Rapid Identification of Common β-Thalassemia Mutations in the Chinese Population Using Duplex or Triplex Amplicon Genotyping by High-Resolution Melting Analysis

Abstract

β-Thalassemia is one of the most prevalent inherited diseases in China. To date, over 20 β-thalassemia mutations have been identified in the Chinese population, and four mutations [CD41-42 (-4 bp), IVS-2-654C→T, CD17A→T, and -28A→G] account for ∼90% of the cases. Therefore, the exploration of simple, reliable, and rapid approaches for molecular detection of these common mutations is important for prevention and early diagnosis of the disease. High-resolution melting (HRM) analysis is a new technique for mutation detection that has the advantages of rapidity, accuracy, and convenience. Building on one-amplicon genotyping by HRM analysis, we developed duplex and triplex amplicon genotyping to simultaneously identify these common β-thalassemia mutations in patients or carriers. Two or three sets of primers were combined to conduct duplex or triplex amplicon genotyping, which distinguished a variety of genotypes by HRM based on the melting curve shapes. Seventy-one DNA samples from β-thalassemia traits or patients were analyzed using the described approaches and 65 were identified to carry the 4 common β-thalassemia alleles including 56 heterozygous mutations [23 for CD41-42 (-4 bp), 18 for IVS-2-654C→T, 11 for CD17A→T, and 4 for -28A→G], 3 homozygous mutations for IVS-2-654C→T, and 6 compound heterozygous mutations [CD41-42 (-4 bp)/IVS-2-654C→T (4 cases), -28A→G/CD17A→T (1 case), IVS-2-654C→T/CD17A→T (1 case)]. The whole procedure for mutation detection was completed within only half an hour. The results derived from HRM analysis were fully in accordance with sequencing. We suggest this rapid and accurate method for molecular screening to detect the common β-thalassemia mutations in the Chinese population as well as in other ethnic groups and nationalities in which the above four β-thalassemia alleles are prevalent.

Introduction

β-thalassemia, one of the most prevalent blood disorders worldwide, is characterized by microcytosis and hypochromic anemia resulting from mutations of the human β-globin locus (Weatherall and Clegg, 2001). To date, over 200 different causative mutations in the human β-globin gene have been found worldwide (Kazazian and Boehm, 1988; Rund and Rachmilewitz, 2005). Most of the carriers or individuals with β-thalassemia are in good health; occasionally, they are mildly anemic. However, individuals who are homozygous or compound heterozygous for β-thalassemia mutations manifest a marked decrease in the rate of β-globin synthesis and require regular blood transfusions to sustain their lives. Individuals so affected usually die before the age of 25 as a direct result of cardiac iron deposition if they are not given chelation treatment (Kazazian and Boehm, 1988; Weatherall and Clegg, 2001).

β-Thalassemia is common in China (Zeng and Huang, 1987; Huang et al., 1990). It has been calculated that ∼1%-3% of the people in southern China carry a β-thalassemia allele (Chang and Liu, 1995; Ko and Xu, 1998), causing a relatively serious public health problem. Over 20 β-thalassemia mutations have been reported in the Chinese population (Poncz et al., 1982; Ko and Xu, 1998; Jia et al., 2003; Mo et al., 2005; Chen et al., 2007; Ye et al., 2007; hih et al., 2009). Previous studies showed that among these mutations, four mutations [CD41-42 (-4 bp), IVS-2-654C → T, CD17A → T, and -28A → G] account for ∼90% of the cases in the Chinese population (Zeng and Huang, 1987; Kazazian et al., 1986; Chan et al., 1987; Zhang et al., 1988). These common β-thalassemia mutations cause nonfunctional mRNA, aberrant RNA processing, or defects in RNA transcription, resulting in absent or reduced production of β-globin protein. Various methods have been applied for the clinical detection of β-thalassemia mutations, including restriction fragment length polymorphism analysis, denaturing gradient gel electrophoresis, reverse dot blot hybridization, amplification refractory mutation system, allele-specific oligonucleotide blot, microarrays, and denaturing high-performance liquid chromatography (Old et al., 1984; Cai et al., 1988; Newton et al., 1989; Cai and Kan, 1990; Cai et al., 1994; van Moorsel et al., 2004; Li et al., 2008). However, the above approaches are costly or technically time consuming and do not appear to be suitable for rapid molecular diagnosis in clinical practice or for molecular screening in large populations. Therefore, a reliable and rapid method of detecting the common β-thalassemia mutations would be beneficial for both physicians and patients.

