Serotyping and Identification of Antimicrobial Resistance Genes in Avian Pathogenic Escherichia coli Isolated from Poultry Flocks in Jiangxi Province,China

Abstract

Avian pathogenic Escherichia coli (APEC) is an important bacterial pathogen that causes severe respiratory and systemic infections in poultry. Our previous research investigated the prevalence and antimicrobial resistance phenotypes of APEC isolated from poultry flocks in Jiangxi Province, China. The present study aims to further identify the serotypes and the carbapenem-resistant gene bla _NDM in APEC strains. Serotype investigations revealed that the most dominant serotype was O24 (53.2%), followed by O78 (11.9%), O2 (3.2%), O18 (2.4%), O45 (0.8%), and O88 (0.8%). Serotypes O1, O30, and O65 were not detected, and 35 strains (27.8%) were un-typed. The identified genes bla _NDM-5 and bla _NDM-1 shared a close phylogenetic distance with Klebsiella sp. and Acinetobacter sp. isolated from river and human feces, respectively. Two APEC strains carrying bla _NDM-5 and bla _NDM-1 were subjected to whole-genome sequencing and analysis. The results showed that bla _NDM-5 was associated with the mobile genetic element IS5 and bla _NDM-1 was associated with the mobile genetic element ISAba125. Current study findings can be helpful for effective vaccine development and provide a deep understanding of APEC infections and antimicrobial resistance in poultry flocks.

Introduction

Avian pathogenic Escherichia coli (APEC), one of the most important bacterial pathogens, is responsible for significant economic losses in the poultry industry due to its high morbidity and mortality and reduced productivity (Christensen et al., 2021). APEC is a frequent cause of various extraintestinal infections in poultry, such as pericarditis, airsacculitis, perihepatitis, and peritonitis (Hu et al., 2022). APEC also has potential risks to be a zoonotic pathogen that infects humans through the environment or the consumption of animal-origin foods (Li et al., 2020). Protective and therapeutic strategies for APEC infection usually involve antibacterial drugs, vaccine prevention, probiotics, phage therapy, and various new therapies, such as innate immune stimulants, growth and quorum sensing inhibitors, and antimicrobial peptides (Kathayat et al., 2021). However, the emergence of severe antimicrobial resistance and the escalating prevalence of multidrug-resistant strains increases the complexity of treatment and controlling APEC infections (Wang et al., 2018).

Jiangxi is one of the largest provinces within the poultry industry in China. Poultry breeding in Jiangxi faces challenges due to its large-scale farming practices, including high incidence of bacterial diseases and difficulties in their prevention and treatment (Li et al., 2021). Research on the detailed characteristics of APEC strains in this region is limited. Our previous investigation on the prevalence and antimicrobial resistance profile of 126 APEC strains isolated from poultry flocks in Jiangxi Province revealed high levels of multidrug resistance in the strains and identified two bla _NDM-positive APEC strains (Tan et al., 2023).

In this study, serotyping of APEC strains were performed using PCR assays, and dominant serotypes were investigated. The bla _NDM genes were amplified, sequenced, and analyzed. The two identified bla _NDM-positive APEC strains were subjected to whole-genome sequencing. Antimicrobial resistance genes (ARGs) and related mobile genetic elements (MGEs) involved in the strains were subsequently analyzed. Our findings provide a deep understanding of APEC in poultry flocks and help promote the development of novel prevention strategies for preventing and controlling APEC infections.

Materials and Methods

Genome extraction

APEC strains were recovered and expanded at 37°C in lysogeny broth (Hopebio, Qingdao, China). Bacterial DNA was extracted using a MiniBEST Bacteria Genomic DNA Extraction Kit (TaKaRa, Dalian, China) in accordance with the manufacturer’s instructions and dissolved in 10 mmol/L Tris–HCl buffer (pH 7.5) in the final step. DNA samples were stored at −20°C for subsequent assays.

