Protective Effect of Enterococcus faecium and Its Extracellular Vesicles Against Ethanol-Induced Intestinal Injury

Abstract

In this study, we examined the impact of Enterococcus faecium (E. faecium, Efm) and its extracellular vesicles (EVs) on intestinal morphological structure, antioxidant function, inflammatory response, and permeability in rats. In a 5-day feeding experiment, a total of 72 female Sprague Dawley (SD) rats were randomly allotted into nine groups with eight rats per group. The study was conducted in three parts. First, we examined the impact of Efm on ethanol-induced intestinal injury. Second, we investigated the protective effects of various active components of bacterial culture on intestinal function in vivo. Third, we explored the impact of Efm with elevated EV secretion on intestinal function. The rats were treated by gavage administration (5 mL/kg body weight [BW]) every other day for a total of three times. After the last treatment at 2 h, the phosphate buffered saline (PBS) group received 5 mL/kg BW of PBS orally, whereas the other groups were orally administered 5 mL/kg BW of absolute ethanol to induce intestinal injury. After the feeding trial, eight rats per treatment were collected for intestinal samples. Our findings demonstrate that pretreatment with Efm can reverse morphological alterations in intestinal tissues, enhance superoxide dismutase/malondialdehyde levels, increase intestinal permeability, and reduce the inflammation levels, thereby regulating intestinal damage. Pretreatment with EfmEVs reversed the detrimental effects of ethanol-induced intestinal damage, displaying a discernible decline in inflammation, augmented permeability, and bolstered antioxidant capacity. Moreover, the release of EVs contributes to the intestinal safeguarding mechanism of Efm. EVs act as mediators in Efm’s protective response against ethanol-induced intestinal injury by mitigating inflammation and enhancing antioxidant activity. The Clinical Trial Registration Number: FOSU210403.

Introduction

Prolonged ethanol consumption or acute ethanol ingestion can induce inflammation, leading to dysfunction in various tissues and organs, and ultimately causing chronic conditions such as liver disease, neurological disorders, gastrointestinal cancer, and inflammatory bowel disease (Bishehsari et al., 2017; Patel et al., 2015; Rehm et al., 2009). The primary site of ethanol absorption is the intestinal tract, where the effects are mainly manifested in the disruption of intestinal barrier, including compromised mucosal integrity, gut microbial imbalance, intestinal inflammation, and oxidative damage to intestinal tissue (Bishehsari et al., 2017; Kolli et al., 2013; Patel et al., 2015; Shirpoor et al., 2015; Shirpoor et al., 2016).

The gastrointestinal tract, being the initial point of contact with ingested substances (Ghareeb et al., 2015), is particularly vulnerable to invasion by toxins. Probiotics exhibit notable antioxidant activity and possess the capacity to enhance intestinal barrier function (Kim et al., 2019). As biologics used in the treatment of intestinal injury, probiotics play a role in regulating the microecological balance in the intestines, maintaining intestinal barrier function, and other related mechanisms (Batista et al., 2020; Chiu et al., 2015; Lu and Wang, 2021; Wang et al., 2011). Enterococcus faecium (E. faecium, Efm), a Gram-positive bacterium, is a human probiotic that aids in digestion and protects the gastrointestinal mucosa (Liu et al., 2022). Efm can modulate the structure of intestinal flora and digestive enzyme activity, improving animal production, performance, and immunity (Busing and Zeyner, 2015; Sukegawa et al., 2014).

Extracellular vesicles (EVs), as key messengers in intercellular communication, play a significant role in various physiological processes, such as cellular differentiation, inflammation, and immunity (Buzas, 2023; Odegaard et al., 2020; Ruan et al., 2021; Tkach and Thery, 2016; Wang et al., 2021). Bacteria-derived EVs contain bacterial bioactive components and exert their biological functions primarily by traversing the mucus layer, migrating to various tissues, or interacting with host immune cells (Molina-Tijeras et al., 2019). These processes potentially contribute to the modulation of intestinal homeostasis and intestinal immunity. Specifically, Lactobacillus reuteri-derived EVs can inhibit the expression of pro-inflammatory genes in the jejunum and enhance the expression of anti-inflammatory genes, thereby counteracting the inflammatory response induced by lipopolysaccharide (LPS) (Hu et al., 2021). Lactobacillus paracasei-derived EVs have been found to mitigate LPS-induced intestinal inflammation through the involvement of NOX-2, iNOS, and NF-κB (Choi et al., 2020).

However, the existing literature on probiotics and their derived EVs in ethanol-induced injury is rather limited. In our previous study, we found that EfmEVs have a protective effect against ethanol-induced acute gastric injury by regulating inflammation levels and antioxidant capacity (Luo et al., 2024b). In contrast, this study shifts the focus to the intestine, aiming to explore the protective effect of EVs on alcohol-induced intestinal injury. The objective of our research is to conduct a preliminary investigation into whether the protective mechanisms observed in gastric tissue are also applicable to the intestine and to provide a theoretical basis for the prevention and treatment of related diseases.

Materials and Methods

Culture of bacteria

Efm was received from this laboratory. Efm was cultured in de Man Rogosa and Sharpe (MRS) medium (2.0% glucose, 1.0% meat extract, 1.0% peptone, 0.5% yeast extract, 0.5% sodium acetate, 0.2% K₂HPO₄, 0.2% diammonium citrate, 0.1% Tween 80, 0.02% MgSO₄·7H₂O, 0.005% MnSO₄·H₂O) (MRS, Mumbai, India). Bacteria were shaken at 200 rpm in aerobic conditions at 37°C for ∼14–16 h to an OD600 of ∼0.4–0.6.

