Polymorphisms −1082 G/A and −819 C/T in the Interleukin-10 Gene Are Not Associated with Gout Susceptibility in the Chinese Han Male Population

Abstract

Background: Gout is caused by monosodium urate crystal-induced inflammation of the joints and periarticular tissues. Interleukin 10 (IL-10) is an important immunoregulatory cytokine, levels of which can be influenced by functional single-nucleotide polymorphisms in the promoter. Objective: To investigate the association of −1082 G/A and −819 C/T polymorphisms in the IL-10 promoter with gout susceptibility in the Chinese Han male population. Methods: A case-control study was performed in 302 patients and 284 controls. Genotyping of IL-10 −1082 G/A and −819 C/T polymorphisms was performed by DNA sequencing techniques. An association analysis was analyzed by the χ² test. Results: No significant differences were found in −819T/C and −1082 A/G genotypic and allelic frequencies between gout cases and controls (for −819T/C, χ²=0.212, df=1, p=0.645 by genotype; χ²=0.079, df=1, p=0.779 by allele; for −1082 A/G, χ²=2.116, df=1, p=0.146 by genotype; χ²=1.854, df=1, p=0.173 by allele). Conclusions: IL-10 −1082 G/A and −819 C/T polymorphisms may not be associated with susceptibility to gout and thus do not play a major role in the development of gout in the Chinese Han male population.

Introduction

Gout is an autoinflammatory disease that is characterized by an increase in serum urate concentration, recurrent attacks of acute arthritis, and deposits of monosodium urate (MSU) monohydrate in and around the joints (Terkeltaub, 1993; McCarty, 1994; Bieber and Terkeltaub, 2004). With the change of lifestyle and diet, studies suggest that its prevalence and incidence have risen rapidly in recent decades in the Chinese Han male population. Once presumed to be rare, the prevalence is now demonstrated to range between 0.1% and 1.94% (Miao et al., 2008). This dramatic increase in the prevalence of gout within the past decade has been accompanied by an abundance of new research on susceptibility genes (such as glut9, ABCG2, and URAT1) (Stark et al., 2008; Li et al., 2010; Wang et al., 2010). However, environmental factors may often explain differences of disease frequency across many populations and the rapid rise in disease frequency for complex diseases; numerous risk factors also contribute to the development of gout, including hyperuricaemia, alcohol consumption, metabolic syndrome, hypertension, obesity, diuretic use, and chronic renal disease (Chou et al., 1994; Chang et al., 1997; Lin et al., 2000a; 2000b; Lyu et al., 2003).

Previous studies suggested that inflammation might play an important role in the pathogenesis of gout and regulation of serum uric acid levels. The infiltration of neutrophils into inflamed joints is presumed to be essentially involved in the pathogenesis of MSU crystal-induced gouty arthritis. Deposition of MSU crystals induces the generation of neutrophil-chemotactic and activating mediators in the inflamed joints, thereby attracting and activating the neutrophils. Activated neutrophils release proteolytic enzymes, oxygen radicals, arachidonic metabolites, and cytokines. Interleukin 10 (IL-10) is an important cytokine with anti-inflammatory and stimulatory activities (Moore et al., 2001). It is produced by T lymphocytes, B lymphocytes, monocytes, and macrophages (Mosmann, 1994). IL-10 indirectly inhibits cytokine production by both T cells and NK cells through the inhibition of macrophage and monocyte function (de Waal Malefyt et al., 1991; Fiorentino et al., 1991; Ding and Shevach et al.,1992; Hsu et al., 1992). Alternatively, IL-10 induces B cell survival, proliferation, and differentiation (Itoh and Hirohata, 1995). Levels of IL-10 production are critical in immune regulation and in balancing the inflammatory and humoral responses. Human IL-10, mapped at chromosome1q31-q32, is composed of five exons and four introns (Eskdale et al., 1997). In the IL-10 promoter region, the alleles of −1082G and −819C for two common single nucleotide polymorphisms (SNPs) have been associated with increased production of IL-10 (Eskdale et al., 1997; Turner et al., 1997; Eskdale et al., 1998; Koss et al., 2000; Jin et al., 2007). The expression of many inflammatory cytokines is thought to be influenced by functional polymorphisms in their gene loci that may contribute to susceptibility or severity of inflammatory diseases. Therefore, in this present study, we hypothesized that the genotypes of IL-10 polymorphisms may have influence on gout susceptibility and then investigated the possible association of two common promoter SNPs at position −1082A/G (rs1800896) and −819 T/C (rs1800871) with the susceptibility of gout by using a case-control study.

