IVSII-666 of Human Beta-Globin Gene: A Polymorphic Marker Linked to Codon 8(-AA) Mutation

Abstract

Aims: IVSII-666 (C-T) is one of the polymorphic sites located in the second intron of the β-globin gene. Its polymorphism rate and relationship to a specific mutation are studied for the first time on 211 DNA samples of thalassemia trait patients living in Mazandaran province in North Iran using Ssp1 restriction enzyme. β-Globin haplotype determination at XmnI/^Gγ, HincII/3′Ψβ, HinfI/5′β, RsaI/5′β, and SspI/β sites was also performed by analysis of family members. Results: Nineteen different haplotypes were encountered in 211 unrelated thalassemia trait patients. One hundred twenty-seven patients (60.2%) were homozygous (+/+), 81 (38.4%) were heterozygous (+/−), and 3 (1.4%) were homozygous (−/−) for Ssp1 polymorphism. Of 24 mutant chromosomes negative for SspI, 16 were linked to mutation in codon 8(-AA). All codon 8(-AA) mutations were linked to the SspI-negative site. Conclusion: The SspI site can be used as a marker for tracking either normal β-globin gene (11.9%) or mutant alleles at codon 8 during prenatal diagnosis.

Introduction

Thalassemia is the most common single gene disorder in the world: 3% of the world and 5% of the Iranian population are carriers of the disease (Habibzadeh et al., 1998). Ten percent of the population in the north province of Iran (Mazandaran) has the thalassemia trait, and without any preventive measure, one would expect 150 new affected births each year. As thalassemia major causes several physical and emotional problems for the patient and imposes high economic expenses for the society, birth prevention of affected neonates would be the best solution.

Several studies showed that each population has its own specific mutations; but in Iran, as the community is very heterogenous, more than 50 different mutations have been reported (Najmabadi et al., 2001, 2002; Derakhshandeh-Peykar et al., 2007; Hosseinpour Feizi et al., 2008; Galehdari et al., 2010; Rahimi et al., 2010; Sarookhani and Ahmadi, 2010), and in some parts of the country, 10%-20% of mutations in thalassemia traits are not diagnosed directly using routine polymerase chain reaction (PCR) analysis methods.

As molecular diagnosis with common laboratory methods is not conclusive for unknown mutations, linkage analysis study, which uses polymorphic sites near or within the corresponding gene, is a useful, robust, accurate alternative method for the detection of β thalassemia in cases wherein that prenatal diagnosis is considered.

Moreover, as errors in prenatal diagnosis may occur even in experienced specialized laboratories (Old et al., 2000), even in cases wherein mutation detection is possible by routine laboratory methods, it is recommended to confirm the fetus's genotype by at least two different methods to reduce errors due to human manipulations or allele dropout. Thus, in many prenatal diagnostic laboratories, direct mutation analysis and indirect methods such as linkage analysis are performed simultaneously.

The β-globin gene cluster region represents over 20 restriction fragment length polymorphisms (RFLPs), which are mostly located outside the β-globin-coding region (Antonarakis et al., 1985) or show a low polymorphism, making them unfavorable for prenatal diagnosis process.

Regarding a hotspot region for recombination between δ- and β-globin genes (Old et al., 1986; Smith et al., 1992), using a polymorphic marker within the β-globin gene will reduce diagnosis errors due to recombination. An AvaII site in nucleotide 16 of IVSII and Alw44 in codon 2 are among the intragenic polymorphic sites of the β-globin gene. There is also another polymorphic site in IVSII-666 of the β-globin gene in the Mediterranean population that is cleavable by SspI restriction enzyme. The principal aim of this study, which was carried out for the first time in Iran, was to determine the SspI polymorphism rate and its relationship to a particular mutation or haplotype. The high incidence of polymorphism at this site could make it a beneficial marker for linkage analysis in prenatal diagnosis.