Inactivation of bacteria

Inactivation of bacteria was performed as previously described (Luo et al., 2024b).

Isolation of bacterial EVs

Efm-derived extracellular vesicles (EfmEVs) were isolated from the cultured supernatants using differential ultracentrifugation as previously reported (Choi et al., 2020; Luo et al., 2024b). The EfmEV preparations and EVs-free supernatants (EVFS) were stored at −80°C until use.

Stimulation of EV secretion

Stimulation of EV secretion was performed as previously described (Luo et al., 2024b).

Animals

Female SD rats (SPF, ∼190–230 g, 8 weeks of age) were from the Guangdong Medical Laboratory Animal Center (Foshan, Guangdong, China). Animals were fed a standard diet and water ad libitum under ambient room temperature (22 ± 2°C), 50 ± 10% humidity, and a 12-h light/12-h dark cycle.

Experimental design

To explore whether Efm alleviates ethanol-induced intestinal injury, SD rats were randomly allocated to three groups (n = 8) as follows: the normal control group (PBS), the ethanol model group (EtOH), and Efm + ethanol model group (Efm). The PBS and EtOH groups received 5 mL/kg BW of PBS orally gavaged, while the Efm groups received 2 × 10⁹ colony-forming unit (CFU)/mL (5 mL/kg BW) of Efm every other day for a total of three times. Approximately 12 h before the last treatment, the rats were fasted but allowed free access to water. After the last treatment at 2 h, the Efm and EtOH groups were orally administered a dose of 5 mL/kg BW with absolute ethanol to induce intestinal injury, whereas the PBS group received 5 mL/kg BW of PBS through oral administration.

To investigate which fraction of the bacterial culture is potentially protective against the intestinal damage, intestinal protective function of different bacterial culture components was studied in vivo. Female SD rats (n = 24) were randomly divided into three groups as follows: EVFS + ethanol model group (EVFS), inactivated Efm + ethanol model group (iaEfm), and EfmEVs + ethanol model group (EfmEVs). The EVFS, iaEfm, and EfmEVs groups were orally administered with 5 mL/kg BW of EVFS, 2 × 10⁹ CFU/mL of iaEfm (5 mL/kg BW), or 20 μg/mL of EfmEVs (5 mL/kg BW), respectively, every other day for a total of three times. Fasting and ethanol induction were performed as described above.

To further explore whether EV secretion is beneficial for the intestinal protective effect of Efm, linezolid (LZD) was used to stimulate EV secretion. Female SD rats (n = 24) were randomly divided into three groups as follows: LZD + ethanol model group (LZD), Efm + ethanol model group (Efm), and Efm + LZD cotreated + ethanol model group (LZD-Efm). The LZD, Efm, and LZD-Efm groups were orally administered with 0.2 μg/mL of LZD (5 mL/kg BW), 2 × 10⁹ CFU/mL of Efm (5 mL/kg BW), and Efm mixed with LZD (2 × 10⁹ CFU/mL of Efm, 0.2 μg/mL of LZD, 5 mL/kg BW) every other day for a total of three times. Fasting and ethanol induction were performed as described above.

Histopathology of the intestinal tissue

Intestinal tissue was fixed in 4% formalin and then embedded in paraffin. Paraffin blocks were cut into ∼4–5 µm sections and stained with hematoxylin and eosin. Villus height and crypt depth were measured under a microscope at 40× magnification (Nikon Eclipse E200 microscope; Nikon, Tokyo, Japan), and the villus height/crypt depth ratio (VCR) was calculated and evaluated based on intestinal.

Antioxidant activity of duodenal tissues

Collected duodenal tissues were compressed and homogenized (10% w/v) in saline, and the homogenized mixture was centrifuged at 3000 r/min for 10 min to evaluate antioxidant activity. Superoxide dismutase (SOD) and malondialdehyde (MDA) activities were measured according to the instruction provided with the activity assay kit (SOD: A001-1-1; MDA: A003-1-2; Nanjing Jiancheng Bioengineering Institute, Jiangsu, China). Total protein content was measured using a Bradford Protein Assay Kit (P0010S; Beyotime, Shanghai, China).

Measurements of mRNA expression in the duodenal tissues

Total RNA was extracted using the TRIzol® reagent (Tiangen, Beijing, China) following the manufacturer’s instructions. Then, 1 μg of total RNA was reverse-transcribed to single-strand cDNA using the RT Easy^TM II cDNA Synthesis Kit (Foregene, Chengdu, China). Real-time polymerase chain reaction was performed using SYBR Green Supermix (Foregene, Chengdu, China) on QuantStudio3 (Applied Biosystems). Amplification data were analyzed using the 2^−ΔΔCt method with the ACTB gene serving as a reference. The primer sequences are listed in Table 1.

Table 1.