Materials and Methods

Study subjects

The gout patients and controls were recruited from the Department of Endocrinology or gout laboratory at the Affiliated Hospital of the Qingdao University Medical College. Three hundred two male gout patients and 284 ethnically matched controls were genotyped for IL-10 (patients' mean age: 53.49±13.36, and controls' mean age: 42.35±15.37). The diagnosis of gout was based on the preliminary criteria, which were published by the American College of Rheumatology in 1997. Controls without a personal or familial history of hyperuricemia or gout or other serious illness were collected. We measured all the participants for blood glucose, uric acid, total cholesterol (TC), triglycerides (TG), urea nitrogen, and creatinine in the plasma. All subjects were provided written informed consent, and the study protocol was approved by the Ethics Committee of Affiliated Hospital of the Qingdao University Medical College.

Genotyping

Genomic DNA was extracted from peripheral blood leukocytes (5 mL) using standard methods. The segments of the two polymorphisms were replicated using the following primers: 5′CTCGCTGCAACCCAACTGGC3′ and 5′ CTCGCTGCAACCCAACTGGC3′. Polymerase chain reaction (PCR) were carried out in a final volume of 20 μL containing 2×PCR MasterMix, 0.4mmol/L of each primer and 100 ng of genomic DNA. The reaction was carried out as follows: 94°C for 5 min, followed by 35 cycles of 95°C for 1 min, 56°C for 30 s, 72°C for 1 min, and 72°C for 10 min. Amplified PCR products were purified and sequenced using the appropriate PCR primers and the BigDye Terminator Cycle Sequencing kit (Applied Biosystems, Foster City, CA) and run on an automated sequencer, ABI 3730XL (Applied Biosystems) to perform a sequence analysis.

Statistical analysis

In this study, the Statistical Package for Social Sciences version 17.0 (SPSS, Inc., Chicago, IL) was used for a statistical analysis. The student's t-test was used to assess a significant difference in demographic and clinical characteristics between cases and controls. The Goodness of fit χ² test was used to examine Hardy-Weinberg equilibrium in gout and controls. The Pearson χ² test was used to compare the genotype and allele frequencies between controls and patients (if expected values were below 5, the Fisher's exact test was necessarily used). The odds ratios and 95% confidence intervals were used as a measure of the strength of relationships in the genotype distribution and allele frequencies between the patient cases and controls. p-Values <0.05 was considered statistically significant.

Results

Demographic and clinical characteristics of the study population

The clinical characteristics of the population enrolled in the study are summarized in Table 1. The results showed that gout patients had significantly higher body mass index (BMI) values, waist-hip ratio, blood glucose levels, TC levels, TG levels, uric acid levels, systolic pressure levels, and diastolic pressure levels than the controls (p<0.001). In addition, the serum urea nitrogen levels (p=0.398) tended to be higher in the gout patients.

Table 1.

Demographic and Clinical Characteristics (Mean±Standard Deviation) of the Study Population

Parameter	Gout (n=302)	Control (n=284)	p-Value
Age (year)	53.49±13.36	42.35±15.37	<0.001
Body mass index (kg/m²)	27.0±3.55	23.18±3.68	<0.001
WHR (cm)	0.92±0.05	0.87±0.06	<0.001
Systolic pressure (mmHg)	136.85±20.35	121.08±16.823	<0.001
Diastolic pressure (mmHg)	88.12±12.76	79.31±10.52	<0.001
Blood Glucose (mM)	6.56±6.16	5.24±0.73	<0.001
Uric acid (μM)	510.18±138.61	358.22±109.20	<0.001
Triglycerides (mM)	2.35±1.95	1.29±1.49	<0.001
Total cholesterol (mM)	5.31±1.32	4.37±0.77	<0.001
Urea nitrogen (mM)	5.77±2.53	5.62±1.49	0.398
Creatinine (μM)	89.50±27.97	98.54±11.08	<0.001

Data are represented as the mean±standard deviation.