Materials and Methods

DNA extraction

The DNA of 211 thalassemia trait unrelated patients living in Mazandaran province and their family members (when available) was extracted from peripheral blood after alkaline lysis.

Genotype determination at SspI polymorphic site

PCR was performed on 200 ng DNA using china3 and china4 primers as described by Cai et al. (1994). Fifteen microliters of each PCR product was digested overnight by 10 units SspI enzyme. The results of digestion were visualized under UV illumination on a 3% agarose gel.

β-Globin haplotype determination

Five RFLP sites within the β-globin gene cluster were analyzed with PCR amplification followed by restriction enzyme digestion. These sites correspond to Xmn/^Gγ, HincII/3′Ψβ, HinfI/5′β, RsaI/5′β, and SspI/β. Each of the 211 thalassemia trait patients was scored for the presence (+) or absence (−) of each of the five RFLP sites. For 168 of them, β-globin gene cluster haplotypes were constructed by studying segregation in families, to establish the linkage phase. The primers sequences and the expected fragments size are summarized in Table 1.

Table 1.

Primers Sequences and Expected Polymerase Chain Reaction and Digested Products Size

Polymorphic site	Primers sequences 5′→3′	PCR products size (bp)	Digested fragments size (bp)
XmnI/^Gγ	F: AACTGTTGCTTTATAGGATTTT	657	456, 201
	R: AGGAGCTTATTGATAACCTCAGAC
HincII/3′Ψβ	F: TCTGCATTTGACTCTGTTAGC	620	540, 80
	R: GGACCCTAACTGATATAACTA
HinfI/5′β	F: CCTCACCTGAGGAGTTAATT	770	622, 148
	R: CTACCATAATTCAGCTTTGGGAT
RsaI/5′β	Same as HinfI/5′β primers	770	587, 183
SspI/β	China3: GTGTACACATATTGACCAAA	422	200, 16, 206 (SspI+)
	China4: AGCACACAGACCAGCACGTT		216, 206 (SspI−)

Mutation detection

For each thalassemia trait patient, the mutation at the β-globin gene was determined by the reverse dot blot method as described by Cai et al. (1994) and Maggio et al. (1993). Patients were screened for 22 mutations including −101(C-T), −88(C-A), −30(T-A), −28(A-C), −26(A-C), codon 5(-CT), codon 8(-AA), Fr 8/9(+G), codon 15(G-A), codon 16(-C), codon 22(-7 bp), codon 30(G-C), IVSI-1(G-A), IVSI-5(G-C), IVSI-6(T-C), IVSI-110(G-A), IVSI-130(G-C), IVSI(-25 bp), codon 39(C-T), codon 44(-C), IVSII-1(G-A), and IVSII-745(C-G).

Results

Among 211 carriers tested, 127, 81, and 3 showed +/+, +/−, and −/− genotypes, respectively, at the SspI polymorphic site in the β-globin gene.

Table 2 shows the number of + and − alleles in the SspI site. As this table illustrates, 87 chromosomes were SspI negative. Therefore, the amount of SspI-negative site is 20.6% among the population studied.

Table 2.

Prevalence of + and − Alleles in SspI Site

SspI site	Number of chromosomes	%
+	335	79.4
−	87	20.6
Total	422	100

Table 3 represents the distribution of (+) and (−) sites in normal and mutant alleles. (+) and (−) sites were assigned to normal and mutant alleles based on segregation in each family's members. For 43 thalassemia trait patients, necessary family members were not available, and consequently, it was not possible to assign (+) or (−) sites to normal or mutant alleles. For the remaining 168 thalassemia trait patients, segregation analysis in family members showed that 20 normal chromosomes (11.9%) were SspI negative and 24 mutant chromosomes (14.3%) were SspI negative.

Table 3.