Sequences of Primers for Real-Time Polymerase Chain Reaction

Gene name	GenBank accession no.	Sequences of primers (5′−3′)	Annealing temperature (°C)	PCR product size (bp)
ACBT	NM_0.31144.3	F: CCGTAAAGACCTCTATGCCAACA	58.7	230
ACBT	NM_0.31144.3	R: CGGACTCATCGTACTCCTGCTT	58.7	230
MUC5AC	U83139.1	F: CTTTTCTGATGTCTTTGTAGT	61	157
MUC5AC	U83139.1	R: GTAGAGGGAAGTGGAGTTATT	61	157
MUC4	NM_001419613.1	F: CGAACTTCATTGCCTTTG	61	120
MUC4	NM_001419613.1	R: CCACCGTTTGGTTATTGT	61	120
OCLN	NM_031329.3	F: GCTCAGGGAATATCCACCTAT	58.7	346
OCLN	NM_031329.3	R: ACTTCTCCAGCAACCAGCATC	58.7	346
TJP2	NM_001414504.1	F: AAGAAGAACATTCGCAAGAGC	61	186
TJP2	NM_001414504.1	R: AGTTTGAAACAGGTCGGGTAG	61	186
TFF	NM_013042.2	F: CAGGAATTTGTTGGCCTATCT	61	104
TFF	NM_013042.2	R: CCACGGTTGTTACACTGCTCT	61	104
TGFβ	NM_021578.2	F:CAGAGAAGAACTGCTGTGTA	61	176
TGFβ	NM_021578.2	R: GTTGTGTTGGTTGTAGAGGG	61	176
BAX	U32098.1	F: TGGCGATGAACTGGACAACAA	61	153
BAX	U32098.1	R: GCAAAGTAGAAAAGGGCAACC	61	153
NF-kB	NM_001415012.1	F: GCATTCTGACCTTGCCTAT	61	183
NF-kB	NM_001415012.1	R: TCCAGTCTCCGAGTGAAGC	61	183
P65	AJ002424.2	F: TTACATCAAGCACCCACAC	61	165
P65	AJ002424.2	R: AGAAGGAAAACTGCGAACC	61	165
IL10	XM_006249712.4	F: CCATAGGGGACATTTTATAGTATTT	61	103
IL10	XM_006249712.4	R: GCCTTAGGATCGAAGTTTCAG	61	103
IL1β	NM_031512.2	F: TGAACTCAACTGTGAAATAGC	58.7	277
IL1β	NM_031512.2	R: AAAGATGAAGGAAAAGAAGGT	58.7	277
VEGF	AY702972.1	F: CCCACGACAGAAGGGGAGCAG	61	163
VEGF	AY702972.1	R: ACCGCATTAGGGGCACACAGG	61	163

PCR, polymerase chain reaction.

Data analysis

The data were analyzed using SPSS 20.0 and presented as mean ± standard deviation for at least eight samples. The statistical significance of differences between three or more groups was determined by one-way analysis of variance. A p-value <0.05 indicates statistical significance.

Results

Effects of Efm and its EVs on intestinal morphology structure in ethanol-induced intestinal injury

The effects of Efm on morphological structure in ethanol-induced intestinal injury are shown in Figure 1A. The PBS group exhibited elongated and slender villi in the small intestine. Conversely, the EtOH group displayed significant villus shortening, fracturing, and a reduced VCR. Efm maintained intestinal villi integrity. The villus heights of jejunum and ileum were similar (p > 0.05) among the treatments, and the crypt depth of duodenum was similar (p > 0.05) among the treatments (Table 2). Compared with the PBS group, EtOH challenge decreased duodenum villus height (p < 0.05), as well as VCR in the duodenum, jejunum, and ileum (p < 0.05), while increasing the crypt depth in the jejunum and ileum (p < 0.05). In contrast, Efm pretreatment increased duodenum villus height and the VCR of the three intestinal segments compare with the EtOH group (p < 0.05).

FIG. 1.

Effects of Enterococcus faecium (Efm) and its extracellular vesicles (EVs) on intestinal morphology structure in ethanol-induced intestinal injury in rats were observed (×40). (A) Effects of Efm on intestinal mucosal morphology in rats were observed. (B) Effects of pretreatment with different active components of Efm on intestinal mucosal morphology in rats were observed. (C) Effects of increasing EVs secretion on intestinal mucosal morphology in rats were observed.

Table 2.

The Effects of Enterococcus faecium on Duodenum, Jejunum, and Ileum Morphology in Rats

Parameter	PBS	EtOH	Efm	p-Value
Duodenum villi lengths (μm)	503.89 ± 41.47^a	302.84 ± 28.63^c	442.98 ± 58.14^b	0.000
Jejunum villi lengths (μm)	422.54 ± 42.34	400.98 ± 37.97	468.37 ± 79.80	0.124
Ileum villi lengths (μm)	286.16 ± 44.05	276.43 ± 46.67	294.78 ± 42.58	0.761
Duodenum crypt depth (μm)	154.68 ± 9.41	142.18 ± 11.40	146.15 ± 6.55	0.740
Jejunum crypt depth (μm)	114.23 ± 24.20^b	142.41 ± 24.07^a	124.12 ± 16.54^a,b	0.070
Ileum crypt depth (μm)	102.47 ± 11.75^b	121.62 ± 8.57^a	125.10 ± 20.67^a	0.020
Duodenum VCR	3.33 ± 0.33^a	2.35 ± 0.26^b	3.21 ± 0.26^a	0.000
Jejunum VCR	3.50 ± 0.70^b	2.77 ± 0.33^b	4.04 ± 0.59^a	0.009
Ileum VCR	2.50 ± 0.20^a	2.06 ± 0.40^b	2.53 ± 0.34^a	0.031

^–cDifferent letters indicate significant differences between mean values for a given behavior (p < 0.05). Data were presented as means ± standard error, n = 8.