WHR, waist-hip ratio.

Genotype and allele frequencies analysis

A total of 302 gout patients and 284 gout-free controls participated in this study. The genotypic distribution was not significantly different from the distribution expected according to Hardy-Weinberg equilibrium in gout patients (for −819T/C, p=0.304; for −1082 A/G, p=0.432) and control group (for −819T/C, p=0.412; for −1082 A/G, p=0.398). No significant differences were found in −819T/C and −1082 A/G genotypic and allelic frequencies between gout cases and controls (for −819T/C, χ²=0.212, df=1, p=0.645 by genotype; χ²=0.079, df=1, p=0.779 by allele; for −1082 A/G, χ²=2.116, df=1, p=0.146 by genotype; χ²=1.854, df=1, p=0.173 by allele) (Table 2).

Table 2.

Genotype Frequencies and Association Tests of rs1800896 and rs1800871 in IL-10 in Gout Patients and Control Subjects

		Controls	Gouts	Crude OR (95% CI)	p-Value	Adjust OR (95% CI) ^a	p-Value
−1082 A/G	AA	230	258	1		1
	AG	52	42	0.72 (0.46-1.12)	0.146	0.64 (0.37-1.12)	0.120
	GG	2	2	0.89 (0.13-6.38)	1.000	0.43 (0.06-3.21)	0.418
	A	512	558	1
	G	56	46	0.75 (0.50-1.13)	0.173
−819T/C	TT	123	127	1		1
	CT	125	140	1.09 (0.77-1.53)	0.645	1.22 (0.79-1.88)	0.374
	CC	33	35	1.03 (0.60-1.76)	0.922	1.11 (0.58-2.13)	0.751
	T	371	394	1
	C	191	210	1.04 (0.81-1.32)	0.779

The OR was adjusted for age and BMI.

CI, confidence interval; OR, odds ratio.

Discussion

Gout is the most common autoinflammatory arthritis characterized by elevated serum urate and recurrent attacks of intra-articular crystal deposition of MSU (Miao et al., 2009), which is enclosed by granulomas composed of mono- and multi-nucleated macrophages and result in the histological hallmark of gout tophi. MSU and calcium pyrophosphate dihydrate crystals are phagocytized by monocytes, and then directly activate the inflammasome via NALP3 (Martinon et al., 2006) in monocytes or macrophages to release active IL-1β (Giamarellos-Bourboulis et al., 2009). IL-1β activates the production of proinflammatory cytokines as well as other inflammatory mediators such as tumor necrosis factor a (TNF-a) and IL-8 (Di Giovine et al., 1987; Guerne et al., 1989; di Giovine et al., 1991; Pouliot et al., 1998; Landis and Haskard, 2001). These mediators cause a major influx of inflammatory cells, most notably neutrophils (di Giovine et al., 1991; Terkeltaub et al., 1991; Hachicha et al., 1995). Previous studies have demonstrated that some cytokines, in particular TNF-α, IL-1β, IL-6, and IL-8, may play the major role in the pathogenesis of joint diseases (Rai et al., 2008). Because the capacity for cytokine production in individuals largely depends on genetic polymorphisms (Landis and Haskard, 2001) and heterogeneity of the candidate gene in patients with gout emerges as a probable biomarker for determining the disease phenotypes, much previous research has focused on the association between polymorphisms of cytokine genes and gout. IL-6 −174G/C, −597G/A, the transforming growth factor β1 (TGF-β1) 869T/C, and TNF-α −863C/A were found to be associated with gout (Chang et al., 2007, 2008; Chang et al., 2007; Tsai, 2008; Reuss et al., 2002), while IL-6 −572C/G or −373A/T, TGF-β1 −509C/T, and TNF-α −308 A/G polymorphism are not related to gout (Chang et al., 2007; Chang et al., 2008; Tsai, 2008).

