Frequencies of CYP3A5*1/*3 Variants in a Moroccan Population and Effect on Tacrolimus Daily Dose Requirements in Renal Transplant Patients

Abstract

The cytochromes P450 are a superfamily of oxidative enzymes, which are implicated in the metabolism of a large number of endogenous substances as well as exogenous chemicals. The cytochrome P450 (CYP3A5) appears to play an important role in drug metabolism activity. The most frequent mutation in the CYP3A5 gene, affecting its activity, consists of a G6986A transition within intron 3. In this study, we determined the allelic frequency of CYP3A5*3 in a Moroccan population, consisting of 108 individuals including 10 renal transplant patients. About 8.33% (9/108) of the subjects were homozygous wild-type (CYP3A5*1/*1), 37.04% (40/108) were heterozygous (CYP3A5*1/*3), and 54.63% (59/108) were homozygous (CYP3A5*3/*3). Therefore, CYP3A5*3 variant was the most frequent allele detected at 73.15%. In the second part of this work, we assessed the influence of the CYP3A5 polymorphism on tacrolimus doses required for 10 renal transplant patients who are receiving tacrolimus as immunosuppressive therapy. Our results showed that, during the first 3 months after kidney transplantation, the tacrolimus daily requirements for heterozygous patients (CYP3A5*3/*1) were higher compared with homozygous patients (CYP3A5*3/*3) (0.133±0.026 vs. 0.21±0.037 mg/kg/day). After the third month the difference was also observed, whereby the mean of tacrolimus daily requirements for patients with CYP3A5*3/*3 and CYP3A5*1/*3 was 0.053±0.013 and 0.08±0.014 mg/kg/day, respectively. This first study in Morocco provides genetic data related to the frequency of genetic polymorphisms of CYP3A5 and opens the perspective to develop other pharmacogenetic studies.

Introduction

The cytochromes P450 are a superfamily of oxidative enzymes, which are implicated in the metabolism of a large number of endogenous substances as well as exogenous chemicals (Thompson et al., 2004). The cytochromes P450s are involved in the oxidation of ∼40%-60% of commonly used drugs. CYP3A4 and CYP3A5 are two major isoforms of CYP3A subfamily expressed in adult human tissues. CYP3A4 is found in the liver and small intestine, whereas CYP3A5 is polymorphically expressed in the liver, small intestine, kidney, and other organs (Murray et al., 1999; Paine et al., 2006). These isoforms represent the predominant functional forms of human CYP3A (Lin et al., 2002).

Many studies have been focused on the identification of sequence variation affecting enzyme activity in the CYP3A5 gene. The most frequent mutation in this gene consists of a G6986A transition within intron 3 (CYP3A5*3). This mutation creates an alternative splice site resulting in a frame shift and truncation of the protein (Kuehl et al., 2001; Lamba et al., 2002). Individuals who are carrying two copies of a CYP3A5*3 allele show a markedly reduced level of CYP3A5 protein expression and activity (Kuehl et al., 2001).

Many reports suggested that the CYP3A5*3 mutant allele may play an important role in interindividual differences of response to drug therapy (Ingelman-Sundberg et al., 1999; Tsuchiya et al., 2004). The association between tacrolimus, an immunosuppressive agent for preventing or treating graft rejection in organ transplantation, and CYP3A5 polymorphism was largely investigated in several studies. It has been demonstrated that renal transplant patients who are CY3A5 expressors (CYP3A5*1) required a higher dose of tacrolimus to achieve therapeutic trough concentration than nonexpressors (CYP3A5*3) (Thervet et al., 2003; Haufroid et al., 2004; Macphee et al., 2005; Quteineh et al., 2008).

In this study, we aimed to determine the allelic frequency of CYP3A5*3 in the Moroccan population. Moreover, we assessed the impact of this polymorphism on the daily dose required for 10 renal transplant patients undergoing treatment with tacrolimus.

Materials and Methods

Subjects

In this study we have genotyped a group of 108 individuals, including 98 healthy newborn infants and 10 renal transplant patients (7 men and 3 women). Newborn infants are from different regions of Morocco and the Moroccan origin of their parents and grandparents was confirmed. All renal transplant patients received tacrolimus as their main immunosuppressant; the characteristics of patients are shown in Table 2. Informed consent for DNA analysis was obtained from patients and parents of newborns.