VCR, villus height/crypt depth ratio.

The effects of pretreatment with different active components of Efm on morphology structure in ethanol-induced intestinal injury are shown in Figure 1B. The EVFS and iaEfm groups displayed significant villus fracturing (especially in the ileum), along with crude and deeper crypt depths. Conversely, the EfmEVs group exhibited elongated and slender villi in the small intestine, maintaining their integrity. Meanwhile, the EfmEVs group showed a significant increase in the VCR and a decrease in crypt depth in the duodenum compared with the iaEfm group and EVFS group (p < 0.05) (Table 3).

Table 3.

The Effects of Pretreatment with Different Active Components of Enterococcus faecium on Duodenum, Jejunum, and Ileum Morphology in Rats

Parameter	EVFS	iaEfm	EfmEVs	p-Value
Duodenum villi lengths (μm)	573.14 ± 40.88	512.32 ± 76.32	545.99 ± 57.40	0.245
Jejunum villi lengths (μm)	544.02 ± 73.41	508.40 ± 93.78	439.46 ± 100.84	0.101
Ileum villi lengths (μm)	317.05 ± 22.65	318.08 ± 51.75	347.72 ± 30.34	0.286
Duodenum crypt depth (μm)	171.41 ± 12.87^a	162.39 ± 16.36^a	131.64 ± 8.69^b	0.000
Jejunum crypt depth (μm)	132.50 ± 21.29	121.30 ± 7.44	121.48 ± 19.75	0.427
Ileum crypt depth (μm)	134.38 ± 26.34	114.26 ± 14.14	125.10 ± 16.29	0.208
Duodenum VCR	3.12 ± 0.37^b	2.53 ± 0.28^c	3.81 ± 0.22^a	0.000
Jejunum VCR	3.94 ± 0.60	3.98 ± 0.43	3.97 ± 0.41	0.208
Ileum VCR	2.42 ± 0.45	2.66 ± 0.30	2.81 ± 0.31	0.989

^–cDifferent letters indicate significant differences between mean values for a given behavior (p < 0.05). Data were presented as means ± standard error, n = 8.

VCR, villus height/crypt depth ratio.

The effects of increasing EV secretion on morphological structure in ethanol-induced intestinal injury are shown in Figure 1C. Among the groups, the LZD group exhibited the most severe damage, followed by Efm and LZD-Efm groups. Specifically, the villi in the LZD group were extensively fractured and detached. In the Efm group, some intestinal villi were detached, with the jejunum experiencing more pronounced damage. However, the LZD-Efm group showed restoration of the intestinal villi. After coadministration of Efm and LZD, the crypt depth in the ileum increased dramatically compared with Efm administration alone (p < 0.05) (Table 4). While improvements were noted in the Efm and LZD-Efm groups, even the VCR of the three intestinal segments significantly increased than the LZD group (p < 0.05).

Table 4.

The Effects of Increasing Extracellular Vesicle Secretion on Duodenum, Jejunum, and Ileum Morphology in Rats

Parameter	LZD	Efm	LZD-Efm	p-Value
Duodenum villi lengths (μm)	240.33 ± 65.28	287.48 ± 54.01	279.34 ± 75.17	0.422
Jejunum villi lengths (μm)	299.59 ± 98.00	378.55 ± 58.01	338.37 ± 56.95	0.201
Ileum villi lengths (μm)	279.60 ± 19.65	273.19 ± 47.52	325.07 ± 81.10	0.207
Duodenum crypt depth (μm)	118.46 ± 9.11	126.17 ± 24.08	100.58 ± 22.70	0.105
Jejunum crypt depth (μm)	100.24 ± 16.47	102.05 ± 22.54	112.44 ± 12.83	0.446
Ileum crypt depth (μm)	145.70 ± 19.02^a	116.36 ± 12.81^b	136.64 ± 15.43^a	0.010
Duodenum VCR	2.01 ± 0.33^b	2.68 ± 0.45^a	2.79 ± 0.64^a	0.025
Jejunum VCR	2.70 ± 0.70^b	3.69 ± 0.47^a	3.56 ± 0.67^a	0.030
Ileum VCR	2.00 ± 0.25^b	2.48 ± 0.40^a	2.62 ± 0.41^a	0.014

^–cDifferent letters indicate significant differences between mean values for a given behavior (p < 0.05). Data were presented as means ± Standard error, n = 8.

VCR, villus height/crypt depth ratio.

Effects of Efm and its EVs on duodenal antioxidant indicators in ethanol-induced intestinal injury

The effects of Efm on duodenal antioxidant indicators in ethanol-induced intestinal injury are shown in Figure 2A–C. Compared with PBS group, both the EtOH and Efm groups significantly increased SOD level (p < 0.05). The EtOH group had highest MDA levels among the three groups.

FIG. 2.

Effects of Enterococcus faecium (Efm) and its extracellular vesicles (EVs) on duodenal antioxidant indicators in ethanol-induced intestinal injury in rat. Effects of pretreatment with Efm on duodenal malondialdehyde (MDA) levels (A), superoxide dismutase (SOD) activity, and (B) SOD/MDA ratio in (C) ethanol-induced intestinal injury in rat. Effects of pretreatment with different active components of Efm on duodenal MDA levels (D), SOD activity (E), and SOD/MDA ratio (F) in ethanol-induced intestinal injury in rat. Effects of increasing EV secretion on duodenal MDA levels (G), SOD activity (H), and SOD/MDA ratio (I) in ethanol-induced intestinal injury in rat. Data are expressed as mean ± standard deviation. Means with different letters were significantly different (n = 8; one-way analysis of variance; Duncan; p < 0.05).

