Abstract
Background: Congenital heart disease (CHD) is one of the most common human birth defects. The etiology and pathogenesis of CHD are complex and involve several genes as well as multiple changes in signaling pathways. The aim of this study was to identify potential pathological mutations in the Homeobox C9 (Hoxc9) gene in 350 Chinese children with CHD to further understand the etiology of CHD. Method: Sequence analysis of the Hoxc9 gene in 350 nonsyndromic patients with CHD Result: We did not identify any nonsynonymous variants in the coding regions of Hoxc9 in the patients with CHD. We found one synonymous variant c.C564T (p. his188his) in one ventricular septal defect patient. We also identified four previously reported polymorphisms (rs56368105, rs12817092, rs34079606, and rs2241820) in CHD. Conclusions: We did not find any diagnostic alterations in the coding regions of Hoxc9 among the patients with CHD. Nevertheless, to our knowledge, this is the first study of Hoxc9 in nonsyndromic CHD and has expanded our overall knowledge of the etiology of this disease.
Introduction
C
Hox genes are major regulators of development and play pivotal roles during adult tissue differentiation (Wang et al., 2009). In mammals, there are 39 Hox genes organized into four genomic clusters, designated as groups A-D (Krumlauf, 1994). The Hoxc gene cluster was located in a sensitive area that has been identified as the human simple CHD susceptibility region (Gong et al., 2005). The Homeobox C9 (Hoxc9) gene spans 3242 bp on human chromosome 12q13.13, comprises 2 exons, and encodes a 260 amino acid protein. The Hoxc9 gene is required for the development of the neural tube in the mouse embryo, and disruptions in this gene lead to a deformed heart (Shashikant and Ruddle, 1996). Over the last few decades, SMAD4 has been identified as a CHD-causing gene (Qi et al., 2007), and Smad4-MH1 could occupy one of the DNA binding sites on Hoxc9, inhibiting its transcription activity (Zhou et al., 2008). From the results of these investigations, we predicted that Hoxc9 may play a role in the development of CHD. The aim of our study was to identify potentially pathogenic mutations in Hoxc9 among 350 Chinese children with CHD and to provide insights into the etiology of the condition.
Materials and Methods
Study population
A total of 350 nonsyndromic patients with CHD were recruited in this study. Informed consent was obtained from their parents or guardians. The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki and was approved by the ethics committee of the National Research Institute for Family Planning. Clinical assessment was performed on each patient and included anthropometric measurement, physical examination for dysmorphism and malformation, and radiological evaluation. The patients also had peripheral blood taken, underwent chest X-ray examination, ultrasonic echocardiogram, and electrocardiogram.
DNA analysis
Genomic DNA was extracted from peripheral blood leukocytes using standard methods. Two exons and nearby introns of Hoxc9 gene were amplified by polymerase chain reaction using two pairs of Hoxc9 gene-specific primers. PCR primer sequences were as follows: Hoxc9 cDNA exon I, forward Primer 5'GGTGACCGGTGCCTTGG 3', reverse Primer 5' GCTCCCTGCACGGTTCG 3', amplified fragment length is 929 bp; exon II forward Primer 5'AACGGTTGGGAATTTGGACTT 3', reverse Primer 5' CCTCCTCCTCGCTGGGTAGAAC 3', amplified fragment length is 787 bp. PCR products were sequenced using the BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Foster City, CA) and run on an automated sequencer, ABI 3730XL (Applied Biosystems) to perform mutational analysis.
Results
The clinical and molecular findings in patients with cardiac defects are shown in Table 1 and include ventricular septal defect (VSD), atrial septal defect, patent ductus arteriosus, pulmonary hypertension, tetralogy of Fallot, pulmonary atresia or stenosis, patent foramen ovale, tricuspid regurgitation, and certain other complex cardiac malformations.
The sequence analysis of Hoxc9 in the 350 nonsyndromic patients with CHD did not identify any nonsynonymous variants in the coding regions. We found one synonymous variant c.C564T (p. his188his) in one VSD patient. In addition, we identified four previously reported polymorphisms in CHD : rs56368105, rs12817092, rs34079606, and rs2241820, two of these being in coding regions.