DNA samples and polymerase chain reaction conditions

Genomic DNA was extracted from peripheral blood samples, using a salt extraction method. The concentration of genomic DNA was determined by measuring the absorbance by NanoDrop ND-2000 (Nanodrop Technologies). DNA was stored at −20°C before use. One hundred nanograms of extracted DNA was amplified in a final volume of 50 μL. The polymerase chain reaction (PCR) mixture contained 10 μL of 5× buffer (2 mM MgCl₂), 0.1 mM each of the deoxynucleotide triphosphates, 1.5 U of Go Taq (Promega), and 0.6 μM of each primer.

The forward primer was 5′aaacatataaaacattatggagagtgg3′ and reverse primer was 5′cacacccaggaagccagact3′. The PCR conditions were 1 min denaturation at 95°C; 35 cycles of 15 s at 95°C, 15 s at 59°C, and 30 s at 72°C; and a final extension step at 72°C for 7 min. Two microliters of purified product was amplified using a Big Dye kit (Applied Biosystems) as indicated in the manufacturer's protocol in a final volume of 13 μL. The PCR consisted of an initial denaturation step at 96°C for 10 s, 25 cycles at 96°C for 10 s, 50°C for 5 s, and 60°C for 4 min. The final product was sequenced using an Abi-Prism 310 sequencer (Applied Biosystems) (Fig. 1).

FIG. 1.

Direct sequencing results for the G6986A mutation in CYP3A5 gene: (A) profile of homozygous CYP3A5*3/*3 genotype; (B) profile of homozygous CYP3A5*1/*3 genotype; (C) profile of homozygous CYP3A5*1/*1 genotype.

Results

To determine the frequency of CYP3A5 polymorphism in the Moroccan population we genotyped 98 healthy newborn infants in addition to 10 renal transplant patients: 8.33% (9/108) subjects were homozygous wild-type (CYP3A5*1/*1), 37.04% (40/108) were heterozygous (CYP3A5*1/*3), and 54.63% (59/108) were homozygous (CYP3A5*3/*3) (Table 1). Therefore, CYP3A5*3 variant was the most frequent allele detected at 73.15% (Table 1).

Table 1.

CYP3A5 Allele Frequencies in Morocco and Other Population

		CYP3A5
Population	n	^*1	^*3	Reference
Moroccans	108	0.268	0.732	This study
Chinese	34	0.245	0.755	Balram et al. (2003)
Japanese	200	0.233	0.767	Fukuen et al. (2002)
Caucasians	428	0.061	0.939	Dally et al. (2004)
Spaniard	204	0.086	0.914	Sinues et al. (2007)
Afro-Americans	34	0.721	0.279	Floyd et al. (2003)
Ghanaian	200	0.85	0.15	Kudzi et al. (2010)

n, number of individuals.

In this study we have also explored the effect of the CYP3A5 genotype on the daily dose required for 10 renal transplant patients. The characteristics and genotypes of subjects participating in this study are shown in Table 2. Among 10 renal transplant patients genotyped, 6 subjects were homozygous for the CYP3A5*3 allele, while 4 subjects were heterozygous. During the first 3 months after kidney transplantation, the mean of required doses of tacrolimus for patients carrying homozygous genotype was 0.133±0.026 mg/kg/day, while for patients with a heterozygous genotype the mean was 0.21±0.037 mg/kg/day. After the third month, the mean of tacrolimus daily requirements for patients with CYP3A5*3/*3 and CYP3A5*1/*3 was 0.053±0.013 and 0.08±0.014 mg/kg/day, respectively.

Table 2.

Characteristics, Complications, and Genotypes of Renal Transplant Patients

	Age	Sex	Initial nephropathy	Lasted transplantation (month)	Amount necessary first 3 months for target (8-10 ng/mL)	Amount necessary after 3 months for target (3-7 ng/mL)	Diabetes de novo after transplantation	Neuropathy	Acute rejection	CYP3A5 genotype
Patient 1	40	W	Indetermined	36	0.3 mg/kg/day	0.1 mg/kg/day	Yes	No	No	^1/^3
Patient 2	45	M	Indetermined	36	0.19 mg/kg/day	0.1 mg/kg/day	Yes	Yes	No	^1/^3
Patient 3	32	M	Indetermined	30	0.25 mg/kg/day	0.1 mg/kg/day	Yes	No	No	^3/^3
Patient 4	21	W	Indetermined	30	0.16 mg/kg/day	0.08 mg/kg/day	No	No	No	^3/^3
Patient 5	30	M	Glomerulaire	24	0.12 mg/kg/day	0.04 mg/kg/day	No	No	No	^1/^3
Patient 6	50	M	Reflux	12	0.07 mg/kg/day	0.02 mg/kg/day	Yes	Yes	No	^3/^3
Patient 7	26	W	Reflux	12	0.12 mg/kg/day	0.06 mg/kg/day	No	No	No	^3/^3
Patient 8	45	M	Interstitielle	30	0.1 mg/kg/day	0.03 mg/kg/day	No	No	No	^3/^3
Patient 9	25	M	Reflux	12	0.23 mg/kg/day	0.08 mg/kg/day	No	No	No	^1/^3
Patient 10	43	M	Congenitale	60	0.1 mg/kg/day	0.03 mg/kg/day	Yes	No	No	^3/^3

