Molecular,Microscopic,and Immunochromatographic Detection of Enteroparasitic Infections in Hemodialysis Patients and Related Risk Factors

Abstract

Intestinal parasitic infection (IPI) is one of the important causes of morbidity and mortality in patients with chronic renal failure (CRF). Patients with CRF are more prone to infections due to acquired immunodeficiency caused by uremia. This study aims at determining the prevalence of parasitic intestinal infections in hemodialysis (HD) patients in Makkah, Saudi Arabia, and at comparing the techniques used for the detection of intestinal parasites. One hundred stool samples were collected from Saudi HD patients from two dialysis centers of two hospitals in Makkah City, and 50 samples were collected randomly from healthy individuals that served as control. The laboratory tests were carried out at King Fahd Medical Research Center, King Abdulaziz University, Jeddah. One stool sample was collected from each participant and examined with different techniques. The diagnosis was carried out using the direct wet smear with normal saline and native-Lugol's, Ritchie technique, rapid diagnostic test (ImmunoCard STAT! CGE), and molecular techniques (real-time polymerase chain reaction). The relation between age, gender, weight, and height to calculate body mass index, level of education, time of the HD, lifestyle, residence status, several gastrointestinal symptoms, blood pressure, diabetes, irritable bowel disease, and other factors was studied. Intestinal parasites were found in 38% of the HD patients and 36% of the control group. The most encountered intestinal parasites in the HD patients and control group were Blastocystis hominis (31%) and (34%), Entamoeba histolytica (3%) and (2%) respectively, Endolimax nana (4%) in the HD group, Giardia lamblia (4%) in the control group, and no positive results for Cryptosporidium or helminths in both groups. The IPIs should be suspected in all cases of immunodeficient patients, and stool samples should be ordered as routine with other tests in interval times and examined using special techniques. The physicians should be aware of the similarity between HD and intestinal parasitosis symptoms to perform diagnostic tests and determine the suitable treatment.

Introduction

Globally, intestinal parasites are considered among the biggest cause of diseases and sickness worldwide (Amer et al., 2016). Indeed, intestinal parasitic infections (IPIs) affect ∼3.5 billion people worldwide, among whom 450 million are sick (Amer et al., 2016; Feleke et al., 2019).

Renal insufficiency is a disease that increases the sensitivity of humans to infections, including intestinal parasites (Shehata et al. 2019). Chronic kidney disease (CKD) is associated with failure in renal function for many reasons and may lead to death. CKD developed into end-stage renal disease (ESRD), which entails hemodialysis (HD) or kidney transplantation (Omrani et al., 2015). Patients undergoing HD are considered immunocompromised patients and require specific steps in health care to reduce the risk of infection (Esteghamati et al., 2019; Mahmoudi et al., 2020). Infectious diseases and uremic toxins-associated with immune deficiency are the second cause of death among ESRD patients (Omrani et al., 2015; El-Kady et al., 2018; Zueter et al., 2019; Taghipour et al., 2020).

Acquiring persistent diarrhea and malabsorption are especially concerning, because they expose immunodeficient patients to a great life-threatening complication (Rasti et al., 2017; Jeske et al., 2018). On the other hand, IPIs in non-immunocompromised individuals are more commonly self-limiting (Mahmoudi et al., 2020).

Studies on the prevalence of IPIs are limited in HD patients worldwide. No previous studies estimated the prevalence of intestinal parasites in HD patients in Makkah, Saudi Arabia. Therefore, we conducted a study including several techniques to investigate the prevalence of IPIs and related factors among HD patients in Makkah. Our results could have major implications for the awareness about IPIs among HD patients.

Materials and Methods

Ethical approval and consent to participate

This study has been approved by the Medical Ethics Committee of the Saudi Ministry of Health, Makkah (no. 1439-280594) before experiments were started. Informed consent was obtained from each participant.

Patients' samples

One hundred fifty stool samples were collected in clean plastic containers with a completed questionnaire for each participant. The samples were collected between July 2018 and November 2019. Some laboratory investigations were delayed for 1 year due to the COVID-19 pandemic. All patients were Saudis attending Al-Noor Specialist Hospital and King Faisal Hospital in Makkah. The overall recruited patients were 100 HD and 50 non-HD (control group).

Macroscopic examination

Stool samples were checked for color, consistency, mucous, blood, tapeworm segments, and adult worms.

Direct smears

One to two milligrams of stool were mixed with 2 drops of normal saline on a glass slide, and similar steps were conducted by using iodine. Then, each slide was covered with a cover glass and examined using objective lenses 10 × and 40 × (Nlinwe and Kumla, 2020).

Formal ether concentration technique (Ritchie technique)

This sedimentation technique was performed as previously described to enhance the chance of detection by using about 2 g of stool sample to concentrate the diagnostic stages at the bottom of the tube (Aldahhasi et al., 2020; Alharbi et al., 2020; Demeke et al., 2021).

Trichrome permanent staining

To confirm the morphology of the protozoan parasites, polyvinyl alcohol (PVA)-preserved stool samples were stained with Para-Pak^® trichrome kit (Cat. No. 400101; Meridian, Biosciences, Milan, Italy), according to the manufacturer's instructions, and then they were examined microscopically by oil immersion objective lens as previously described (Aldahhasi et al., 2020).