Molecular serotyping

Ten primer pairs (Table 1) were used to identify specific serotypes (O1, O2, O18, O24, O30, O45, O65, O78, and O88) from bacterial genomes through simplex-PCR assays (DebRoy et al., 2011; Iguchi et al., 2015). Each 20 μL reaction system was composed of 10 μL of Premix Taq (TaKaRa), 1 μL of forward primer, 1 μL of reverse primer, 1 μL of bacterial genome, and 7 μL of double-distilled H₂O (ddH₂O). The PCR conditions were as follows: initial incubation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at specific temperatures (Table 1) for 30 s, extension at 72°C for 1 min, and a final extension at 72°C for 5 min. The PCR amplification products were separated on a 1% agarose gel that includes GelRed (Biotium, California, USA). ddH₂O served as the negative control during all PCR assays.

Table 1.

Primers Used in This Study

Primer name	Primer sequence (5ʹ–3ʹ)	Amplicon Size (bp)	Annealing temperature	Target gene	Reference
Serotyping
O1-F	GTGAGCAAAAGTGAAATAAGGAACG	1098	57°C	wzx	(DebRoy et al., 2021)
O1-R	CGCTGATACGAATACCATCCTAC
O2x-F	TGGCCTTGTTCGATATACTGCGGA	819	60°C	wzx
O2x-R	TCACGAGCTGAGCGAAACTGTTCA
O2y-F	TGCAACTCATTGGTCTGCTTTGCC	351	60°C	wzy
O2y-F	CGGAAAGCCATAACAGGTAGAGAG
O18-F	GTTCGGTGGTTGGATTACAGTTAG	551	57°C	wzx
O18-R	CTACTATCATCCTCACTGACCACG
O24-F	TGGGATTTATGCGGTTGCTT	233	55°C	wzx	(Iguchi et al., 2015)
O24-R	TGCGAGAAGAGGAGTAGTCGA
O30-F	GAATGGGAGGGGATATCAGAA	894	56°C	wzy
O30-R	TTGCGCTACCCTGAATAGCAT
O45-F	GTCCCCAGGGTTTGTGTATG	916	56°C	wzy
O45-R	AATAAGGGAGCCCGCGAT
O65-F	TGTTGGCGCTGGTTTTATGTT	381	60°C	wzy
O65-R	CCCATAATTGCACCGCATAA
O78-F	GGTATGGGTTTGGTGGTA	992	57°C	wzx
O78-R	AGAATCACAACTCTCGGCA
O88-F	CTGCGCTTGGAGCATTCTAT	781	57°C	wzy
O88-R	GGCGCGAAACTTTCATATGC
Resistant gene
NDM-F	CACCTCATGTTTGAATTCGCC	984	58°C	bla _NDM	(Zafer et al., 2015)
NDM-R	CTCTGTCACATCGAAATCGC	984	58°C		(Zafer et al., 2015)

APEC, avian pathogenic Escherichia coli.

Detection of bla_NDM

bla _NDM genes were amplified from the bacterial genomes using the primer pair NDM-F/NDM-R (Table 1). Each 50 μL reaction system was prepared in a volume of 50 μL consisting of 5 μL of 10× PCR buffer (TaKaRa), 4 μL of dNTP mixture (TaKaRa), 1 μL of Taq polymerase (TaKaRa), 1 μL of forward primer, 1 μL of reverse primer, 2 μL of bacterial genome, and 36 μL of ddH₂O. The PCR conditions were as follows: initial incubation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, and a final extension at 72°C for 5 min. The amplified PCR products were then sent to Sangon Biotech (Shanghai) Co., Ltd. (China) for nucleotide sequencing.

Construction of phylogenetic tree

Through the BLAST analysis of the sequencing results of the two bla _NDM genes, eight or ten trains carrying these bla _NDM genes with high sequence homology were selected to construct phylogeny tree. The distance trees were then exported using the BLAST online tool. Beautification and editing of the distance trees were performed with MEGA Version 11 software (version 11.0.13) (www.megasoftware.net).

Whole-genome sequencing and analysis

Sequencing libraries of the extracted genomic DNA samples were constructed after quality confirmation. Whole-genome sequencing was performed using the Illumina NovaSeq platform at Sangon Biotech (Shanghai) Co., Ltd. The raw data were assembled using SPAdesv3.12.0. The serotypes, ARGs, and MGEs of the two bla _NDM-positive APEC strains were identified by uploading FASTA sequences and performing online analysis on The Center for Genomic Epidemiology (https://cge.cbs.dtu.dk/services/).