High-resolution melting (HRM) analysis is a new and rapid method for mutation detection, in which polymerase chain reaction (PCR) and mutation scanning are carried out simultaneously in a single procedure within 30 min (Reed et al., 2007). In the present study, we used HRM analysis to identify β-thalassemia mutations in Chinese patients or carriers. In particular, duplex or multiplex amplicon genotyping by HRM analysis was developed to rapidly identify the four most common Chinese β-thalassemia mutations.

Materials and Methods

Patients and DNA samples

A total of 91 subjects (9 β-thalassemia major, 62 β-thalassemia minor, and 20 normal individuals) were evaluated by HRM analysis. These samples were provided by Shanghai Children's Hospital. Informed consent was obtained from each participant, and the study was approved by the ethics committee of Shanghai Children's Hospital. Human genomic DNA was extracted using the standard phenol/chloroform method from leukocytes in peripheral blood.

Primers

Four sets of PCR primers were designed according to the human β-globin gene DNA sequence (NCBI Reference Sequence: NG_ooooo7.3) to generate four different amplicons by PCR (Table 1). Primer set A1 + A2 was used to detect mutations in the promoter and part of exon 1 (amplicon 1), primer set A3 + A4 was used to detect mutations in parts of exon 1 and intron 1 (amplicon 2), primer set A5 + A6 was used to detect mutations in parts of intron 1 and exon 2 (amplicon 3), and primer set A7 + A8 was used to detect mutations in intron 2 (amplicon 4). Each amplicon was <200 bp in length and covered one common β-globin mutant site found in Chinese β-thalassemia patients (Fig. 1).

FIG. 1.

Schematic representation of the locations of the four amplicons and four common mutant sites within the β-globin gene.

Table 1.

Primers for High-Resolution Melting Analysis of β-Thalassemia Mutations

Sequence to be detected	Amplicon	Primer name	Primer type	Sequence (5' to 3')	Length of PCR amplicon (bp)	Annealing temperature (°C)
Promoter and exon 1	Amplicon 1	A1	Sense	GCCAGGGCTGGGCATAAA	129	55
		A2	Antisense	ACGGCAGACTTCTCCTCA
Exon 1 and intron 1	Amplicon 2	A3	Sense	CTGAGGAGAAGTCTGCCGTTAC	105	55
		A4	Antisense	GGGACCTGTCTTGTAACCTTGATA
Intron 1 and exon 2	Amplicon 3	A5	Sense	GCCTATTGGTCTATTTTCC	108	49
		A6	Antisense	TGCCCATAACAGCATCAG
Intron 2	Amplicon 4	A7	Sense	GGCTCATGGCAAGAAAGT	163	50
		A8	Antisense	GGGAAGAAAACATCAAGCGTC

PCR, polymerase chain reaction.

For more rapid and simultaneous detection of the four common mutations, duplex or triplex amplicon genotyping by HRM analysis was developed using two or three sets of primers simultaneously.

HRM analysis

PCR was performed on the Rapid Cycler (Idaho Technology, Salt Lake City, UT). Approximately 50 ng of DNA was amplified in a total volume of 10 μL containing 200 nM of each primer, 2 mM MgCl₂, 0.01% bovine serum albumin, and 1 μL LCGreen I dye (Idaho Technology). The reaction conditions included an activation step at 94°C for 15 s, followed by a 35-cycle program of 94°C for 5 s, 55°C-49°C (according to Table 1) for 10 s, and 72°C for 20 s, with final extension at 72°C for 1 min 30 s. For multiplex PCR, the exact concentrations of every set of primers in the master mixes as well as the annealing temperature and cycling conditions for each of the reactions varied slightly (Table 2).

Table 2.