The effects of pretreatment with different active components of Efm on duodenal antioxidant indicators in ethanol-induced intestinal injury are shown in Figure 2D–F. The EfmEVs group had the highest SOD/MDA ratio and the lowest level of MDA among the three groups.

The effects of increasing EV secretion on duodenal antioxidant indicators in ethanol-induced intestinal injury are shown in Figure 2G–I. The LZD-Efm group had the highest level of SOD and the lowest level of MDA among the three groups.

Effects of Efm and its EVs on duodenal mRNA expression in ethanol-induced intestinal injury

The effects of Efm on duodenal mRNA expression in ethanol-induced intestinal injury are shown in Figure 3A. Compared with the PBS group, ethanol treatment significantly downregulated the mRNA expression of MUC4, TJP2, and IL-10 (p < 0.05), while increasing IL-1β mRNA expression (p < 0.05). Efm pretreatment showed a tendency toward reducing duodenum injury, with TJP2 mRNA expression levels increasing compared with EtOH group in a similar trend (p > 0.05). Apart from that, Efm pretreatment showed a decreasing BAX, NF-kB, IL-1β mRNA expression compared with the EtOH group (p < 0.05).

FIG. 3.

Effects of Enterococcus faecium (Efm) and its extracellular vesicles (EVs) on duodenal mRNA expression in ethanol-induced intestinal injury in rat. (A) Effects of pretreatment with Efm on duodenal mRNA expression in rat. (B) Effects of pretreatment with different active components of Efm on duodenal mRNA expression in rat. (C) Effects of increasing EV secretion on duodenal mRNA expression in rat. Relative mRNA expression levels of MUC5AC, MUC4, OCLN, TJP2, TFF, TGFβ, BAX, NK-kB, P65, IL-10, IL-1β, and VEGF in the intestinal tissues. Data are expressed as mean ± standard deviation. Means with different letters were significantly different (n = 8; one-way analysis of variance; Duncan; p < 0.05).

The effects of pretreatment with different active components of Efm on duodenal mRNA expression in ethanol-induced intestinal injury are shown in Figure 3B. EfmEV pretreatment displayed highest expression levels of OCLN, TJP2, TFF, IL10, VEGF mRNA among the three groups (Fig. 3B). Compared with EVFS group, decreasing TGFβ and IL-1β mRNA expression and increasing TJP2 and VEGF in the EfmEVs and iaEfm groups (p < 0.05) were observed. After EfmEV administration, the levels of IL10 increased compared with the EVFS and iaEfm groups (p < 0.05).

The effects of increasing EVs secretion on duodenal mRNA expression in ethanol-induced intestinal injury are shown in Figure 3C. Efm and LZD coadministration displayed highest MUC4, OCLN, TFF, TGFβ, BAX, NF-kB, IL-1β and lowest TJP2 and VEGF mRNA expression among the three groups (Fig. 3C). Efm and LZD coadministration significantly increased the mRNA expression of MUC5AC, MUC4, OCLN, TFF, TGFβ, NF-kB, P65, IL10, and IL-1β in duodenum tissue compared with the Efm group (p < 0.05). Compared with LZD administration alone, Efm and LZD coadministration significantly increased MUC4, TFF, TGFβ, BAX, IL-1β mRNA expression while reducing IL10 and VEGF mRNA expression (p < 0.05).

Discussion

Ethanol exposure disrupts the intestinal barrier, causing oxidative stress and inflammation (Baek et al., 2023; Patel et al., 2021; Shirpoor et al., 2016; Wang et al., 2015). Probiotic intervention reduces these effects and maintains intestinal barrier function (Forsyth et al., 2009; Lu and Wang, 2021; Wang et al., 2011; Zhao et al., 2021). This study found that Efm pretreatment effectively alleviates ethanol-induced intestinal damage.

It is generally believed that poor intestinal function is related to shorter villus height, deeper crypt depth, and lower VCR (Ren et al., 2018). In this study, we found the ethanol challenge altered the morphology of the intestinal structure, particularly in the duodenum. Efm pretreatment alleviated the damage to the intestinal morphological structure caused by ethanol exposure. Efm also exhibited such beneficial effects in gastric tissues (Luo et al., 2024b). Based on the aforementioned findings, the role of Efm in safeguarding the intestines has been confirmed. It is of interest to determine the specific active constituents within Efm that contribute to this protective effect against intestinal damage. Numerous studies highlight the close relationship between exogenous EVs and their biological distribution and functions within animal organisms (Chen et al., 2022; Krzyżek et al., 2023). EVs act on the intestine, where they are absorbed and subsequently alter the composition of the intestinal microbiota and host physiological functions (Liang et al., 2022; Man et al., 2021). For instance, treatment with Salmonella outer membrane vesicles not only reduces the production of short chain fatty acids (SCFAs) and the abundance of the producing bacteria but also negatively affects ileal morphology (Luo et al., 2024a). Moreover, EfmEVs primarily targeted the stomach and intestine in rats, indicating their crucial regulating stomach function, as confirmed by our research (Luo et al., 2024b). We observed that EV pretreatment resulted in minimal damage and mild pathological changes. Previous research has indicated that LZD enhances the secretion of EVs from Efm and has proven the protective effect of EfmEVs on gastric health (Luo et al., 2024b). Furthermore, the stimulation of EV secretion from Efm by LZD was found to play a role in safeguarding intestinal health, showing minimal damage and preserved intestinal histology. These results unequivocally indicate that EVs are a crucial functional component of Efm in its role of intestinal protection.