In the study group, no acute rejection episodes were observed. However we reported, in patients with the two different genotypes, some known adverse events due to tacrolimus use (diabetes de novo and neuropathy) (Table 2).

Discussion

The family of cytochrome P450 is one of the major targets for pharmacogenetic studies. This family metabolizes more than 50% of drugs prescribed. It has been shown that certain mutations affecting genes coding for enzymes of this family have an influence on hepatic metabolism of many drugs in the body (Cholerton et al., 1992; Nebert and Russell, 2002). An example that illustrates this relationship is the effect of the CYP3A5 gene on metabolism of tacrolimus, an immunosuppressant used for prevention and treatment of transplant rejection. Many studies have explored this relationship and demonstrated that there is an effect of the CYP3A5 genotype on daily doses required for renal transplant patients. Indeed, patients with the genotype CYP3A5*1/*1 have an increased intestinal and liver metabolism, which will lead to a rapid elimination of tacrolimus from the body, and the daily dose required to achieve adequate trough levels will be higher in contrast to patients carrying the CYP3A5*3/*3 genotype (Thervet et al., 2003; Haufroid et al., 2004; Macphee et al., 2005; Quteineh et al., 2008).

In our study, we analyzed the distribution of CYP3A5 allele frequency in the Moroccan population. Then we compared these frequencies with those of other populations reported in the literature. In the Moroccan population the CYP3A5*3 allele was more frequent with a 73.2%, while the frequency of the CYP3A5*1 allele was 26.8%.

Previous studies published in other populations showed that the CYP3A5*3 allele was the most prevalent in Caucasian populations with a frequency exceeding 90%, whereas in African and African-American populations the CYP3A5*1 allele was the most frequent (Floyd et al., 2003; Dally et al., 2004; Kudzi et al., 2010). Thompson et al. (2004) showed that the frequency of the CYP3A5*3 allele shows extreme variations across human populations and is significantly correlated with distance from the equator. The results obtained in our study are concordant with these observations. Indeed, we note that the CYP3A5*3 allele in the Moroccan population has a frequency intermediate between those of European populations and African populations.

Several studies that evaluated the effect of CYP3A5 genetic polymorphisms on tacrolimus dose requirement demonstrated that there is a significant difference between renal transplant patients heterozygous or homozygous for CYP3A5*1 allele compared with CYP3A5*3 homozygotes (Thervet et al., 2003; Quteineh et al., 2008). Our results showed that during the first 3 months of transplantation, individuals carrying CYP3A5*3/*3 need lower doses to achieve the blood tacrolimus targeted trough level, than those carrying CYP3A5*1/*3. The same results were observed after the third month. Nevertheless, the limited number of patients does not allow statistically significant conclusions.

The possible presence of Moroccan patients homozygous for CYP3A5*1/*1 (8.33%) should be considered by physicians during treatment after transplantation to achieve the desired immunosuppression, as this genotype is associated with a need for significantly higher doses of tacrolimus and risk of developing acute graft rejection episodes (Quteineh et al., 2008).

Conclusion

In conclusion, this is the first study performed in a population from Morocco, in which a distribution of the CYP3A5 variants was investigated in a group of newborn infants. Our results showed that frequency of the CYP3A5*1 variant seems to be higher as compared with the Caucasians and lower than is found in black Africans. Furthermore, comparison of doses required for 10 renal transplant patients showed a difference between patients homozygous for CYP3A5*3 and those who were heterozygous; this difference needs to be explored by increasing the number of cases, even if many previous studies showed a statistically significant difference only between CY3A5*1/*1 and CY3A5*3/*3 genotypes.