Concentrations of Primers and T_ms in 10 ml Multiplex Polymerase Chain Reaction Amplification Systems

Multiplex PCR amplification	Primer type	Annealing temperature (°C)	Concentration of primer (nM)
Amplicon 1, amplicon 2	A1, A2	50	Each of 100
	A3, A4		Each of 10
Amplicon 3, amplicon 4	A5, A6	49	Each of 100
	A7, A8		Each of 50
Amplicon 2, amplicon 4	A3, A4	50	Each of 50
	A7, A8		Each of 100
Amplicon 1, amplicon 2, amplicon 4	A1, A2	50	Each of 100
	A3, A4		Each of 10
	A7, A8		Each of 50

HRM analysis was performed using the HR-1 instrument (Idaho Technology) and carried out over a temperature range from 72°C to 95°C, rising at 0.3°C/s with 100 acquisitions per degree. The melting curves were normalized for direct comparison among samples. For duplex or triplex amplicon genotyping by HRM analysis, after normalization of fluorescence and removal of the exponential background, derivative melting curves were applied for comparison among samples. HRM analysis of both shape and peak height was performed in duplicate for each sample.

Results

First, one-amplicon genotyping was used to detect β-globin mutations associated with β-thalassemia by HRM analysis. Four sets of primers amplified four different amplicons with PCR, and each amplicon involved one common mutant site in human β-globin gene, which could be clearly identified by HRM based on the melting curve shapes (Fig. 2A-D). In addition to the common mutant sites located in the amplicons, some rare β-thalassemia mutations were also involved in the same amplicons. Therefore, at least one common mutation plus one rare mutation could be simultaneously detected by one-amplicon genotyping using HRM analysis. For instance, two mutations (CD17A → T and c.84-85insC) were simultaneously identified in amplicon 2 with HRM analysis (Fig. 2B).

FIG. 2.

Screening of β-thalassemia mutations in the Chinese by one-amplicon genotyping using HRM analysis. The arrowheads demonstrate different genotypes. (A) -28A → G heterozygotes detected by amplicon 1; (B) CD17A → T and c.84-85insC heterozygotes detected by amplicon 2; (C) CD41-42 (-4 bp) heterozygotes detected by amplicon 3; and (D) IVS-2-654C → T heterozygotes and homozygotes detected by amplicon 4. HRM, high-resolution melting.

For more rapid and efficient scanning of the common β-thalassemia mutations, we used the results of one-amplicon genotyping to develop duplex and triplex amplicon genotyping by HRM analysis. Because the T_ms of the two or three amplicons were different from each other, two or three different genotyping loci for the genotyping curve would appear in each sample and one locus represented one amplicon in the genotyping curve (Fig. 3A-C). When duplex amplicon genotyping was used to detect -28A → G and CD17A → T mutation combinations using amplicon 1 and amplicon 2 in different samples, four different genotyping curves for four different genotypes (CD17A → T heterozygote, -28A → G heterozygote, -28A → G/CD17A → T double heterozygote, and wild-type) were easily discriminated from one another (Fig. 3A). In evaluation of CD17A → T and IVS-2-654C → T, or CD41-42 (-4 bp) and IVS-2-654C → T mutation combinations using amplicon 2 and amplicon 4 or amplicon 3 and amplicon 4, five different genotyping curves corresponding to five different genotypes were observed: IVS-2-654C → T/IVS-2-654C → T homozygote, IVS-2-654C → T heterozygote, CD17A → T or CD41-42 (-4 bp) heterozygote, IVS-2-654C → T/CD17A → T or CD41-42 (-4 bp)/IVS-2-654C → T double heterozygote, and wild type (Fig. 3B, C). When triplex amplicon genotyping was used to detect the various mutation combinations with IVS-2-654C → T, CD17A → T, and -28A → G simultaneously using amplicon 1, amplicon 2, and amplicon 4 in different samples, seven different genotyping curves were produced by HRM analysis, which represented seven different genotypes: IVS-2-654C → T heterozygote, IVS-2-654C → T homozygote, CD17A → T heterozygote, -28A → G heterozygote, IVS-2-654C → T/CD17A → T double heterozygote, -28A → G/CD17A → T double heterozygote, and wild type (Fig. 4A-H). Therefore, each genotype had a unique melting curve shape that was nearly identical in different samples if they had the same genotype (Fig. 4B-H).

FIG. 3.