Results

Identification of O-serotypes

PCR assays showed that 35 strains were un-typed, accounting for 27.8% of all the APEC isolates. The remaining 91 strains can be classified into six serotypes, namely, O2, O18, O24, O45, O78, and O88 (Fig. 1). Serotypes O1, O30, and O65 were not detected. Details of serotype, host, sample, and collection time of each strain are listed in Supplementary Table S1.

FIG. 1.

PCR amplification for the serotype identification of APEC strains. M represents the DNA marker (100–3000 bp). − represents the negative control. APEC, avian pathogenic Escherichia coli.

As shown in Figure 2, the predominant serotype was O24 (53.2%, 67/126), whether in ducks (51.4%, 54/105), chickens (63.2%, 12/19), or geese (50.0%, 1/2). The proportions of other serotypes were as follows: O78 (11.9%, 15/126), O2 (3.2%, 4/126), O18 (2.4%3/126), O45 (0.8%, 1/126), and O88 (0.8%, 1/126). Among the duck-sourced APEC strains, O78 was the second most common serotype accounting for 12.4% (13/105), followed by O2 (3.8%, 4/105). Among the chicken-sourced APEC strains, O18 was the second most common serotype accounting for 15.8% (3/19), followed by O78 (10.5%, 2/19).

FIG. 2.

Detection frequency of specific O-serotypes in chickens, ducks, and geese. NT represents un-typed strains.

Analysis of the blaNDM genes

Given the high multidrug resistance rate of the APEC strains, the broad-spectrum resistance gene bla _NDM was examined (Tan et al., 2023). PCR assays confirmed that the two strains, APEC-93 and APEC-103, were bla _NDM-positive strains. These positive PCR products were subsequently sequenced and identified as bla _NDM-5 and bla _NDM-1. Further analysis showed that the bla _NDM-5 gene (GenBank accession number: OR351943) carried by APEC-93 had the highest similarity to Klebsiella sp.SKJ2, which was isolated from a river in India (Fig. 3). In addition, the bla _NDM-1 gene (GenBank accession number: OR351944) in APEC-103 exhibited a close relationship with Acinetobacter sp. NF403, which was isolated from human feces in southern China (Fig. 4).

FIG. 3.

Phylogenetic tree based on the bla _NDM-5 gene carried by one APEC strain. GenBank accession numbers follow the names of bacterial strains. APEC, avian pathogenic Escherichia coli.

FIG. 4.

Phylogenetic tree based on the bla _NDM-1 gene carried by one APEC strain. GenBank accession numbers follow the names of bacterial strains. APEC, avian pathogenic Escherichia coli.

Analysis of genome sequencing results

APEC-93 and APEC-103 were subjected to whole-genome sequencing to further investigate the genetic characteristics associated with ARGs. The sequences were uploaded to NCBI (BioProject ID: PRJNA1077093). Genome analysis results indicated that the serotypes of APEC-93 and APEC-103 are O63:H4 and O24:H21, respectively (Table 2), which were in agreement with the serotyping results of PCR (Supplementary Table S1).

Table 2.

Genetic Characteristics Associated with the Antimicrobial Resistance Genes of Two bla _NDM-Positive Strains

Strains	Serotype	Mobile genetic elements					Other antimicrobial resistance genes
Strains	Serotype	Name	Family	Type	Strand	Associated resistance genes	Other antimicrobial resistance genes
APEC-93	O63:H4	ISEc59	IS6	Insertion sequence	Forward	aph(3′)-Ia, aac(3)-IV, aph(4)-Ia	bla _OXA-10, bla _TEM-1B, tet(A), aph(3″)-Ib, aph(6)-Id, floR, aadA1, sul3, qacL, sitABCD, ARR-2, cmlA1, sul2, lnu(F), aadA2b, dfrA14
		IS5	IS5	Insertion sequence	Forward	bla _NDM-5
		ISKpn19	ISKra4	Insertion sequence	Reverse	qnrS1
APEC-103	O24:H21	ISAba125	IS30	Insertion sequence	Forward	bla _NDM-1	bla _TEM-20, bla _OXA-10, bla _CTX-M-65, aadA1, lnu(F), ARR-2, cmlA1, tet(A), sitABCD, dfrA14
		ISEc59	IS6	Insertion sequence	Reverse	aph(3′)-Ia, aph(3″)-Ib, aph(6)-Id, aac(3)-IV, aph(4)-Ia
		IS1006	IS6	Insertion sequence	Reverse	floR
		ISKpn19	ISKra4	Insertion sequence	Forward	qnrS1

APEC, avian pathogenic Escherichia coli.