Rapid chromatographic immunoassay test

A previously described rapid diagnostic test (RDT), using ImmunoCard STAT! CGE kit (Cat. No. 751420; Meridian, Biosciences) was performed according to the manufacturer's instructions to detect Giardia lamblia, Cryptosporidium parvum, and Entamoeba histolytica (Alharbi et al., 2020).

DNA extraction

The DNA extraction was performed on frozen stool specimens stored at −20°C, using QIAamp Fast DNA stool mini kit according to the manufacturer's instructions (Qiagen, 2021).

Real-time polymerase chain reaction

Real-time polymerase chain reaction (PCR) was performed to target genes related to E. histolytica (SSU rRNA); G. lamblia (Beta-giardin); C. parvum (Cowp1); and Blastocystis hominis (18s rRNA). The primers and probes set consist of the forward primer (F), the reverse primer (R), and the probe primer (Llewellyn et al., 2016; Won et al., 2016) (Table 1).

Table 1.

Primers and Probes

Parasite	Gene target	F primer, 5'—3'	R primer, 5'—3'	Probe primer, 5'—3'
Entamoeba histolytica	SSU rRNA	AACAGTAATAGTTTCTTTGGTTAGTAAAA	CTTAGAATGTCATTTCTCAATTCAT	ROX—ATTAGTACAAAATGGCCAATTCATTCA—IBRQ
Giardia lamblia	Beta-giardin	GAGGTCAAGAAGTCCGCCG	CAAGGGACTTGCGGAAGTTT	FAM—ACGATCAAGGAGGAGATCGA—BHQ
Cryptosporidium parvum	Cowp 1	TGTGTTCAATATCTCCCTGCAAA	GCATGTCGATTCAATTTGTCA	Quasar670—CCTCCTGGATTCAATTTGTCA—BHQ
Blastocystis hominis	18s rRNA	GGAGAGGGAGCCTGAGAGAT	AACATTGTTCCGCATTGTGA	VIC—ATCCTGACACAGGGAGGTAGTG—non fluorescent quencher MGB

BHQ, black hole quencher plus; IBRQ, lowa black RQ; MGB, minor groove binder.

The stock solutions for primers and probes were prepared according to the requirements specified by the manufacturer (Humanizing Genomic Macrogen Clinical Lab, Korea) in each vial and to the performed techniques. Vials were centrifuged for 1 min at 13,400 rpm; different volumes of DNase/RNase-free distilled water were added to each primer, then mixed carefully, and finally centrifuged again at full speed for 1 min.

To prepare primers and probe for use, we diluted the stock 1:10 (10 μL stock solution and 90 μL DNase/RNase-free distilled water) and then stored at −20°C.

According to the manufacturer's instructions of QuantiTect^® Probe PCR kit (Qiagen, Germany), the real-time PCR master mix reaction components were prepared as previously described (Alharbi et al., 2020). Then, 15.5 μL from the reaction mix was dispensed into a PCR plate (96 wells strips tubes); next, 4.5 μL of the purified DNA was added. Negative control containing only DNase/RNase-free distilled water was used in each run. The plate was sealed, then centrifuged for 1 min, and finally transferred into Applied Biosystems™ 7500 Fast Real-Time PCR System. Data analysis was done by calculating the threshold cycle number (Ct value) that presented the positive amplification of genes in real-time-cycler number.

Statistical analysis

The collected data were revised, coded, tabulated, and analyzed using SPSS, version 25. Data were submitted, appropriate tests for each parameter were carried out, and p-value of <0.05 was considered significant.

Results

Demographic characteristics

The age of the patients ranged from 20 to 78 years (47.89 ± 14.4 SD). Males and females represented 89 (59%) and 61 (41%), respectively, whereas 103 (69%) were married, 38 (25%) were single, 6 (4%) were widows, and 3 (2%) were divorced. Education level varied as 31 (20.7%) were illiterate, 25 (16.7%) elementary level, 25 (16.7%) intermediate level, 40 (26.6%) high school level, and 29 (19.3%) with bachelor's degree. The HD patients were significantly associated with lower education levels (p < 0.05).

Out of the analyzed samples, 38 out of 100 (38%) of HD patients and 18 out of 50 (36%) of the control group revealed infection with intestinal parasites.

All infected cases in the control group have normal weight, whereas among the infected HD patients, 8 (21%) were underweight, 29 (76%) normal weight, with a significant association between underweight and infected HD patients (p < 0.05).

The commencement of dialysis for patients ranged from 1 month to 31 years; however, there was no significant association with IPIs (p > 0.05). Similarly, in all studied groups, there was no significant association between IPIs and cases on a diet program, residency type, washing fruits/vegetables, and washing hands before eating or after toilet (p > 0.05). On the other hand, there was a significant association between the rate of infection and watching health educational programs and familiarity with parasites (p < 0.001).

As shown in Table 2, HD patients have the highest frequency of abdominal pain (62%), nausea (47%), diarrhea (42%), vomiting (30%), and constipation (11%). However, in the control group, 40% have abdominal pain, nausea (34%), diarrhea (22%), vomiting (8%), and no cases of constipation. Eighteen HD patients revealed a significant relationship between IPI and high blood pressure, diabetes, and irritable bowel disease (p < 0.005). Asymptomatic cases were among 32% of the control group.

Table 2.