Screening of common β-thalassemia mutations by duplex amplicon genotyping using HRM analysis. Different curves marked by arrowheads denote different genotypes. They are (A) -28A → G/CD17A → T double heterozygotes, -28A → G and CD17A → T heterozygotes, and wild type; (B) IVS-2-654C → T/CD17A → T double heterozygotes, CD17A → T and IVS-2-654C → T heterozygotes, IVS-2-654C → T homozygote, and wild type; (C) CD41-42(-4 bp)/IVS-2-654C → T double heterozygotes, CD41-42(-4 bp) and IVS-2-654C → T heterozygotes, IVS-2-654C → T homozygote, and wild type.

FIG. 4.

Screening of common β-thalassemia mutations by triplex amplicon genotyping using HRM analysis. Different curves marked by arrowheads denote different genotypes. (A) IVS-2-654C → T, -28A → G and CD17A → T heterozygotes, IVS-2-654C → T homozygote, and IVS-2-654C → T/CD17A → T and -28A → G/CD17A → T double heterozygotes. The representative melting curves of every genotype in different samples with the same genotype are shown in panels B-H, respectively. The loci of each genotyping curve marked by arrowheads represent different genotypes. These loci include -28AA homozygous wild type, -28A → G heterozygous mutation, CD17AA homozygous wild type, CD17A → T heterozygous mutation, IVS-2-654CC homozygous wild type, IVS-2-654C → T homozygous mutation, and IVS-2-654C → T heterozygous mutation. (B) IVS-2-654C → T heterozygotes; (C) CD17A → T heterozygotes; (D) -28A → G heterozygotes; (E) IVS-2-654C → T homozygotes; (F) -28A → G/CD17A → T double heterozygotes; (G) IVS-2-654C → T/CD17A → T double heterozygotes; (H) wild types.

In total, 71 samples were identified to have β-thalassemia mutations, of which 65 were identified to carry the four common β-thalassemia alleles: 56 heterozygous mutations: 23 for CD41-42 (-4 bp), 18 for IVS-2-654C → T, 11 for CD17A → T, and 4 for -28A → G. Three cases were homozygous mutations for IVS-2-654C → T and there were six compound heterozygous mutations for CD41-42 (-4 bp)/IVS-2-654C → T (four cases), -28A → G/CD17A → T (one case), and IVS-2-654C → T/CD17A → T (one case). In addition to the four common mutations, six cases were found to have another type of heterozygous mutation (c.84-85insC).

The mutations detected by HRM analysis in all the samples were confirmed by DNA sequencing or multiplex allele-specific amplification (Mao et al., 1996).

Discussion

This study demonstrates that duplex or triplex amplicon genotyping by HRM analysis can be used to rapidly and accurately detect the four most common β-thalassemia mutations. Duplex or multiplex amplicon genotyping by HRM analysis was reported to detect multiple mutations derived from different genes (Liew et al., 2006; Seipp et al., 2007; Seipp et al., 2008; Seipp et al., 2009). In contrast to the previous studies, our duplex or triplex amplicon genotyping system was applied to identify several mutations in one specific gene (human β-globin), in which some common mutation sites are far away from each other. Multiple amplicons targeting different loci can be separated naturally by T_m based on their guanine-cytosine content and sequence. When duplex amplicon genotyping was used to detect two different common β-thalassemia mutations by HRM analysis, six different genotyping curves derived from the two mutation combinations (two types of heterozygotes, two types of homozygotes, one type of double heterozygote as well as wild type) can be theoretically obtained. However, when we used duplex amplicon genotyping to detect some mutation combinations such as IVS-2-654C → T with CD17A → T, IVS-2-654C → T with CD41-42 (-4 bp), or −28A → G with CD17A → T, only four or five different types were shown because some genotypes were not present in the tested samples. Moreover, triplex amplicon genotyping by HRM analysis should generate 10 different genotyping curves derived from three mutation combinations (three types of heterozygotes, three types of homozygotes, three types of double heterozygotes as well as wild type). In our tested samples, because of the absence of some types of β-thalassemia mutations, only seven genotypes derived from the combinations of three common β-thalassemia mutations (-28A → G, CD17A → T, and IVS-2-654C → T) were distinctly determined by triplex amplicon genotyping with HRM analysis. Quadruplex amplicon genotyping may be possible by HRM analysis if the genotyping locus of each amplicon is clearly separated in temperature without overlap and the T_ms of primers are nearly identical. Unfortunately, in our study, the T_m of amplicon 3 overlapped with that of amplicon 1. Accordingly, we could not definitively distinguish the genotypes from one another using quadruplex amplicon genotyping, and only duplex or triplex amplicon genotyping was applied for the identification of the common β-thalassemia mutations by HRM analysis in the present study.