Previous antimicrobial susceptibility assays showed that APEC-93 and APEC-103 were resistant to nearly all tested antimicrobial drugs such as penicillins, cephalosporins, tetracycline, chloramphenicol, macrolide, quinolones, and aminoglycosides except for polymyxin (Tan et al., 2023). Correspondingly, multiple ARGs were discovered in the two APEC strains (Table 2), such as carbapenemase-resistant gene bla _NDM; β-lactamase-resistant genes bla _OXA, bla _TEM, and bla _CTX-M); and aminoglycoside-resistant genes aph(3′)-Ia, aac(3)-IV, and aph(4)-Ia. Moreover, MGEs were observed upstream of the bla _NDM genes and on the chromosomes. The MGE associated with bla _NDM-5 was IS5 and the MGE associated with bla _NDM-1 was ISAba125. Other MGEs and related ARGs were also identified and listed in Table 2.

Discussion

APEC is an opportunistic pathogen often associated with stressful factors, such as crowding, poor ventilation, and poor sanitation. Infection with APEC can occur through direct contact with contaminated feces, water, or feed or via aerosol transmission and be extremely detrimental to poultry health and production (Kathayat et al., 2021). Strategies to mitigate APEC in poultry flocks are one of the finest solutions for sustainable poultry production (Joseph et al., 2023). Amid the increasing antibiotic resistance, alternative treatment strategies such as vaccines, probiotics, and bacteriophages are necessary at the current stage (Joseph et al., 2023). Considering that a timely regional epidemiological investigation is necessary, we investigated the dominant serotypes of previously isolated APEC strains. The results can be beneficial to the development of targeted vaccines.

Among the numerous serotypes of APEC, O1, O2, and O78 have been considered the predominant serogroups by many foreign and domestic studies (Hu et al., 2022). For example, the predominant serotype in eastern China is O78 (43.2%), followed by O18 (13.6%) and O2 (13.6%) (Xu et al., 2019). O145, a pivotal serogroup in non-O157 Shiga toxin-producing E. coli, has emerged as a newly predominant serogroup of APEC in China (Wang et al., 2022). Our results showed that the isolated strains in Jiangxi Province were distributed in O2, O18, O24, O45, O78, and O88; among which, O24 (51.4%) was the predominant serotype, followed by O78 (11.9%). Serotype O24 of APEC was first reported and isolated from diseased ducks in Southwest China in 2010 (Wang et al., 2010). These findings indicated that the current epidemic situation of APEC is becoming complex, and effective APEC vaccines that can provide protection against diverse and variable serotypes are urgently needed. A high-throughput screening approach to search for universal protective antigens against the three traditional serogroups and the newly emerged O145 has been recently proposed (Wang et al., 2023), providing an idea for the inexpensive, rapid, and efficient screening of bacterial vaccine candidates.

Carbapenem-resistant Enterobacteriaceae have been increasingly reported worldwide (Wu et al., 2019). The genes bla _NDM-5 and bla _NDM-1 identified in this study shared a close phylogenetic identity with Klebsiella sp. and Acinetobacter sp. isolated from river and human feces, respectively. These results suggested the potential risk of pathogenic E. coli that acquires ARGs from pathogenic organisms and environmental microbiota. Subsequent genomic analysis results revealed different types of MGEs associated with these bla _NDM genes. MGEs-mediated horizontal transfer plays an important role in the dissemination of bla _NDM (Biez et al., 2023). For example, IS5 is frequently found upstream or downstream of bla _NDM-5 in K. pneumoniae (Huang et al., 2021; Zhao et al., 2021), Morganella morganii (Guo et al., 2019), and E. coli (Xu et al., 2023).