IL-10 is a potent anti-inflammatory cytokine, which can suppress macrophage function and inhibit the activation of Th1 cells and adhesion molecules (Turner et al., 1997; Reuss et al., 2002). Its ability to induce T-cell energy, to inhibit MHCI expression and the synthesis of proinflammatory cytokines such as IL-1a, IL-1β, IL-6, IL-8, IL-12 and TNF-α in activated macrophages (de Waal Malefyt et al., 1991; Crawley et al., 1999) and interferon-g (IFN-g) production by T cells (D'Andrea et al., 1993) may be important in its apparent contribution to anti-inflammation. Endogenously produced IL-10 is a potent immunosuppressant and an important modulator of acute and chronic inflammation (Goldman and Stordeur, 1997). IL-10 can also mediate the downregulation of the inflammatory response in rheumatoid arthritis (RA). It has been demonstrated that IL-10 suppresses joint swelling and deformation as well as necrosis of cartilage in an RA animal model (Ji et al., 2005; Ying et al., 2011). The anti-inflammatory properties of IL-10 do suggest that IL-10 may play an important role in the pathogenesis of gout.

In the present study, we performed an extensive analysis of the relationship of the polymorphisms −1082 G/A and −819 C/T in IL-10 with susceptibility to gout. We found that the genetic distributions of two polymorphisms were not likely to be independent risk factors for gout. To our knowledge, this is the first study to report the association between polymorphisms of IL-10 and gout in a Chinese Han population. We found that the distributions of the genotypes and allele frequencies showed no significant differences of the two polymorphisms in gout patients and controls. While we found that gout has a strong association with hyperuricaemia, metabolic syndrome, and other phenotypic disease characteristics in our study, such as serum TGs levels, BMI values, diastolic blood pressure, and systolic pressure levels.

Our results suggested a lack of association of these single nucleotide polymorphisms with gout. The results are contrary to our previous hypothesis. There may be several potential reasons why an association between these polymorphisms and gout was not found. First, it has been suggested that the contradictory results are due to possible differences in IL-10 regulation in different cell types (Rees et al., 2002). Second, there could be a possible relationship between IL-10 alleles and IL-10 gene expression and protein production, which was previously examined in different experimental settings (Turner et al., 1997; Mallat et al., 1999; Caligiuri et al., 2003). Missing determination of plasma levels of IL-10 was the limitation of this study. Third, conflicting results may be due to different ethnic origins in different studies. Fourth, the sample size is very small, the test may have an inadequate power to detect a particular effect (the power of genotypic test were 17.38% for −1082 G/A, 21.32% for −819 C/T, respectively). Therefore, further studies are needed to investigate the relationship between the IL-10 gene polymorphisms and gout in various and large populations.

As for the above shortcomings, there must be some other uncovered mechanisms that underly the susceptibility to gout. Since human susceptibility to gout is a complicated polygenic trait, interactive effects between the polymorphism studied and other SNPs in human genes (including those in IL-6, IL-8, IL-12, and IL-18 which also influence the process of the inflammation), need to be evaluated and further studies should also be performed to analyze the exact mechanisms.

Footnotes

Acknowledgments

We thank all probands for their participation. This work was supported by the National Basic Research Program of China (2010CB534902) and the National Natural Science Foundation of China (81070686, 30570890 and 30871192).

Author Disclosure Statement

No competing financial interests exist.

References

Bieber

, Terkeltaub

. 2004. Gout: on the brink of novel therapeutic options for an ancient disease. Arthritis Rheum, 50:2400-2414.

Caligiuri

, Rudling

, Ollivier

et al. 2003. Interleukin-10 deficiency increases atherosclerosis, thrombosis, and low-density lipoproteins in apolipoprotein E knockout mice. Mol Med, 9:10-17.

Chang

, Chen

, Tsai

et al. 2008. Associations between gout tophus and polymorphisms 869T/C and −509C/T in transforming growth factor beta1 gene. Rheumatology (Oxford), 47:617-621.

Chang

, Ko

, Wang

et al. 1997. High prevalence of gout and related risk factors in Taiwan's Aborigines. J Rheumatol, 24:1364-1369.

Chang

, Tsai

, Chen

et al. 2007. The polymorphism −863C/A in tumour necrosis factor-alpha gene contributes an independent association to gout. Rheumatology (Oxford), 46:1662-1666.

Chou

, Pei

, Chang

et al. 1994. Prevalence of rheumatic diseases in Taiwan: a population study of urban, suburban, rural differences. J Rheumatol, 21:302-306.