We noted that the genotyping curve of amplicon 1 in our study was not very significant in triplex amplicon genotyping. We surmised that this may have been caused by the relatively low amplification efficiency of primer set A1 + A2 compared with that of primer set A3 + A4, which was obviously superior to the other two sets of primers, or may be due to the mutual depression among primers. Thus, to minimize interference and equalize the amplification efficiency of different sets of primers, it is important to adjust the concentration of every set of primers in duplex or triplex amplicon genotyping. Further, good DNA quality and uniform DNA concentration in samples are also important for success, especially for multiplex amplicon genotyping by HRM analysis.

In contrast to one-amplicon genotyping by HRM analysis, duplex or triplex amplicon genotyping can detect multiple mutations far away from each other. Moreover, this method also improves the throughput. We propose that the rapid-cycle multiplex PCR associated with HRM analysis may be considered as a primary screening method for detecting the common β-thalassemia mutations, such as CD41-42 (-4 bp), IVS-2-654C→T, CD17A→T, and -28A→G, which constitute the majority of β-thalassemia alleles in the Chinese and Southeast Asian populations.

Although multiple amplicon genotyping by HRM analysis is rapid, efficient, and cost-effective than other methods and it is especially practical for scanning the common β-thalassemia mutations, it is not likely to be useful for simultaneously distinguishing all of the mutations involved in these amplicons. Thus, as a supplement, one-amplicon genotyping can be used to detect multiple rare mutations that are close together and cannot be definitively identified using the multiplex amplicon genotyping method. For instance, we simultaneously identified CD17A → T and c.84-85insC mutations using one-amplicon genotyping by HRM analysis in this study.

Conclusion

We developed a more rapid and simple method to detect the common Chinese β-thalassemia mutations with duplex or triplex amplicon genotyping by HRM analysis. Our results indicated that the application of HRM analysis of multiplex amplicon genotyping, in association with one-amplicon genotyping, is a highly efficient method to identify β-thalassemia mutations.

Footnotes

Acknowledgments

This work was supported by grants from the National “863” Program of China (2007AA02Z400), the National Scientific and Technologic Supporting Project of China (2006BAI05A07, 2006BAI05A08), Shanghai Shen-Kang Hospital Developmental Center (SHDC12007101), Joint-Key Project from Shanghai Health Bureau (2008ZD004), Key Project from Shanghai Municipality (08JC1413000) and State and Shanghai Leading Academic Discipline (B204).

Disclosure Statement

None of the authors report any potential conflicts of interest.

References

Cai

, Kan

. 1990. Identification of the multiple β-thalassemia mutations by denaturing gradient gel electrophoresis. J Clin Invest, 85:550-553.

Cai

, Wall

, Kan

et al. 1994. Reverse dot blot probes for the screening of β-thalassemia mutations in Asians and American blacks. Hum Mutat, 3:59-63.

Cai

, Zhang

, Huang

et al. 1988. A simple approach to prenatal diagnosis of β-thalassemia in a geographic area where multiple mutations occur. Blood, 71:1357-1360.

Chan

, Chan

, Chahab

et al. 1987. Distribution of β-thalassemia mutations in south China and their association with haplotypes. Am J Hum Genet, 41:678-685.

Chang

, Liu

. 1995. Molecular diagnosis of thalassemia in Taiwan. Kaohsiung J Med Sci, 11:371-378.

Chen

, Mo

, Li

et al. 2007. A novel mutation of −73(A-NT) in the CCAAT box of the beta-globin gene identified in a patient with the mild beta-thalassemia intermedia. Ann Hematol, 86:653-657.

Huang

, Zhou

, Zhu

et al. 1990. Detection of β-thalassemia mutations in the Chinese using amplified DNA from dried blood specimens. Hum Genet, 84:129-131.