SOD increases to eliminate oxygen free radicals (Shen et al., 2016), whereas MDA is a degradation product of peroxidation of unsaturated fatty acids in cell membranes (Salazar-Montes et al., 2008; Wu et al., 2018). SOD/MDA ratio indicates an organism’s potential ability to resist lipid peroxidation (Xiong et al., 2015). Ethanol reduces antioxidant capacity, generating free radicals and disrupting clearance systems (Gan et al., 2021). The high SOD/MDA ratio, which reflects improved antioxidant capacity, helps mitigate ethanol-induced intestinal injury. EfmEVs pretreatment resulted in the lowest MDA levels and the highest SOD activity and SOD/MDA ratio in ethanol-induced intestinal damage, confirming the antioxidant capability of EVs and aligning with previous research (Choi et al., 2020; Luo et al., 2024b).

Intestinal inflammation is closely associated with intestinal barrier function. When the intestine is affected by inflammation, the integrity of tight junction proteins and epithelial cells may be compromised (Shao et al., 2022). Furthermore, ethanol can directly trigger intestinal inflammation, leading to dysfunction of the intestinal barrier (Hamarneh et al., 2017; Parlesak et al., 2000; Yang et al., 2019), which aligns with our research findings. Ethanol treatment reduced the mucin content, attenuated the intestinal barrier function, and produced an inflammatory response. Efm pretreatment alleviated the increase in IL-1β level caused by ethanol exposure. EVs can protect the intestinal barrier function by regulating inflammation in the gut. EVs from Lactobacillus fermentum, which target gastrointestinal tissues, reduce the expression of pro-inflammatory cytokines (IL-1β, TNF-α) while simultaneously enhancing the expression of anti-inflammatory cytokines (IL-10, TGFβ), thereby alleviating sulfated polysaccharide-induced intestinal inflammation in mice (Choi et al., 2020). EVs secreted by L. reuteri play a crucial role in immune regulation and disease protection in a chicken model’s intestinal tract, leading to improved growth performance, reduced mortality, and alleviated LPS-induced inflammation, inhibiting the expression of pro-inflammatory genes (TNF-α, IL-1β, IL-6, IL-17, IL-8) (Hu et al., 2021). In addition, the EVs group exhibited the highest levels of OCLN, TJP2, TFF, IL-10, and VEGF and the lowest levels of IL-1β. The results are consistent with previous research (Choi et al., 2020; Luo et al., 2024b). In addition, the stimulation secretion EVs of Efm by LZD were found to play a role in improved intestinal barrier function and elevated levels of anti-inflammatory factors. EfmEVs can regulate ethanol-induced intestinal damage by enhancing intestinal barrier function and modulating inflammation levels.

Conclusions

In conclusion, Efm significantly relieved ethanol-induced intestinal injury in rats, with EVs serving as a key functional active component. The protective effects of EfmEVs may be mediated through enhancing the barrier function and anti-inflammatory activity, showing promising potential as a novel therapeutic agent with anti-inflammatory properties.

Animal Welfare Statement

All animal care and treatment procedures were approved by the Animal Care and Use Committee of Foshan University, which meet the ethical standards in Laboratory Animal—Guideline for Ethical Review of Animal Welfare (The National Standard of the People’s Republic of China GB/T 35892-2018).

Footnotes

Authors’ Contributions

Q.Q. contributed to the study conceptualization, data curation, formal analysis, validation, and visualization. Methodology, investigation, and writing—original draft were performed by M.L., S.L., and J.S. Funding acquisition was performed by Q.Q., X.F., and H.Z. L.W. contributed to the project administration. Writing—review and editing was performed by Q.Q. and X.F. All authors have read and agreed to the published version of the article.

Disclosure Statement

The authors declare no conflicts of interest.

Funding Information

This research was funded by the National Natural Science Foundation of China (Grant No. 31902228), Key Construction Discipline Research Ability Improvement Project of Guangdong Province (Grant No. 2022ZDJS040), and Special Fund for Science and Technology Innovation Cultivation of Guangdong University Students (Grant No. pdjh2024b397).

References

Baek

, Kim

, Lee

, et al. Disrupted intestinal mucosal barrier mediated by alcohol consumption aggravates systemic microplastic accumulation. Ecotoxicol Environ Saf, 2023; 262:115342; doi: 10.1016/j.ecoenv.2023.115342

Batista

, da Silva

, de Jesus

LCL

, et al. Probiotics, prebiotics, synbiotics, and paraprobiotics as a therapeutic alternative for intestinal mucositis. Front Microbiol, 2020; 11:544490; doi: 10.3389/fmicb.2020.544490

Bishehsari

, Magno

, Swanson

, et al. Alcohol and gut-derived inflammation. Alcohol Res, 2017; 38(2):163–171.