The Clinical Symptoms and Infection Rates

Clinical characteristics		Control (N = 50)			HD (N = 100)			p ₁ OR (95% CI)	p ₂ OR (95% CI)
Clinical characteristics		Total, n (%)	Non-infected, n (%)	Infected, n (%)	Total, n (%)	Non-infected, n (%)	Infected, n (%)	p ₁ OR (95% CI)	p ₂ OR (95% CI)
Asymptomatic	Yes	16 (32)	11 (34)	5 (28)	13 (13)	9 (15)	4 (11)	0.005 2.03 (1.22–3.41)	0.101 1.24 (0.73–2.10)
Asymptomatic	No	34 (68)	21 (66)	13 (72)	87 (87)	53 (85)	34 (89)	0.005 2.03 (1.22–3.41)	0.101 1.24 (0.73–2.10)
Abdominal pain	Yes	20 (40)	10 (31)	10 (56)	62 (62)	37 (60)	25 (66)	0.011 1.73 (1.13–2.63)	0.137 1.37 (0.91–2.07)
Abdominal pain	No	30 (60)	22 (69)	8 (44)	38 (38)	25 (40)	13 (34)	0.011 1.73 (1.13–2.63)	0.137 1.37 (0.91–2.07)
Nausea	Yes	17 (34)	10 (31)	7 (38.9)	47 (47)	29 (47)	18 (47)	0.129 1.40 (0.91–2.13)	0.706 1.08 (0.72–1.64)
Nausea	No	33 (66)	22 (69)	11 (61.1)	53 (53)	33 (53)	20 (53)	0.129 1.40 (0.91–2.13)	0.706 1.08 (0.72–1.64)
Vomiting	Yes	4 (8)	2 (6)	2 (11)	30 (30)	18 (29)	12 (32)	0.002 2.52 (1.39–4.58)	0.099 1.14 (0.70–1.85)
Vomiting	No	46 (92)	30 (94)	16 (89)	70 (70)	44 (71)	26 (68)	0.002 2.52 (1.39–4.58)	0.099 1.14 (0.70–1.85)
Diarrhea	Yes	11 (22)	8 (25)	3 (16)	42 (42)	26 (42)	16 (42)	0.016 1.77 (1.12–2.79)	0.060 0.94 (0.61–1.45)
Diarrhea	No	39 (78)	24 (75)	15 (84)	58 (58)	36 (58)	22 (58)	0.016 1.77 (1.12–2.79)	0.060 0.94 (0.61–1.45)
Constipation	Yes	0 (0)	0 (0)	0 (0)	11 (11)	6 (10)	5 (13)	0.015 —	0.109 —
Constipation	No	50 (100)	32 (100)	18 (100)	89 (89)	56 (90)	33 (87)	0.015 —	0.109 —
Diseases^a	Yes	0 (0)	0 (0)	0 (0)	18 (18)	6 (10)	12 (32)	0.002 —	0.007 —
Diseases^a	No	50 (100)	32 (100)	18 (100)	82 (82)	56 (90)	26 (68)	0.002 —	0.007 —

Irritable bowel disease, blood pressure, heart disease, diabetes, and TSH disorder.

HD, hemodialysis; P₁, between all total cases in both groups; P₂, between infected cases in both groups; TSH, thyroid-stimulating hormone.

Stool physical characteristics

The color and consistency of stool among both groups revealed variations, but with no significant differences (p > 0.05). However, the main specimen consistency of infected patients in both groups was soft (56%).

Detected parasites

As shown in Tables 3 and 4, the most encountered parasites in the single and double infections were B. hominis (31%) and (34%), E. histolytica (3%) and (2%), in HD patients and the control group respectively. Endolimax nana (4%) was found only in the HD patients, and G. lamblia (4%) was found only in the control group. No positive results for Cryptosporidium and helminths were observed in both groups. There was no significant difference between IPIs and health status of the participants (p > 0.05). Similarly, no significant difference was found for the detected parasites and the used techniques.

Table 3.

Prevalence of Intestinal Parasitic Infections

Infection type	Parasite	Control, n (%) 95% CI	HD, n (%) 95% CI	Total, n (%) 95% CI	p OR (95% CI)
Single	Blastocystis hominis	15 (30) 17.30–42.70	31 (31) 21.90–40.0	46 (30.7) 23.3–38.1	0.900 1.029 (0.656–1.615)
	Entamoeba histolytica	1 (2) 0.001–5.90	1 (1) 0.01–2.90	2 (1.3) 0.001–3.10	0.717 1.284 (0.332–4.962)
	Endolimax nana	0 (0) —	1 (1) 0.01–2.90	1 (0.7) 0.001–2.00	—
	Giardia lamblia	0 (0) —	0 (0) —	0 (0) —	—
	Cryptosporidium parvum	0 (0) —	0 (0) —	0 (0) —	—
Double	B. hominis+E. histolytica	0 (0) —	2 (2) 0.001–4.70	2 (1.3) 0.001–3.10	—
	B. hominis+E. nana	0 (0) —	3 (3) 0.001–6.50	3 (2) 0.002–4.20	—
	B. hominis+G. lamblia	2 (4) 0.001–9.40	0 (0) —	2 (1.3) 0.001–3.10	—

In direct smears and Ritchie technique; E. histolytica represents E. histolytica/Entamoeba dispar/Entamoeba moshkovskii.

HD, hemodialysis.