Crawley

, Kay

, Sillibourne

et al. 1999. Polymorphic haplotypes of the interleukin-10 5' flanking region determine variable interleukin-10 transcription and are associated with particular phenotypes of juvenile rheumatoid arthritis. Arthritis Rheum, 42:1101-1108.

D'Andrea

, Aste-Amezaga

, Valiante

et al. 1993. Interleukin 10 (IL-10) inhibits human lymphocyte interferon gamma-production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells. J Exp Med, 178:1041-1048.

de Waal Malefyt

, Abrams

, Bennett

et al. 1991. Interleukin 10(IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J Exp Med, 174:1209-1220.

10.

Di Giovine

, Malawista

, Nuki

, Duff

. 1987. Interleukin 1 (IL 1) as a mediator of crystal arthritis. Stimulation of T cell and synovial fibroblast mitogenesis by urate crystal-induced IL 1. J Immunol, 138:3213-3218.

11.

di Giovine

, Malawista

, Thornton

, Duff

. 1991. Urate crystals stimulate production of tumor necrosis factor alpha from human blood monocytes and synovial cells. Cytokine mRNA and protein kinetics, and cellular distribution. J Clin Invest, 87:1375-1381.

12.

Ding

, Shevach

. 1992. IL-10 inhibits mitogen-induced T cell proliferation by selectively inhibiting macrophage costimulatory function. J Immunol, 148:3133-3139.

13.

Eskdale

, Gallagher

, Verweij

et al. 1998. Interleukin 10 secretion in relation to human IL-10 locus haplotypes. Proc Natl Acad Sci U S A, 95:9465-9470.

14.

Eskdale

, Kube

, Tesch

, Gallagher

. 1997. Mapping of the human IL10 gene and further characterization of the 5' flanking sequence. Immunogenetics, 46:120-128.

15.

Fiorentino

, Zlotnik

, Mosmann

et al. 1991. IL-10 inhibits cytokine production by activated macrophages. J Immunol, 147:3815-3822.

16.

Giamarellos-Bourboulis

, Mouktaroudi

, Bodar

et al. 2009. Crystals of monosodium urate monohydrate enhance lipopolysaccharide-induced release of interleukin 1 beta by mononuclear cells through a caspase 1-mediated process. Ann Rheum Dis, 68:273-278.

17.

Goldman

, Stordeur

. 1997. Interleukin-10 as an anti-stress cytokine. Eur Cytokine Netw, 8:301-302.

18.

Guerne

, Terkeltaub

, Zuraw

, Lotz

. 1989. Inflammatory microcrystals stimulate interleukin-6 production and secretion by human monocytes and synoviocytes. Arthritis Rheum, 32:1443-1452.

19.

Hachicha

, Naccache

, McColl

. 1995. Inflammatory microcrystals differentially regulate the secretion of macrophage inflammatory protein 1 and interleukin 8 by human neutrophils: a possible mechanism of neutrophil recruitment to sites of inflammation in synovitis. J Exp Med, 182:2019-2025.

20.

Hsu

, Moore

, Spits

. 1992. Differential effects of IL-4 and IL-10 on IL-2-induced IFN-gamma synthesis and lymphokine-activated killer activity. Int Immunol, 4:563-569.

21.

Itoh

, Hirohata

. 1995. The role of IL-10 in human B cell activation, proliferation, and differentiation. J Immunol, 154:4341-4350.

22.

, Kim

, Rho

et al. 2005. Inhibition of IL-10-induced STAT3 activation by 15-deoxy-Delta12,14-prostaglandin J2. Rheumatology (Oxford), 44:983-988.

23.

Jin

, Kim

et al. 2007. The IL-10 (-627 A/C) promoter polymorphism may be associated with coronary aneurysms and low serum albumin in Korean children with Kawasaki disease. Pediatr Res, 61,5 Pt 1:584-587.

24.

Koss

, Satsangi

, Fanning

et al. 2000. Cytokine (TNF alpha, LT alpha and IL-10) polymorphisms in inflammatory bowel diseases and normal controls: differential effects on production and allele frequencies. Genes Immun, 1:185-190.

25.