Distribution of + and − Sites in Normal and Mutant Alleles

	Mutant alleles		Normal alleles
SspI site	N	%	N	%
+	144	85.7	148	88.1
−	24	14.3	20	11.9
Total	168	100	168	100

The assignment of + or − SspI site to normal or mutant alleles of β-globin was performed for 168 thalassemia trait patients based on their family segregation analysis.

All codon 8 (C8) carriers encountered were +/− (14 cases) or −/− (2 cases). Linkage analysis based on family study showed that in all cases, C8 was linked to an SspI-negative site. Other encountered mutant alleles linked to SspI-negative sites were Fr8/9(+G) (1 of 5 cases), codon 44(-C) (1 of 4 cases), IVSI-5(G-C) (2 of 5 cases), and IVSII-745(C-G) (3 of 4 cases).

Other mutations encountered in this study were − 28(A-C), codon 5(-CT), codon 16(-C), codon 22(-7 bp), codon 30(G-C), IVSI-1(G-A), IVSI-110(G-A), IVSI(-25 bp), IVSI-130(G-C), codon 39(C-T), and IVSII-1(G-A). None of these mutations was associated with an SspI-negative site.

Table 4 depicts the existing haplotypes in the Mazandaran population. These haplotypes were determined using five polymorphic sites at SspI/β, XmnI/^Gγ, HincII/3′Ψβ, HinfI/5′β, and RsaI/β.

Table 4.

Different Haplotypes in Mazandaran Population

Haplotypes	Xmn/^Gγ	HincII/3′Ψβ	HinfI/5′β	RsaI/5′β	SspI/β
1a	+	+	+	+	+
1b	+	+	+	+	−
2a	+	+	−	+	+
2b	+	+	−	+	−
3	+	−	+	+	+
4a	−	+	+	+	+
4b	−	+	+	+	−
5a	−	−	+	+	+
5b	−	−	+	+	−
6	+	+	−	−	^a
7a	−	+	+	−	+
7b	−	+	+	−	−
8a	−	−	+	−	+
8b	−	−	+	−	−
9	−	−	−	+	+
10	−	+	−	+	+
11a	+	+	+	−	+
11b	+	+	+	−	−
12	−	−	−	−	^a
13	−	+	−	−	+
14	+	−	−	+	^a
15a	+	−	+	−	+

The haplotypes 6, 12, and 14 were not found in this research because of their rarity.

All 2a mutant haplotypes correspond to IVSII-1 mutation and all 11b mutant haplotypes correspond to C8 mutation. However, these two mutations are also present in other haplotypes. For instance, one C8 allele was found in haplotype 7b and two C8 alleles in haplotype 8b. IVSII-1 mutation, which is the most prevalent mutation in Mazandaran, representing about 60% of mutant alleles (Najmabadi et al., 2001), was linked to seven different haplotypes.

Discussion

Regarding the high prevalence of thalassemia in Mazandaran province in Iran, prenatal diagnosis is one of the best ways for disease control.

Because in some cases, β-globin gene mutations are not detected in the country, it is necessary to use other mutation-detecting methods such as sequencing or indirect methods such as denaturing gradient gel electrophoresis (DGGE), single strand conformation polymorphism (SSCP), or RFLP analysis to follow mutant alleles for prenatal diagnosis. Moreover, RFLP can be used as a complementary method to reduce errors due to human manipulations or allele dropout during prenatal diagnosis.

Being located in a hot spot region for recombination within the β-globin gene cluster or having a low polymorphism rate is among the inconveniences of most regularly used polymorphic sites situated in the β-globin gene cluster.

As the two intragenic polymorphic sites, AvaII site in intron II and Alw44 site in codon 2, are linked inside the β-globin gene in Iranian population (personal data), more research on this subject is deemed necessary. SspI is a restriction enzyme that detects a polymorphism at nucleotide 666 in intron II of the β-globin gene and has been already reported in the Mediterranean population (Ghanem et al., 1992). This polymorphism was also encountered in European and African populations (Braun et al., 1995). No previous study concerning the polymorphism of this site was performed in Asian populations or in Iran.