Table 4.

Frequency of Parasites Detected by Each Techniques

Parasite	Direct smears		Ritchie technique		RDT		Real-time PCR
Parasite	Control, n (%) 95% CI	HD, n (%) 95% CI	Control, n (%) 95% CI	HD, n (%) 95% CI	Control, n (%) 95% CI	HD, n (%) 95% CI	Control, n (%) 95% CI	HD, n (%) 95% CI
Blastocystis hominis	16 (32) 19.10–44.90	31 (31) 21.90–40.10	13 (26) 13.80–38.20	20 (20) 12.20–27.80	NA	NA	17 (34) 20.90–47.10	31 (31) 21.90–40.10
Entamoeba histolytica	1 (2) 0.001–5.90	0 (0) —	0 (0) —	0 (0) —	1 (2) 0.001–5.90	3 (3) 0.001–6.30	0 (0) —	0 (0) —
Giardia lamblia	2 (4) 0.001–9.40	0 (0) —	2 (4) 0.001–9.40	0 (0) —	2 (4)	0 (0) —	2 (4) 0.001–9.40	0 (0) —
Cryptosporidium parvum	0 (0) —	0 (0) —	0 (0) —	0 (0) —	0 (0) —	0 (0) —	0 (0) —	0 (0) —
Endolimax nana	0 (0) —	4 (4) 0.002–7.80	0 (0) —	1 (1) 0.001–3.00	NA	NA	NA	NA
P	>0.05

In direct smears and Ritchie technique; E. histolytica represents E. histolytica/Entamoeba dispar/Entamoeba moshkovskii.

HD, hemodialysis; NA, not applicable; PCR, polymerase chain reaction; RDT, rapid diagnostic test.

Performance criteria of the performed techniques using Kappa test

Only B. hominis and G. lamblia were detected by all used techniques. When direct smears were proposed to be the gold standard method for B. hominis detection, substantial agreement (0.764) was found with Ritchie technique, and perfect agreement (0.831) with real-time PCR. However, when Ritchie technique was assumed to be the gold standard, substantial agreement was found with direct smears and real-time PCR.

Then, when real-time PCR was nominated to be the gold standard, fair agreement was found with direct smears, and substantial agreement with Ritchie technique (Table 5). On the other hand, G. lamblia detection revealed perfect agreement (1) with all techniques, including direct smears, RDT, and real-time PCR (Table 6).

Table 5.

Agreement Between Techniques Used to Detect Blastocystis hominis, in Relation to Direct Smears (A); Ritchie Technique (B); and Real-Time Polymerase Chain Reaction (C)

		N	P	k	Agreement
A
Ritchie technique	N	^TN103	^FN14	0.764	Substantial
Ritchie technique	P	^FP0	^TP33	0.764	Substantial
Real-time PCR	N	^TN97	^FN5	0.831	Perfect
Real-time PCR	P	^FP6	^TP42	0.831	Perfect
B
Direct smears	N	^TN103	^FN0	0.764	Substantial
Direct smears	P	^FP14	^TP33	0.764	Substantial
Real-time PCR	N	^TN99	^FN3	0.649	Substantial
Real-time PCR	P	^FP18	^TP30	0.649	Substantial
C
Direct smears	N	^TN97	^FN6	0.831	Perfect
Direct smears	P	^FP5	^TP42	0.831	Perfect
Ritchie technique	N	^TN99	^FN18	0.649	Substantial
Ritchie technique	P	^FP3	^TP30	0.649	Substantial

FN, false negative; FP, false positive; k, kappa coefficient; N, negative; P, positive; PCR, polymerase chain reaction; TN, true negative; TP, true positive.

Table 6.

Agreement Between Techniques to Detect Giardia lamblia, in Relation to Direct Smears (A); Rapid Diagnostic test (B); and Real-Time Polymerase Chain Reaction (C)

		N	P	k	Agreement
A
RDT	N	^TN148	^FN0	1	Perfect
RDT	P	^FP0	^TP2	1	Perfect
Real-time PCR	N	^TN148	^FN0	1	Perfect
Real-time PCR	P	^FP0	^TP2	1	Perfect
B
Direct smears	N	^TN148	^FN0	1	Perfect
Direct smears	P	^FP0	^TP2	1	Perfect
Real-time PCR	N	^TN148	^FN0	1	Perfect
Real-time PCR	P	^FP0	^TP2	1	Perfect
C
Direct smears	N	^TN148	^FN0	1	Perfect
Direct smears	P	^FP0	^TP2	1	Perfect
RDT	N	^TN148	^FN0	1	Perfect
RDT	P	^FP0	^TP2	1	Perfect

FN, false negative; FP, false positive; k, kappa coefficient; N, negative; P, positive; PCR, polymerase chain reaction; RDT, rapid diagnostic test; TN, true negative; TP, true positive.

Sensitivity, specificity, and predictive values

Validity testing of the applicable techniques for the detection of B. hominis and G. lamblia is presented in Table 7.

Table 7.