Landis

, Haskard

. 2001. Pathogenesis of crystal-induced inflammation. Curr Rheumatol Rep, 3:36-41.

26.

, Han

, Levin

et al. 2010. Multiple single nucleotide polymorphisms in the human urate transporter 1 (hURAT1) gene are associated with hyperuricaemia in Han Chinese. J Med Genet, 47:204-210.

27.

Lin

, Lin

, Chou

. 2000a. Community based epidemiological study on hyperuricemia and gout in Kin-Hu, Kinmen. J Rheumatol, 27:1045-1050.

28.

Lin

, Lin

, Chou

. 2000b. The interaction between uric acid level and other risk factors on the development of gout among asymptomatic hyperuricemic men in a prospective study. J Rheumatol, 27:1501-1505.

29.

Lyu

, Hsu

, Yeh

et al. 2003. A case-control study of the association of diet and obesity with gout in Taiwan. Am J Clin Nutr, 78:690-701.

30.

Mallat

, Heymes

, Ohan

et al. 1999. Expression of interleukin-10 in advanced human atherosclerotic plaques: relation to inducible nitric oxide synthase expression and cell death. Arterioscler Thromb Vasc Biol, 19:611-616.

31.

Martinon

, Petrilli

, Mayor

et al. 2006. Gout-associated uric acid crystals activate the NALP3 inflammasome. Nature, 440:237-241.

32.

McCarty

. 1994. Crystals and arthritis. Dis Mon, 40:255-299.

33.

Miao

, Li

, Chen

et al. 2008. Dietary and lifestyle changes associated with high prevalence of hyperuricemia and gout in the Shandong coastal cities of Eastern China. J Rheumatol, 35:1859-1864.

34.

Miao

, Zhao

, Yan

et al. 2009. NALP3 inflammasome functional polymorphisms and gout susceptibility. Cell Cycle, 8:27-30.

35.

Moore

, de Waal Malefyt

, Coffman

, O'Garra

. 2001. Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol, 19:683-765.

36.

Mosmann

. 1994. Properties and functions of interleukin-10. Adv Immunol, 56:1-26.

37.

Pouliot

, James

, McColl

et al. 1998. Monosodium urate microcrystals induce cyclooxygenase-2 in human monocytes. Blood, 91:1769-1776.

38.

Rai

, Rachakonda

, Manning

et al. 2008. Quantification of cytokines and inflammatory mediators in a three-dimensional model of inflammatory arthritis. Cytokine, 42:8-17.

39.

Rees

, Wood

, Gillespie

et al. 2002. The interleukin-10-1082 G/A polymorphism: allele frequency in different populations and functional significance. Cell Mol Life Sci, 59:560-569.

40.

Reuss

, Fimmers

, Kruger

et al. 2002. Differential regulation of interleukin-10 production by genetic and environmental factors—a twin study. Genes Immun, 3:407-413.

41.

Stark

, Reinhard

, Neureuther

et al. 2008. Association of common polymorphisms in GLUT9 gene with gout but not with coronary artery disease in a large case-control study. PLoS One, 3:e1948.

42.

Terkeltaub

, Zachariae

, Santoro

et al. 1991. Monocyte-derived neutrophil chemotactic factor/interleukin-8 is a potential mediator of crystal-induced inflammation. Arthritis Rheum, 34:894-903.

43.

Terkeltaub

. 1993. Gout and mechanisms of crystal-induced inflammation. Curr Opin Rheumatol, 5:510-516.

44.

Tsai

, Chen

, Lai

, Chang

. 2008. Analysis of polymorphisms in the promoter region and protein levels of interleukin-6 gene among gout patients. Clin Exp Rheumatol, 26:841-847.

45.

Turner

, Williams

, Sankaran

et al. 1997. An investigation of polymorphism in the interleukin-10 gene promoter. Eur J Immunogenet, 24:1-8.

46.

Wang

, Miao

, Liu

et al. 2010. Genetic analysis of ABCG2 gene C421A polymorphism with gout disease in Chinese Han male population. Hum Genet, 127:245-246.

47.

Ying

, Shi

, Pan

et al. 2011. Association of polymorphisms in the human IL-10 and IL-18 genes with rheumatoid arthritis. Mol Biol Rep, 38:379-385.