Discussion
More and more animal studies indicate that the Hox family plays an important role in embryogenesis and organ formation of vertebrates and works at different stages of transcription and translation (Krumlauf, 1994; Veraksa et al., 2000). In the past few years, research in Drosophila (Lovato et al., 2002), zebra fish (Waxman and Yelon, 2009), and mouse (Martínez et al., 2007) models have found that Hox genes were related to the development of the heart. A 3.4 cM candidate region of CHD that is located within 12q13.1∼13.3 had shown significant correlation, by transmission disequilibrium test, in 62 nuclear family trios consisting of simple patients with CHD and their parents. There is an important gene cluster in this region—Hoxc gene cluster (Gong et al., 2005). Hoxc9 has been identified in the human blastocyst, where it was related to the homeobox transcription factor of embryonic origin (postzygotic gene activation) (Huntriss et al., 2010). Hoxc9 is required throughout embryo development for restricting expression of more anterior Hox genes, and has an essential role in organizing the motor system through global repressive activities. Genome-wide analysis of Hoxc9 binding suggests that this mode of repression is mediated by direct interactions with Hox regulatory elements, independent of chromatin marks typically associated with repressed Hox genes (Jung et al., 2010). In an ENU-induced recessive mouse mutation model with multi-organ abnormalities such as cardiac disorder, axial skeletal abnormalities, and limb malformations, it has been demonstrated that Hoxc9, Hoxc10, Hoxd9, Hoxd10, and Hoxd12 were all significantly reduced (Szumska et al., 2008). The defects may have been caused by the reduced production associated with these genes.
Zhou et al. (2008) used three techniques, GST pull-down assays, surface plasmon resonance analysis, and multidimensional nuclear magnetic resonance, to analyze the interaction between the recombinant homeodomain (HD) of Hoxc9 and the MH1 domain of Smad4. He found that Smad4-MH1 can interact with the N-terminal part of the HD of Hoxc9, which, in turn, inhibits its transcriptional activity. Smad4 is the main intracellular mediator of TGF-β signaling that has been shown to participate in many physiological and pathological processes, including heart development and heart disease. Recent studies have highlighted the importance of Smad4 during embryonic cardiac developments (Lan et al., 2007; Qi et al., 2007; Song et al., 2007, 2011) and show that knockout of the Smad4 gene in mice leads to early embryonic lethality, showing attenuated vascular sprouting, ruptured blood vessels, poor trabeculation, hypoplasia of ventricles, and defects in ventricle morphogenesis. The embryos lacking Smad4 in cardiomyocytes die between E10.5 and E15.5, and very few embryos were able to survive beyond E12.5. We speculate that there may be cross communication between Hoxc9 and Smad4 which affects the early development of the heart. So, we postulated that patients with CHD might exhibit mutations in the Hoxc9 gene.
Marek et al. (2011) in a 21-year study in the Czech Republic reported on 1604 cases of prenatal diagnosis of CHD in the fetus. Termination of pregnancy occurred in 919 cases (57.3%), continuing pregnancy in 685 (42.7%) cases. Of the fetuses for which pregnancy continued, 59 (8.6%) ended in intrauterine fetal death and in 147 (8.6%), the fetus died shortly after birth. Of the 626 babies born alive (39% of those antenatally diagnosed with cardiac abnormalities), another 147 children died later. Thus, only 479 (29.9%) of the prenatally diagnosed 1604 diagnosed fetuses were alive at the end of their study. In addition to the CHD, 149 (31.2%) of these children also showed other structural malformations or chromosomal abnormalities. These data show that natural death and abortion account for a high proportion of fetal cardiovascular malformations. In the present study, we screened for potential pathogenic mutations in the Hoxc9 gene in Chinese children with nonsyndromic CHD, but did not find any diagnostic mutations in the coding regions. These results could be explained in two ways. First, our blood samples were derived from living patients and it may be that, similar to Smad4 mutations, any mutations in the coding sequence of Hoxc9, and the resultant early cardiac defects they cause, will be lethal. Mutations of the Hoxc9 may also be accompanied by other important organ deformities such as motor system defects, which will greatly reduce the survival of the fetus. Second, it may simply be that there is very little relationship between the Hoxc9 genes and the risk of CHD.
In conclusion, our understanding of the functions of the Hoxc9 gene is still very limited, and its exact role in heart development is still unknown. Further studies will be required to determine its full role, if any, in the development of the early embryonic heart.
Footnotes
Acknowledgments
This work was supported by the National Basic Research Program of China (2010CB529504), the National Science & Technology Pillar Program of China (No.2008BAH24B05).
Author's Contributions
Lei Sun performed the experiment and drafted the article. Longfei Cheng participated in its design and coordination and helped draft the article. Binbin Wang participated in revision of the article. Jing Wang carried out the molecular genetic studies. Congmin Li, Bingren Gao, Xiaochen Wang, and Tianchu Huang participated in samples collection. Hui Li and Xu Ma conceived of the study, participated in its design and coordination, and helped draft the article.
Disclosure Statement
The authors declare that no competing financial interests exist.