Busing

, Zeyner

. Effects of oral enterococcus faecium strain DSM 10663 NCIMB 10415 on diarrhoea patterns and performance of sucking piglets. Benef Microbes, 2015; 6(1):41–44; doi: 10.3920/BM2014.0008

Buzas

. The roles of extracellular vesicles in the immune system. Nat Rev Immunol, 2023; 23(4):236–250; doi: 10.1038/s41577-022-00763-8

Chen

, Rao

, Yue

, et al. Glucocorticoid-induced loss of beneficial gut bacterial extracellular vesicles is associated with the pathogenesis of osteonecrosis. Sci Adv, 2022; 8(15):eabg8335; doi: 10.1126/sciadv.abg8335

Chiu

, Huang

, Chen

, et al. Synbiotics reduce ethanol-induced hepatic steatosis and inflammation by improving intestinal permeability and microbiota in rats. Food Funct, 2015; 6(5):1692–1700; doi: 10.1039/c5fo00104h

Choi

, Moon

, Shin

, et al. Lactobacillus paracasei-derived extracellular vesicles attenuate the intestinal inflammatory response by augmenting the endoplasmic reticulum stress pathway. Exp Mol Med, 2020; 52(3):423–437; doi: 10.1038/s12276-019-0359-3

Forsyth

, Farhadi

, Jakate

, et al. Lactobacillus GG treatment ameliorates alcohol-induced intestinal oxidative stress, gut leakiness, and liver injury in a rat model of alcoholic steatohepatitis. Alcohol, 2009; 43(2):163–172; doi: 10.1016/j.alcohol.2008.12.009

10.

Gan

, Tong

, Zhou

, et al. Hepatoprotective effect of lactobacillus plantarum HFY09 on ethanol-induced liver injury in mice. Front Nutr, 2021; 8:684588; doi: 10.3389/fnut.2021.684588

11.

Ghareeb

, Awad

, Bohm

, et al. Impacts of the feed contaminant deoxynivalenol on the intestine of monogastric animals: Poultry and swine. J Appl Toxicol, 2015; 35(4):327–337; doi: 10.1002/jat.3083

12.

Hamarneh

, Kim

, Kaliannan

, et al. Intestinal alkaline phosphatase attenuates alcohol-induced hepatosteatosis in mice. Dig Dis Sci, 2017; 62(8):2021–2034; doi: 10.1007/s10620-017-4576-0

13.

, Lin

, Wang

, et al. Lactobacillus reuteri-derived extracellular vesicles maintain intestinal immune homeostasis against lipopolysaccharide-induced inflammatory responses in broilers. J Anim Sci Biotechnol, 2021; 12(1):25; doi: 10.1186/s40104-020-00532-4

14.

Kim

, Guevarra

, Kim

, et al. Role of probiotics in human gut microbiome-associated diseases. J Microbiol Biotechnol, 2019; 29(9):1335–1340; doi: 10.4014/jmb.1906.06064

15.

Kolli

, Abraham

, Isaac

, et al. Preclinical efficacy of melatonin to reduce methotrexate-induced oxidative stress and small intestinal damage in rats. Dig Dis Sci, 2013; 58(4):959–969; doi: 10.1007/s10620-012-2437-4

16.

Krzyżek

, Marinacci

, Vitale

, et al. Extracellular vesicles of probiotics: Shedding light on the biological activity and future applications. Pharmaceutics, 2023; 15(2); doi: 10.3390/pharmaceutics15020522

17.

Liang

, Dai

, Sheng

, et al. Gut bacterial extracellular vesicles: Important players in regulating intestinal microenvironment. Gut Microbes, 2022; 14(1):2134689; doi: 10.1080/19490976.2022.2134689

18.

Liu

, Zhen

, Hu

, et al. Reconfiguration of gut microbiota and reprogramming of liver metabolism with phycobiliproteins bioactive peptides to rehabilitate obese rats. Nutrients, 2022; 14(17); doi: 10.3390/nu14173635

19.

, Wang

. Lactobacillus acidophilus and vitamin C attenuate ethanol-induced intestinal and liver injury in mice. Exp Ther Med, 2021; 22(3):1005; doi: 10.3892/etm.2021.10438

20.

Luo

, Li

, Yang

, et al. Effects of salmonella outer membrane vesicles on intestinal microbiota and intestinal barrier function. Foodborne Pathog Dis, 2024a;21(4):257–267; doi: 10.1089/fpd.2023.0096

21.

Luo

, Sun

, Li

, et al. Protective effect of Enterococcus faecium against ethanol-induced gastric injury via extracellular vesicles. Microbiol Spectr, 2024b;12(4):e0389423; doi: 10.1128/spectrum.03894-23

22.

Man

, Meng

, Liu

, et al. The study of ginger-derived extracellular vesicles as a natural nanoscale drug carrier and their intestinal absorption in rats. Aaps Pharmscitech, 2021; 22(6):206; doi: 10.1208/s12249-022-02366-x

23.

Molina-Tijeras

, Gálvez

, Rodríguez-Cabezas

. The immunomodulatory properties of extracellular vesicles derived from probiotics: A novel approach for the management of gastrointestinal diseases. Nutrients, 2019; 11(5); doi: 10.3390/nu11051038

24.

Odegaard

, Chand

, Wheeler

, et al. Role of extracellular vesicles in substance abuse and HIV-related neurological pathologies. Int J Mol Sci, 2020; 21(18); doi: 10.3390/ijms21186765

25.

Parlesak

, Schafer

, Schutz

, et al. Increased intestinal permeability to macromolecules and endotoxemia in patients with chronic alcohol abuse in different stages of alcohol-induced liver disease. J Hepatol, 2000; 32(5):742–747; doi: 10.1016/s0168-8278(00)80242-1

26.