The study of 422 chromosomes belonging to 211 thalassemia trait patients in Mazandaran province revealed 20.6% SspI-negative sites, with 60.2%, 38.4%, and 1.4% of the patients showing +/+, +/−, and −/− genotypes, respectively. Regarding these features, it can be effectively used in prenatal diagnosis.

The frequencies of SspI+ and SspI− in normal alleles were 0.88 and 0.12, respectively, which were slightly different from those observed in populations from southern Germany (0.86 and 0.14, respectively) and Cameroon (0.87 and 0.13, respectively) (Braun et al., 1995).

Most of the mutant alleles that were associated with the negative SspI site were also associated with mutation in C8 (16 of 24) and all of the thalassemia trait with C8 mutation have the genotype +/− or −/− for SspI site. On performing haplotype analysis using five polymorphic restriction sites within the β-globin gene cluster (SspI/β, XmnI/^Gγ, HincII/3′Ψβ, HinfI/5′β, and RsaI/β), theoretically 2⁵ haplotypes are possible, but in Mazandaran province only 22 of them were observed (personal data). None of the haplotypes 6, 12, and 14 was found in this study because of their rarity.

Based on family segregation analysis we found that all C8 mutations were linked to the SspI-negative site, no matter the haplotype. As there is a linkage disequilibrium between C8 and SspI(−) site, this polymorphic site could be used as a marker to follow C8 mutation in prenatal diagnosis when performing complementary genotype checking of the fetus.

Footnotes

Acknowledgments

The authors thank all of the patients and their families for consenting to participate in this study. The authors also acknowledge Mrs. Mandana Azizi for her technical assistance. This study was authorized by the Ethics Committee of Babol University of Medical Sciences. This work received supports from the Research Council of Babol University of Medical Sciences.

Disclosure Statement

No competing financial interests exist.

References

Antonarakis

, Kazazian

HHJ

, Orkin

. 1985. DNA polymorphism and molecular pathology of the human globin gene clusters. Hum Genet, 69:1-14.

Braun

, Ambach

, Bichlmaier

et al. 1995. Population study of a sequence polymorphism in intron 2 of the human beta-globin gene. Hum Genet, 95:352.

Cai

, Wall

, Kan

, Chehab

. 1994. Reverse dot blot probes for the screening of β-thalassemia mutations in Asians and American blacks. Hum Mutat, 3:59-63.

Derakhshandeh-Peykar

, Akhavan-Niaki

, Tamaddoni

et al. 2007. Distribution of beta-thalassemia mutations in the northern provinces of Iran. Hemoglobin, 31:351-356.

Galehdari

, Salehi

, Azmoun

et al. 2010. Comprehensive spectrum of the β-Thalassemia mutations in Khuzestan, southwest Iran population study of a sequence polymorphism in intron 2 of the human beta-globin gene. Hemoglobin, 34:461-468.

Ghanem

, Girodon

, Vidaud

et al. 1992. A comprehensive scanning method for rapid detection of beta-globin gene mutations and polymorphisms. Hum Mutat, 1:229-239.

Habibzadeh

, Yadollahie

, Merat

, Haghshenas

. 1998. Thalassemia in Iran; an overview. Arch Iran Med, 1:27-33.

Hosseinpour Feizi

, Hosseinpour Feizi

, Pouladi

et al. 2008. Molecular spectrum of beta-thalassemia mutations in Northwestern Iran. Hemoglobin, 32:255-261.

Maggio

, Giambona

, Cai

et al. 1993. Rapid and simultaneous typing of hemoglobin S, hemoglobin C, and seven Mediterranean beta-thalassemia mutations by covalent reverse dot-blot analysis: application to prenatal diagnosis in Sicily. Blood, 81:239-242.

10.