Validity Testing of Used Techniques for Blastocystis hominis and Giardia lamblia Detection in Relation to Direct Smears (A); Ritchie Technique (B); and Real-Time Polymerase Chain Reaction (C)

	Parasite	Sensitivity % 95% CI	Specificity % 95% CI	PPV % 95% CI	NPV % 95% CI	Accuracy % 95% CI
A
Ritchie technique	B. hominis	71.40 55.42–84.28	99.10 94.95–99.98	96.80 80.86–99.53	89.90 84.68–93.50	91.30 85.64–95.30
Ritchie technique	G. lamblia	100 15.81–100	100 97.54–100	100 —	100 —	100 97.57–100
RDT	G. lamblia	100 15.81–100	100 97.54–100	100 —	100 —	100 97.57–100
Real-time PCR	B. hominis	88.1 74.37–96.02	91.70 84.77–96.12	80.40 68.53–88.58	95.20 89.67–97.83	90.70 84.84–94.80
Real-time PCR	G. lamblia	100 15.81–100	100 97.54–100	100 —	100 —	100 97.57–100
B
Direct smears	B. hominis	96.80 83.30–99.92	89.90 83.05–94.68	71.40 59.29–81.10	99.10 93.96–99.86	91.30 85.64–95.30
Direct smears	G. lamblia	100 15.81–100	100 97.54–100	100 —	100 —	100 97.57–100
RDT	G. lamblia	100 15.81–100	100 97.54–100	100 —	100 —	100 97.57–100
Real-time PCR	B. hominis	90.30 74.25–97.96	84.90 77.15–90.78	60.90 50.02–70.74	97.10 91.97–99.00	86 79.40–91.12
Real-time PCR	G. lamblia	100 15.81–100	100 97.54–100	100 —	100 —	100 97.57–100
C
Direct smears	B. hominis	80.40 66.09–90.64	95.20 89.14–98.42	88.10 75.67–94.63	91.70 85.94–95.19	90.70 84.84–94.80
Direct smears	G. lamblia	100 15.81–100	100 97.54–100	100 —	100 —	100 97.57–100
Ritchie technique	B. hominis	60.90 45.37–74.91	97.10 91.80–99.40	90.30 74.92–96.68	84.90 79.62–88.96	86 79.40–91.12
Ritchie technique	G. lamblia	100 15.81–100	100 97.54–100	100 —	100 —	100 97.57–100
RDT	G. lamblia	100 15.81–100	100 97.54–100	100 —	100 —	100 97.57–100

NPV, negative predictive value; PCR, polymerase chain reaction; PPV, positive predictive value; RDT, rapid diagnostic test.

In relation to direct smears, the validity for the detection of B. hominis by Ritchie technique had sensitivity and specificity of 71.4% and 99.1% respectively, whereas real-time PCR had 88.1% sensitivity and 91.7% specificity. In relation to Ritchie technique, direct smear had 96.8% sensitivity and 89.9% specificity, whereas real-time PCR had 90.3% sensitivity and 84.9% specificity. Finally, in relation to the real-time PCR technique, direct smears had 80.4% sensitivity and 95.2% specificity, whereas Ritchie technique had 60.9% sensitivity and 97.1% specificity respectively.

The validity of all used techniques for the detection of G. lamblia revealed a perfect accuracy of 100%.

Discussion

Uremic toxins can build up in the blood due to a loss of kidney function, which can hinder the humoral and cellular immunity (Zueter et al., 2019; Taghipour et al., 2020) and disturbs the acquisition of immune response to antigens (Nlinwe and Kumla, 2020). Therefore, HD patients are believed to have the risk for hidden intestinal parasites (Zueter et al., 2019).

Globally, the studies on the prevalence of IPIs among HD patients are limited. To the best of our knowledge, the current study is the first in Makkah, Saudi Arabia, to estimate the prevalence of infections with intestinal parasites among HD patients. In the current study, the prevalence of IPIs in HD patients and the control group were 38% and 36%, respectively. In Iran, a study reported an infection rate of 15% in HD patients and 7.3% in the control group (Mahmoudi et al., 2020), whereas another study revealed infection rates of 11.9% and 0% among HD patients and the control group, respectively (Rasti et al., 2017).

Research in Jordan reported 11% of Cryptosporidium spp. among HD patients and 0% in the control group (Zueter et al., 2019). A high intestinal parasitosis of 52.5% and 42% was reported among HD patients in studies done in Egypt and Taif (Hawash et al., 2014; Shehata et al., 2019), whereas in the control group they were 12% and 28% respectively. This high prevalence could be due to the different geographical features and the nationalities of the patients.

In the current study, IPIs were higher in males (61%) than in females (39%). This finding is in line with previous studies in Iran, Egypt, Saudi Arabia, and Pakistan (Naeini et al., 2012; Hawash et al., 2014; Raja et al., 2014; Omrani et al., 2015; El-Kady et al., 2018). Males in these countries work in several outdoor fields unlike females, who are mainly housewives. However, in our study, there was no significant relationship between infection with parasites and the demographic characteristics, including age, marital status, residency, or having a house maid.

Similar findings were documented in previous studies in Turkey and Iran (Naeini et al., 2012; Karadag et al., 2013). However, a study done in Iran by Mohaghegh et al., (2017), found a statistically significant difference between age and infection rate in patients under 20 years old. This may be because young people's lives are full of adventures, and they love to try a wide variety of different foods.

In our study, the education level among HD patients showed a significant difference, which may increase the susceptibility to parasitic infections (p < 0.001), as higher educated people are more aware and careful to pay attention to general and personal hygiene. Although there was no significant association between the commencement of dialysis and infection with parasites (p > 0.05), this agrees with what was revealed from studies in Iran, Egypt, and Turkey (Karadag et al., 2013; Mohaghegh et al., 2017; El-Kady et al., 2018; Mahmoudi et al., 2020).