Except for the bla _NDM genes, several other types of AGEs are present in the two bla _NDM-positive strains. Further whole-genome sequencing and analysis of all the APEC isolates will be helpful to reveal the diverse genetic backgrounds and molecular identification of APEC, such as virulence and resistance genotypes, multilocus sequence types, plasmid replicon types, and single nucleotide polymorphism-based core genome phylogeny.

Conclusions

This study provided insights into the dominant serotypes of APEC strains isolated from diseased poultry in Jiangxi Province, China. The presence and genetic relationship of carbapenem-resistant genes bla _NDM-5 and bla _NDM-1 were analyzed. The genetic characteristics associated with the ARGs and MGEs of the two bla _NDM-positive strains were determined by whole-genome sequencing and analysis. Our results indicated that attention and efforts must be devoted to studying the increasing antimicrobial resistance of APEC in poultry flocks. A continuous clinical surveillance of APEC and regional prevention strategies would be an effective control measure that benefits the inhibition of APEC infections and its antimicrobial resistance.

Footnotes

Authors’ Contributions

T.J. and T.M.F. contributed to conception and design of the study. T.J., Z.F.F., L.H.Q., H.J.N., and K.Z.F. performed the experiments. W.Q.P. performed the statistical analysis. T.J. and Z.Y.B. contributed to the development of the figures. T.J. wrote the draft of the article. T.M.F. performed language and logic modifications. All authors contributed to article revision, read, and approved the submitted version.

Disclosure Statement

No competing financial interests exist.

Funding Information

This work was supported by the Jiangxi Collaborative Innovation Fund of Modern Agricultural Scientific Research (JXXTCXQN202201), the Earmarked Fund for Jiangxi Agriculture Research System (JXARS-09), the Key Research and Development Program of Jiangxi Province (20224BBF61031, 20224BBF62003), and the Jiangxi Joint Research Project for Improved Variety (2022JXCQZY04).

Supplementary Material

Supplementary Table S1

References

Biez

, Bonnin

, Emeraud

, et al. Nationwide molecular epidemiology of carbapenemase-producing Citrobacter spp. in France in 2019 and 2020. mSphere, 2023; 8(6):e0036623; doi: 10.1128/msphere.00366-23

Christensen

, Bachmeier

, Bisgaard

. New strategies to prevent and control avian pathogenic Escherichia coli (APEC). Avian Pathol, 2021; 50(5):370–381; doi: 10.1080/03079457.2020.1845300

DebRoy

, Roberts

, Fratamico

. Detection of O antigens in Escherichia coli . Anim Health Res Rev, 2011; 12(2):169–185; doi: 10.1017/S1466252311000193

Guo

, Rao

, Guo

, et al. Detection and genomic characterization of a Morganella morganii isolate from China that produces NDM-5. Front Microbiol, 2019; 10:1156; doi: 10.3389/fmicb.2019.01156

, Afayibo

DJA

, Zhang

, et al. Characteristics, pathogenic mechanism, zoonotic potential, drug resistance, and prevention of avian pathogenic Escherichia coli (APEC). Front Microbiol, 2022; 13:1049391; doi: 10.3389/fmicb.2022.1049391

Huang

, Zhang

, Zhao

, et al. Acquisition of a stable and transferable bla(NDM-5)-Positive plasmid with low fitness cost leading to Ceftazidime/Avibactam resistance in KPC-2-Producing Klebsiella pneumoniae during treatment. Front Cell Infect Microbiol, 2021; 11:658070; doi: 10.3389/fcimb.2021.658070

Iguchi

, Iyoda

, Seto

, et al. Pathogenic E. coli Working Group in Japan. Escherichia coli O-Genotyping PCR: A comprehensive and practical platform for molecular O serogrouping. J Clin Microbiol, 2015; 53(8):2427–2432; doi: 10.1128/JCM.00321-15

Joseph

, Zhang

, Adhikari

, et al. Avian pathogenic Escherichia coli (APEC) in broiler breeders: An overview. Pathogens, 2023; 12(11):1280; doi: 10.3390/pathogens12111280

Kathayat

, Lokesh

, Ranjit

, et al. Avian pathogenic Escherichia coli (APEC): An overview of virulence and pathogenesis factors, zoonotic potential, and control strategies. Pathogens, 2021; 10(4):467; doi: 10.3390/pathogens10040467

10.