Najmabadi

, Karimi-Nejad

, Sahebjam

et al. 2001. The beta-thalassemia mutation spectrum in the Iranian population. Hemoglobin, 25:285-296.

11.

Najmabadi

, Pourfathollah

, Neishabury

et al. 2002. Rare and unexpected mutations among Iranian beta-thalassemia patients and prenatal samples discovered by reverse-hybridization and DNA sequencing. Haematologica, 87:1113-1114.

12.

Old

, Petrou

, Varnavides

et al. 2000. Accuracy of prenatal diagnosis for haemoglobin disorders in the UK: 25 years' experience. Prenat Diagn, 20:986-991.

13.

Old

, Heath

, Fitches

et al. 1986. Meiotic recombination between two polymorphic restriction sites within the β globin gene cluster. J Med Genet, 23:14-18.

14.

Rahimi

, Muniz

, Parsian

. 2010. Detection of responsible mutations for beta thalassemia in the Kermanshah Province of Iran using PCR-based techniques. Mol Biol Rep, 37:149-154.

15.

Sarookhani

, Ahmadi

. 2010. Rare and unexpected beta thalassemic mutations in Qazvin province of Iran. African Journal of Biotechnology, 9:95-101.

16.

Smith

, HO

, Clegg

et al. 1992. Recombination breakpoints in the human β-globin gene cluster. Blood, 92:4415-4421.

Haplotypes	Xmn/^Gγ	HincII/3′Ψβ	HinfI/5′β	RsaI/5′β	SspI/β
1a	+	+	+	+	+
1b	+	+	+	+	−
2a	+	+	−	+	+
2b	+	+	−	+	−
3	+	−	+	+	+
4a	−	+	+	+	+
4b	−	+	+	+	−
5a	−	−	+	+	+
5b	−	−	+	+	−
6	+	+	−	−	^a
7a	−	+	+	−	+
7b	−	+	+	−	−
8a	−	−	+	−	+
8b	−	−	+	−	−
9	−	−	−	+	+
10	−	+	−	+	+
11a	+	+	+	−	+
11b	+	+	+	−	−
12	−	−	−	−	^a
13	−	+	−	−	+
14	+	−	−	+	^a
15a	+	−	+	−	+

Haplotypes	Xmn/^Gγ	HincII/3′Ψβ	HinfI/5′β	RsaI/5′β	SspI/β
1a	+	+	+	+	+
1b	+	+	+	+	−
2a	+	+	−	+	+
2b	+	+	−	+	−
3	+	−	+	+	+
4a	−	+	+	+	+
4b	−	+	+	+	−
5a	−	−	+	+	+
5b	−	−	+	+	−
6	+	+	−	−	^a
7a	−	+	+	−	+
7b	−	+	+	−	−
8a	−	−	+	−	+
8b	−	−	+	−	−
9	−	−	−	+	+
10	−	+	−	+	+
11a	+	+	+	−	+
11b	+	+	+	−	−
12	−	−	−	−	^a
13	−	+	−	−	+
14	+	−	−	+	^a
15a	+	−	+	−	+

Haplotypes	Xmn/^Gγ	HincII/3′Ψβ	HinfI/5′β	RsaI/5′β	SspI/β
1a	+	+	+	+	+
1b	+	+	+	+	−
2a	+	+	−	+	+
2b	+	+	−	+	−
3	+	−	+	+	+
4a	−	+	+	+	+
4b	−	+	+	+	−
5a	−	−	+	+	+
5b	−	−	+	+	−
6	+	+	−	−	^a
7a	−	+	+	−	+
7b	−	+	+	−	−
8a	−	−	+	−	+
8b	−	−	+	−	−
9	−	−	−	+	+
10	−	+	−	+	+
11a	+	+	+	−	+
11b	+	+	+	−	−
12	−	−	−	−	^a
13	−	+	−	−	+
14	+	−	−	+	^a
15a	+	−	+	−	+