Corresponding to studies in Egypt and Brazil (Kulik et al., 2008; Shehata et al., 2019), we similarly observed no statistically significant relationship between infected individuals and diarrhea among HD patients. However, studies in Iran showed a significant difference (Barazesh et al., 2015; Omrani et al., 2015; Mohaghegh et al., 2017). Most of the specimens from infected patients in all groups were formed (36%) and soft (48%). However, a study in Egypt found that they were semi-formed to watery in 80% of HD patients and 96% of the control group (El-Kady et al., 2018).

Interestingly, all infected patients of the control group were of normal weight, whereas the infected HD cases were underweighted and of normal weight, with a significant association of underweight with infection. This agrees with a published study by Omrani et al. (2015). In our study, there was a significant association between IPIs, awareness about parasites, and watching health educational programs (p < 0.001).

Intestinal protozoa were detected in 38% of HD patients and 36% of the control group. Our findings agree with previous investigations (Kulik et al., 2008; Naeini et al., 2012; Gil et al., 2013; Omrani et al., 2015; Mahmoudi et al., 2020). The prevalence of IPIs around the world is ranging between 8.2% and 66%, mainly by intestinal protozoa. This could be due to the simple life cycle and the ease of protozoa transmission from person to person (Garcia, 2016).

In the current study, B. hominis was the most encountered parasite. Using direct smears, B. hominis was detected in 31% and 32% among HD patients and the control group respectively; 20% and 26% by Ritchie technique; and 31% and 34% by real-time PCR. This variation between direct smears and Ritchie technique agrees with previous studies (Wakid et al., 2009; Aldahhasi et al., 2020), but without explanation. We assume the possibility of parasites removal along with the debris layer during Ritchie technique.

The pathogenicity of B. hominis is still controversial. It has been suggested that B. hominis may be a commensal organism that becomes pathogenic when the host is immunosuppressed or has other infections (WHO, 2022). Our finding is consistent with a study in Brazil (Gil et al., 2013), which is higher than that reported in two studies in Iran, among HD patients and the control group (Omrani et al., 2015; Mahmoudi et al., 2020).

Although infections by B. hominis have been previously associated with drinking low-quality water (Efstratiou et al., 2017), we assume that it is unlikely that the patients in our study got the infection from contaminated water only because Makkah is supplied with treated water. A study reported that 37.5% of the staff dealing with dialysis patients were infected with intestinal parasites (Seyrafian et al., 2011), which should be considered with full precautions.

In the current research, E. histolytica was detected in 3% among HD patients. This is in line with previous studies in Iran, Egypt, Brazil, Pakistan, and Saudi Arabia (Gil et al., 2013; Raja et al., 2014; Hawash et al., 2015; Omrani et al., 2015; Shehata et al., 2019). On the other hand, other studies in Iran, Egypt, Brazil, and Turkey revealed no cases with E. histolytica (Kulik et al., 2008; Baiomy et al., 2010; Karadag et al., 2013; Mahmoudi et al., 2020). Among 2% of the control group, E. histolytica/Entamoeba dispar/Entamoeba moshkovskii was identified by using direct smears and E. histolytica by RDT, whereas none were identified with real-time PCR. On the other hand, 3% of HD patients were positive for E. histolytica only in RDT, whereas they were negative in other tests.

The giardiasis in the present study was detected in 4% of the control group only by microscopic examinations, RDT, and real-time PCR. This is in line with previous studies in Iran, Turkey, and Egypt (Baiomy et al., 2010; Naeini et al., 2012; Karadag et al., 2013; Omrani et al., 2015).

Our results, in line with previous studies that have been done in Iran and Brazil (Ferreira-Filho et al., 2011; Gil et al., 2013; Barazesh et al., 2015; Mahmoudi et al., 2020), showed that there were no positive cases for C. parvum.

The non-pathogenic parasite E. nana was detected only among 4% of HD patients. This agrees with previous studies in Iran (Naeini et al., 2012; Omrani et al., 2015; Mahmoudi et al., 2020). However, other studies in Egypt, Saudi Arabia, and Turkey did not reveal any case with E. nana (Karadag et al., 2013; Hawash et al., 2015; Shehata et al., 2019).

In agreement with previous studies in Egypt, Saudi Arabia, and Iran (Hawash et al., 2015; Omrani et al., 2015; Shehata et al., 2019), we revealed the absence of helminth infection in both groups. However, other studies detected low incidence of worms' infections in Iran and Brazil (Kulik et al., 2008; Ferreira-Filho et al., 2011; Naeini et al., 2012; Gil et al., 2013; Barazesh et al., 2015; Mahmoudi et al., 2020). This may be due to the indirect complicated life cycle of many helminths to form the infective stages (Garcia, 2016).

Our results show that 88% of the infected cases were having single infection, with no significant difference among groups. However, in Iran a study observed significant differences between types of infection in both groups (Naeini et al., 2012).

Taken together, our results point out variations in parasite detection using microscopic examination techniques. As has been previously suggested, this is related to the ability of the direct wet smears to detect both cyst and trophozoite stages, whereas Ritchie technique is applicable only for cyst stages because trophozoites may stick to the debris layer (Shalaby and Wakid, 2014). On the other hand, fairly in agreement with a study by Llewellyn et al. (2016), we found that some samples were positive by molecular technique and negative by conventional methods and vice versa.