Disclosure Statement

No competing financial interests exist.

References

Balram

, Zhou

, Cheung

, Lee

. 2003. CYP3A5*3 and *6 single nucleotide polymorphisms in three distinct Asian populations. Eur J Clin Pharmacol, 59:123-126.

Cholerton

, Daly

, Idle

. 1992. The role of individual human cytochromes P450 in drug metabolism and clinical response. Trends Pharmacol Sci, 13:434-439.

Dally

, Bartsch

, Jager

et al. 2004. Genotype relationships in the CYP3A locus in Caucasians. Cancer Lett, 207:95-99.

Floyd

, Gervasini

, Masica

et al. 2003. Genotype-phenotype associations for common CYP3A4 and CYP3A5 variants in the basal and induced metabolism of midazolam in European- and African-American men and women. Pharmacogenetics, 13:595-606.

Fukuen

, Fukuda

, Maune

et al. 2002. Novel detection assay by PCR-RFLP and frequency of the CYP3A5 SNPs, CYP3A5*3 and *6, in a Japanese population. Pharmacogenetics, 12:331-334.

Haufroid

, Mourad

, Van Kerckhove

et al. 2004. The effect of CYP3A5 and MDR1 (ABCB1) polymorphisms on cyclosporine and tacrolimus dose requirements and trough blood levels in stable renal transplant patients. Pharmacogenetics, 14:147-154.

Ingelman-Sundberg

, Oscarson

, McLellan

. 1999. Polymorphic human cytochrome P450 enzymes: an opportunity for individualized drug treatment. Trends Pharmacol Sci, 20:342-349.

Kudzi

, Dodoo

, Mills

. 2010. Genetic polymorphisms in MDR1, CYP3A4 and CYP3A5 genes in a Ghanaian population: a plausible explanation for altered metabolism of ivermectin in humans? BMC Med Genet, 11:111.

Kuehl

, Zhang

, Lin

et al. 2001. Sequence diversity in CYP3A promoters and characterization of the genetic basis of polymorphic CYP3A5 expression. Nat Genet, 27:383-391.

10.

Lamba

, Lin

, Schuetz

, Thummel

. 2002. Genetic contribution to variable human CYP3A-mediated metabolism. Adv Drug Deliv Rev, 54:1271-1294.

11.

Lin

, Dowling

, Quigley

et al. 2002. Co-regulation of CYP3A4 and CYP3A5 and contribution to hepatic and intestinal midazolam metabolism. Mol Pharmacol, 62:162-172.

12.

Macphee

, Fredericks

, Mohamed

et al. 2005. Tacrolimus pharmacogenetics: the CYP3A5*1 allele predicts low dose-normalized tacrolimus blood concentrations in whites and South Asians. Transplantation, 79:499-502.

13.

Murray

, McFadyen

, Mitchell

et al. 1999. Cytochrome P450 CYP3A in human renal cell cancer. Br J Cancer, 79:1836-1842.

14.

Nebert

, Russell

. 2002. Clinical importance of the cytochromes P450. Lancet, 360:1155-1162.

15.

Paine

, Hart

, Ludington

et al. 2006. The human intestinal cytochrome P450 “pie” Drug Metab Dispos, 34:880-886.

16.

Quteineh

, Verstuyft

, Furlan

et al. 2008. Influence of CYP3A5 genetic polymorphism on tacrolimus daily dose requirements and acute rejection in renal graft recipients. Basic Clin Pharmacol Toxicol, 103:546-552.

17.

Sinues

, Vicente

, Fanlo

et al. 2007. CYP3A5*3 and CYP3A4*1B allele distribution and genotype combinations: differences between Spaniards and Central Americans. Ther Drug Monit, 29:412-416.

18.

Thervet

, Anglicheau

, King

et al. 2003. Impact of cytochrome p450 3A5 genetic polymorphism on tacrolimus doses and concentration-to-dose ratio in renal transplant recipients. Transplantation, 76:1233-1235.

19.

Thompson

, Kuttab-Boulos

, Witonsky

et al. 2004. CYP3A variation and the evolution of salt-sensitivity variants. Am J Hum Genet, 75:1059-1069.

20.

Tsuchiya

, Satoh

, Tada

et al. 2004. Influence of CYP3A5 and MDR1 (ABCB1) polymorphisms on the pharmacokinetics of tacrolimus in renal transplant recipients. Transplantation, 78:1182-1187.