Jia

, Lao

, Li

et al. 2003. A rare beta-thalassaemia mutation (C-T) at position −90 of the beta-globin gene discovered in a Chinese family. Haematologica, 88:1191-1193.

Kazazian

Jr. , Boehm

. 1988. Molecular basis and prenatal diagnosis of β-thalassemia. Blood, 72:1107-1116.

10.

Kazazian

Jr. , Dowling

, Waber

et al. 1986. The spectrum of β-thalassemia genes in China and South-east Asia. Blood, 68:964-966.

11.

, Xu

. 1998. Molecular study and prenatal diagnosis of alpha-and beta-thalassemias in Chinese. J Formos Med Assoc, 97:5-15.

12.

, Li

, Huang

et al. 2008. Rapid genotyping of known mutations and polymorphisms in β-globin gene based on the DHPLC profile patterns of homoduplexes and heteroduplexes. Clin Biochem, 41:681-687.

13.

Liew

, Nelson

, Margraf

et al. 2006. Genotyping of human platelet antigens 1 to 6 and 15 by high-resolution amplicon melting and conventional hybridization probes. J Mol Diagn, 8:97-104.

14.

Mao

, Sheng

, Cheng

et al. 1996. Prenatal diagnosis of β-thalassemia using multiplex allele-specific amplification (MASPCR) in Chinese families. Haematology, 1:253-257.

15.

, Li

et al. 2005. A novel frameshift mutation (+G) at codons 15/16 in a beta0 thalassaemia gene results in a significant reduction of beta globin mRNA values. J Clin Pathol, 58:923-926.

16.

Newton

, Graham

, Heptinstall

et al. 1989. Analysis of any point mutation in DNA, the amplification refractory mutation system (ARMS) Nucleic Acids Res, 17:2503-2516.

17.

Old

, Petrou

, Modell

, Weatherall

. 1984. Feasibility of antenatal diagnosis of β-thalassaemia by DNA polymorphisms in Asian Indian and Cypriot populations. Br J Haematol, 57:255-263.

18.

Poncz

, Ballantine

, Solowiejczyk

et al. 1982. Beta-thalassemia in a Kurdish Jew. Single base changes in the T-A-T-A box. J Biol Chem, 257:5994-5996.

19.

Reed

, Kent

, Wittwer

. 2007. High-resolution DNA melting analysis for simple and efficient molecular diagnostics. Pharmacogenomics, 8:597-608.

20.

Rund

, Rachmilewitz

. 2005. Beta-thalassemia. N Engl J Med, 353:1135-1146.

21.

Seipp

, Durtschi

, Liew

et al. 2007. Unlabeled oligonucleotides as internal temperature controls for genotyping by amplicon melting. J Mol Diagn, 9:284-289.

22.

Seipp

, Durtschi

, Voelkerding

et al. 2009. Multiplex amplicon genotyping by high-resolution melting. J Biomol Tech, 20:160-164.

23.

Seipp

, Pattison

, Durtschi

et al. 2008. Quadruplex genotyping of F5, F2, and MTHFR variants in a single closed tube by high-resolution amplicon melting. Clin Chem, 54:108-115.

24.

Shih

H-C

, Er

T-K

, Chang

T-J

. 2009. Rapid identification of HBB gene mutations by high-resolution melting analysis. Clin Biochem, 42:1667-1676.

25.

van Moorsel

, vanWijngaarden

, Fokkema

et al. 2004. Beta-globin mutation detection by tagged singlebase extension and hybridization to universal glass and flow-through microarrays. Eur J Hum Genet, 12:567-573.

26.

Weatherall

, Clegg

. 2001. The Thalassemia Syndromes, fourth. Blackwell Science Ltd.: Oxford, England, 237-286.

27.

, Zhang

, Lei

. 2007. Molecular analysis of alpha/beta-thalassemia in a Southern Chinese Population. Genet Test, 11:75-83.

28.

Zhang

, Cai

, He

et al. 1988. Molecular basis of β-thalassemia in south China, strategy for DNA analysis. Hum Genet, 78:37-40.

29.

Zeng

, Huang

. 1987. Disorders of hemoglobin in China. J Med Genet, 24:578-583.