This could be related to the non-homogeneous stool composition and cyst dispersion inside the subsample (Basuni et al., 2011), in addition to the nonuniformly structure of the parasite excretion in the stool samples (Llewellyn et al., 2016). A prior study in Belgium by Van den Bossche et al. (2015) tested the sensitivity and specificity of four RDTs and used the combination of microscopic and enzyme-linked immunosorbent assay techniques as reference method and PCR for confirmation. They showed that the sensitivity of the four RDTs was excellent for E. histolytica and Cryptosporidium but variable for G. lamblia. The specificity for all RDTs were excellent for Cryptosporidium and G. lamblia but without differentiation between E. histolytica and E. dispar.

Conclusions

The IPIs should be suspected in all cases of immunodeficient patients, including HD. Early diagnosis and accurate identification of intestinal parasites would help clinicians to choose the suitable treatment. Our study adds important information related to the low level of awareness among the studied population about intestinal parasites. The results of the study recommend the need for urgent further attention toward public health education about the common intestinal parasites and how to avoid infection.

Footnotes

Acknowledgments

The authors would like to thank the Ministry of Health, Makkah, Saudi Arabia, and the Infectious Agents Unit at King Fahd Medical Research Center for their help and cooperation during this study. Thanks are extended to the cooperated patients and hospitals.

Authors' Contributions

E.O.B. and M.H.W. designed and conceived the study; E.O.B. collected samples; E.O.B. and M.H.W. performed the practical analysis; E.O.B. and M.H.W. participated in the results analysis and discussion; E.O.B. wrote the first draft of the article; M.H.W. edited the final version of the article; and E.O.B. and M.H.W. read and approved the final article.

Disclosure Statement

No competing financial interests exist.

Funding Information

No funding was received for this article.

References

Aldahhasi

, Toulah

, Wakid

. Evaluation of common microscopic techniques for detection of Blastocystis hominis . J Egypt Soc Parasitol, 2020; 50:33–40.

Alharbi

, Toulah

, Wakid

, Azhar

, Farraj

, Mirza

. Detection of Giardia lamblia by microscopic examination, rapid chromatographic immunoassay test, and molecular technique. Cureus, 2020; 12:e10287.

Amer

, Ashankyty

, Haouas

NAS

. Prevalence of intestinal parasite infections among patients in local public hospitals of Hail, Northwestern Saudi Arabia. Asian Pac J Trop Med, 2016; 9:44–48.

Baiomy

AMS

, Mohamed

KAAH

, Ghannam

MAM

, Al-Razek

. Opportunistic parasitic infections among immunocompromised patients. J Egypt Soc Parasitol, 2010; 40:797–807.

Barazesh

, Fouladvand

, Tahmasebi

, Heydari

, Fallahi

. The prevalence of intestinal parasites in hemodialysis patients in Bushehr, Iran. Hemodial Int, 2015; 19:447–451.

Basuni

, Muhi

, Othman

, Verweij

, Ahmad

, Miswan

, Noordin

. A pentaplex real-time polymerase chain reaction assay for detection of four species of soil-transmitted helminths. Am J Trop Med Hyg, 2011; 84:338–343.

Demeke

, Fenta

, Dilnessa

. Evaluation of wet mount and concentration techniques of stool examination for intestinal parasites identification at Debre Markos comprehensive specialized hospital, Ethiopia. Infect Drug Resist, 2021; 14:1357–1362.

Efstratiou

, Ongerth

, Karanis

. Waterborne transmission of protozoan parasites: Review of worldwide outbreaks—An update 2011–2016. Water Res, 2017; 114:14–22.

El-Kady

, Fahmi

, Tolba

, Hashim

, Hassan

. Cryptosporidium infection in chronic kidney disease patients undergoing hemodialysis in Egypt. J Parasit Dis, 2018; 42:630–635.

10.

Esteghamati

, Khanaliha

, Bokharaei-Salim

, Sayyahfar

, Ghaderipour

. Prevalence of intestinal parasitic infection in cancer, organ transplant and primary immunodeficiency patients in Tehran, Iran. Asian Pac J Cancer Prev, 2019; 20:495–501.

11.

Feleke

, Beyene

, Feleke

, Jember

, Abera

. Intestinal parasitic infection among household contacts of primary cases, a comparative cross-sectional study. PLoS One, 2019; 14:e0221190.

12.

Ferreira-Filho

, da Costa Braga

, de Sa

, Nunes

, Parreira Soares

, Padovese

, de Oliveira

, Ferreira Oliveira

, Dos Passos

, Lemes

. Entamoeba histolytica/entamoeba dispar infection in chronic hemodialysis patients. Saudi J Kidney Dis Transpl, 2011; 22:237–244.

13.

Garcia

. Diagnostic Medical Parasitology. Washington, DC: American Society for Microbiology Press, 2016.

14.

Gil

, Barros

, Macedo NA

, Júnior

, Redoan

, Busatti

, Santos

. Prevalence of intestinal parasitism and associated symptomatology among hemodialysis patients. Rev Inst Med Trop Sao Paulo, 2013; 55:69–74.

15.