, Tan

, Zhang

, et al. Diversity of Avian leukosis virus subgroup J in local chickens, Jiangxi, China. Sci Rep, 2021; 11(1):4797; doi: 10.1038/s41598-021-84189-7

11.

, Zhang

, Luo

, et al. Antimicrobial resistance of Escherichia coli isolated from retail foods in northern Xinjiang, China. Food Sci Nutr, 2020; 8(4):2035–2051; doi: 10.1002/fsn3.1491

12.

Tan

M-F

, Li

H-Q

, Yang

, et al. Prevalence and antimicrobial resistance profile of bacterial pathogens isolated from poultry in Jiangxi Province, China from 2020 to 2022. Poult Sci, 2023; 102(8):102830; doi: 10.1016/j.psj.2023.102830

13.

Wang

, Liu

, Zhang

, et al. The prevalence of colistin resistance in Escherichia coli and Klebsiella pneumoniae isolated from food animals in China: Coexistence of mcr-1 and bla(NDM) with low fitness cost. Int J Antimicrob Agents, 2018; 51(5):739–744; doi: 10.1016/j.ijantimicag.2018.01.023

14.

Wang

, Tang

, Yu

, et al. Distribution of serotypes and virulence-associated genes in pathogenic Escherichia coli isolated from ducks. Avian Pathol, 2010; 39(4):297–302; doi: 10.1080/03079457.2010.495742

15.

Wang

, Xu

, Zheng

, et al. Identification of subunits for novel universal vaccines against three predominant serogroups and the emerging O145 among avian pathogenic Escherichia coli by pan-RV pipeline. Appl Environ Microbiol, 2023; 89(1):e0106122; doi: 10.1128/aem.01061-22

16.

Wang

, Zheng

, Guo

, et al. O145 may be emerging as a predominant serogroup of Avian pathogenic Escherichia coli (APEC) in China. Vet Microbiol, 2022; 266:109358; doi: 10.1016/j.vetmic.2022.109358

17.

, Feng

, Tang

, et al. NDM Metallo-beta-Lactamases and their bacterial producers in health care settings. Clin Microbiol Rev, 2019; 32(2):e00115-18; doi: 10.1128/CMR.00115-18

18.

, Guo

, Li

, et al. Molecular epidemiology and genomic insights into the transmission of carbapenem-resistant NDM-producing Escherichia coli . Comput Struct Biotechnol J, 2023; 21:847–855; doi: 10.1016/j.csbj.2023.01.004

19.

, Sun

, Zhao

. Virulence factors and antibiotic resistance of avian pathogenic Escherichia Coli in Eastern China. J Vet Res, 2019; 63(3):317–320; doi: 10.2478/jvetres-2019-0056

20.

Zafer

, Al-Agamy

, El-Mahallawy

, et al. Dissemination of VIM-2 producing Pseudomonas aeruginosa ST233 at tertiary care hospitals in Egypt. BMC Infect Dis, 2015; 15:122; doi: 10.1186/s12879-015-0861-8

21.

Zhao

, Zhang

, Fan

, et al. Characterization of an NDM-5-producing hypervirulent Klebsiella pneumoniae sequence type 65 clone from a lung transplant recipient. Emerg Microbes Infect, 2021; 10(1):396–399; doi: 10.1080/22221751.2021.1889932

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.01 MB

Serotyping and Identification of Antimicrobial Resistance Genes in Avian Pathogenic Escherichia coli Isolated from Poultry Flocks in Jiangxi Province,China

Abstract

Introduction

Materials and Methods

Genome extraction

Molecular serotyping

Detection of blaNDM

Construction of phylogenetic tree

Whole-genome sequencing and analysis

Results

Identification of O-serotypes

Analysis of the blaNDM genes

Analysis of genome sequencing results

Discussion

Conclusions

Footnotes

Authors’ Contributions

Disclosure Statement

Funding Information

Supplementary Material

References

Supplementary Material

Detection of bla_NDM