Patel

, Behara

, Swanson

, et al. Alcohol and the intestine. Biomolecules, 2015; 5(4):2573–2588; doi: 10.3390/biom5042573

27.

Patel

, Parwani

, Rao

, et al. Prophylactic treatment of probiotic and metformin mitigates ethanol-induced intestinal barrier injury: In Vitro, In Vivo, and In Silico approaches. Mediators Inflamm, 2021; 2021:5245197; doi: 10.1155/2021/5245197

28.

Rehm

, Mathers

, Popova

, et al. Global burden of disease and injury and economic cost attributable to alcohol use and alcohol-use disorders. Lancet, 2009; 373(9682):2223–2233; doi: 10.1016/S0140-6736(09)60746-7

29.

Ren

, Wang

, Yan

, et al. Melatonin alleviates weanling stress in mice: Involvement of intestinal microbiota. J Pineal Res, 2018; 64(2); doi: 10.1111/jpi.12448

30.

Ruan

, Miao

, Schluter

, et al. Extracellular vesicles in neuroinflammation: Pathogenesis, diagnosis, and therapy. Mol Ther, 2021; 29(6):1946–1957; doi: 10.1016/j.ymthe.2021.04.020

31.

Salazar-Montes

, Ruiz-Corro

, Lopez-Reyes

, et al. Potent antioxidant role of pirfenidone in experimental cirrhosis. Eur J Pharmacol, 2008; 595(1–3):69–77; doi: 10.1016/j.ejphar.2008.06.110

32.

Shao

, Zhen

, Guo

, et al. Pretreatment with probiotics Enterococcus faecium NCIMB 11181 attenuated Salmonella Typhimurium-induced gut injury through modulating intestinal microbiome and immune responses with barrier function in broiler chickens. J Anim Sci Biotechnol, 2022; 13(1):130; doi: 10.1186/s40104-022-00765-5

33.

Shen

, Cheng

, Yu

, et al. Resveratrol pretreatment attenuates injury and promotes proliferation of neural stem cells following oxygen-glucose deprivation/reoxygenation by upregulating the expression of Nrf2, HO-1 and NQO1 in vitro . Mol Med Rep, 2016; 14(4):3646–3654; doi: 10.3892/mmr.2016.5670

34.

Shirpoor

, Barmaki

, Khadem Ansari

, et al. Protective effect of vitamin E against ethanol-induced small intestine damage in rats. Biomed Pharmacother, 2016; 78:150–155; doi: 10.1016/j.biopha.2016.01.015

35.

Shirpoor

, Nemati

, Ansari

, et al. The protective effect of vitamin E against prenatal and early postnatal ethanol treatment-induced heart abnormality in rats: A 3-month follow-up study. Int Immunopharmacol, 2015; 26(1):72–79; doi: 10.1016/j.intimp.2015.03.008

36.

Sukegawa

, Ihara

, Yuge

, et al. Effects of oral administration of heat-killed Enterococcus faecium strain NHRD IHARA in post-weaning piglets. Anim Sci J, 2014; 85(4):454–460; doi: 10.1111/asj.12163

37.

Tkach

, Thery

. Communication by extracellular vesicles: Where we are and where we need to go. Cell, 2016; 164(6):1226–1232; doi: 10.1016/j.cell.2016.01.043

38.

Wang

, Kirpich

, Liu

, et al. Lactobacillus rhamnosus GG treatment potentiates intestinal hypoxia-inducible factor, promotes intestinal integrity and ameliorates alcohol-induced liver injury. Am J Pathol, 2011; 179(6):2866–2875; doi: 10.1016/j.ajpath.2011.08.039

39.

Wang

, Lei

, Du

, et al. Protection of gastrointestinal mucosa from acute heavy alcohol consumption: The effect of berberine and its correlation with TLR2, 4/IL1beta-TNFalpha signaling. PLoS One, 2015; 10(7):e0134044; doi: 10.1371/journal.pone.0134044

40.

Wang

, Yang

, Zhang

, et al. Role of extracellular vesicles in placental inflammation and local immune balance. Mediators Inflamm, 2021; 2021:5558048; doi: 10.1155/2021/5558048

41.

, Wang

, Meng

, et al. Total C-21 steroidal glycosides, isolated from the root tuber of Cynanchum auriculatum Royle ex Wight, attenuate hydrogen peroxide-induced oxidative injury and inflammation in L02 cells. Int J Mol Med, 2018; 42(6):3157–3170; doi: 10.3892/ijmm.2018.3896

42.

Xiong

, Wang

, Nennich

, et al. Transfer of dietary aflatoxin B1 to milk aflatoxin M1 and effect of inclusion of adsorbent in the diet of dairy cows. J Dairy Sci, 2015; 98(4):2545–2554; doi: 10.3168/jds.2013-7842

43.

Yang

, Xiang

, He

. Beverage intake and risk of Crohn disease: A meta-analysis of 16 epidemiological studies. Medicine (Baltimore), 2019; 98(21):e15795; doi: 10.1097/MD.0000000000015795

44.

Zhao

, Chen

, Yuan

, et al. Dietary Bacillus subtilis supplementation alleviates alcohol-induced liver injury by maintaining intestinal integrity and gut microbiota homeostasis in mice. Exp Ther Med, 2021; 22(5):1312; doi: 10.3892/etm.2021.10747