Hawash

, Dorgham

, Amir

EAM

, Sharaf

. Prevalence of intestinal protozoa among Saudi patients with chronic renal failure: A case-control study. J Trop Med, 2015; 2015:563478.

16.

Jeske

, Bianchi

, Moura

, Baccega

, Pinto

, Berne

, Villela

. Intestinal parasites in cancer patients in the south of Brazil. Braz J Biol, 2018; 78:574–578.

17.

Karadag

, Tamer

, Dervisoglu

. Investigation of intestinal parasites in dialysis patients. Saudi Med J, 2013; 34:714–718.

18.

Kulik

, Falavigna

DLM

, Nishi

, Araujo

. Blastocystis sp. and other intestinal parasites in hemodialysis patients. Braz J Infect Dis, 2008; 12:338–341.

19.

Llewellyn

, Inpankaew

, Nery

, Gray

, Verweij

, Clements

, McCarthy

. Application of a multiplex quantitative PCR to assess prevalence and intensity of intestinal parasite infections in a controlled clinical trial. PLoS Negl Trop Dis, 2016; 10:e0004380.

20.

Mahmoudi

, Hasani

, Tsiami

, Ashrafi

, Johnson

, Sharifdini

, Karanis

. Intestinal protozoan and helminthic infections among hemodialysis and cancer patients. Parasitol Res, 2020; 119:3053–3059.

21.

Mohaghegh

, Hejazi

, Ghomashlooyan

, Kalani

, Mirzaei

, Azami

. Prevalence and clinical features of Cryptosporidium infection in hemodialysis patients. Gastroenterol Hepatol Bed Bench, 2017; 10:137–142.

22.

Naeini

, Sharifi

, Shahidi

, Taheri

, Seirafian

, Taheri

, Harandi

. Intestinal fungal and parasitic infections in kidney transplant recipients: A multi-center study. Saudi J Kidney Dis Transpl, 2012; 23:677–683.

23.

Nlinwe

, Kumla

. Performance evaluation of direct wet mount technique with respect to formol ether concentration technique, at the Bamenda regional hospital. Int J Med Lab Res, 2020; 5:32–41.

24.

Omrani

, Fallahi

, Rostami

, Siyadatpanah

, Barzgarpour

, Mehravar

, Memari

, Hajialiani

, Joneidi

. Prevalence of intestinal parasite infections and associated clinical symptoms among patients with end-stage renal disease undergoing hemodialysis. Infection, 2015; 43:5370–5544.

25.

Qiagen. Available at: https://www.qiagen.com/us/products/discovery-and-translational-research/dna-rna-purification/dna-purification/genomic-dna/qiaamp-fast-dna-stool-mini-kit/, accessed April 14, 2021 .

26.

Raja

, Abbas

, Hassan

, Luck

, Aziz

, Mubarak

. Prevalence of cryptosporidiosis in renal transplant recipients presenting with acute diarrhea at a single center in Pakistan. J Nephropathol, 2014; 3:127–131.

27.

Rasti

, Hassanzadeh

, Hooshyar

, Momen-Heravi

, Mousavi

, Abdoli

. Intestinal parasitic infections in different groups of immunocompromised patients in Kashan and Qom cities, central Iran. Scand J Gastroenterol, 2017; 52:738–741.

28.

Seyrafian

, Pestechian

, Namdari

, Aviani

, Kerdegari

, Parvizian

, Nasri

. Prevalence of parasitic infections in Iranian stable hemodialysis patients. Appl Med Inf, 2011; 29:31–36.

29.

Shalaby

, Wakid

. Giardiasis in man: Review and updates. J KAU-Med Sci, 2014; 21:81–94.

30.

Shehata

, Hassanein

, Abdul-Ghani

. Opportunistic parasitoses among Egyptian hemodialysis patients in relation to CD4+ T-cell counts: A comparative study. BMC Infect Dis, 2019; 19:480.

31.

Taghipour

, Olfatifar

, Rostami

, Foroutan

, Vasigala

, Norouzi

. Intestinal parasites in hemodialysis patients from developing countries: A systematic review and meta-analysis. Hemodial Int, 2020; 24:12–21.

32.

Van den Bossche

, Cnops

, Verschueren

, Van Esbroeck

. Comparison of four rapid diagnostic tests, ELISA, microscopy and PCR for the detection of Giardia lamblia, Cryptosporidium spp., and Entamoeba histolytica in feces. J Microbiol Methods, 2015; 110:78–84.

33.

Wakid

, Azhar

, Zafar

. Intestinal parasitic infection among food handlers in the Holy City of Makkah during Hajj season 1428 Hegira (2007G). J KAU-Med Sci, 2009; 16:39–52.

34.

WHO World Health Organization. Available at: https://www.who.int/publications/i/item/9789241549950 accessed February 28, 2022 .

35.

Won

, Kim

, Kee

, Shin

, Suh

, Chai

, Ryang

, Shin

. Multiplex real-time PCR assay targeting eight parasites customized to the Korean population: Potential use for detection in diarrheal stool samples from gastroenteritis patients. PLoS One, 2016; 11:e0166957.

36.

Zueter

, Hijjawi

, Hamadeneh

, Al-Sheyab

, Hatamleh

. Cryptosporidiosis among hemodialysis patients in Jordan: First preliminary screening surveillance. Trop Med Infect Dis, 2019; 4:131.