Genetic Analysis of LRRK1 and LRRK2 Variants in Essential Tremor Patients

Abstract

Aims:

Essential tremor (ET) is one of the most common adult-onset movement disorders. ET and Parkinson's disease (PD) overlap clinically and pathologically, which prompted this investigation into the association of PD risk variants in ET patients. This study was designed to explore the role of variants of two PD-related genes LRRK1 and LRRK2 in a Han Chinese ET population.

Materials and Methods:

Genetic analysis of LRRK1, rs2924835, and LRRK2, rs34594498, rs34410987, and rs33949390 variants was conducted on 200 Han Chinese patients with ET and 434 ethnically matched normal controls.

Results:

No statistically significant differences were identified in either genotypic or allelic frequencies of variants between the ET patients and the control cohort (all p > 0.05). Haplotype analysis of three LRRK2 variants (rs34594498, rs34410987, and rs33949390) showed no haplotypes displayed an association with ET risk (all p > 0.05).

Conclusions:

The data suggest that LRRK1 variant (rs2924835) and LRRK2 variants (rs34594498, rs34410987, and rs33949390) are not associated with ET in this Han Chinese population.

Introduction

Essential tremor (ET) is one of the most common adult-onset movement disorders with an overall prevalence up to 4% in the general population (Yahr et al., 2003). Although there is strong evidence for a genetic basis of ET, the causative genes remain unidentified (Shahed and Jankovic, 2007; Chen et al., 2017). Overlaps in clinical and pathological features have been well reported between ET and Parkinson's disease (PD) (Yahr et al., 2003; Shahed and Jankovic, 2007). A long history of hand postural tremor has been found in some PD patients before the onset of parkinsonian features, and a large series of investigation reported that up to 20% of ET patients had parkinsonism on neurological examination (Shahed and Jankovic, 2007). Functional neuroimaging studies found some ET patients also have dopaminergic deficits. Postmortem findings of ET patients with no parkinsonian features also presented Lewy bodies in the brainstem (Yahr et al., 2003; Shahed and Jankovic, 2007). Deep brain stimulation effectiveness has been observed in both ET and PD treatments (Larson, 2014). A potential genetic link between ET and PD has been proposed (Shahed and Jankovic, 2007). Variants in PD-associated genes such as the synuclein alpha gene (SNCA), the leucine-rich repeat and Ig domain containing 1 gene (LINGO1), the LINGO2 gene, the HtrA serine peptidase 2 gene (HTRA2), the leucine-rich repeat kinase 2 gene (LRRK2), and the DnaJ heat shock protein family (Hsp40) member C13 gene (DNAJC13) are also reported to be related to ET (Unal Gulsuner et al., 2014; Chao et al., 2015; Rajput et al., 2015; Chen et al., 2017).

The LRRK2 gene, located on chromosome 12q12, contains 51 exons and encodes the 2527-amino acid protein. LRRK2 gene mutations are recognized as the most frequent genetic cause of both familial and sporadic PD (Ross et al., 2011; Guo et al., 2013). The LRRK1 gene, mapped to chromosome 15q26.3, is a paralog of LRRK2, in which many variants were linked to PD development (Haugarvoll et al., 2007; Ross et al., 2011). LRRK1 and LRRK2 proteins, belonging to a group within the Ras/GTPase superfamily, are expressed throughout the brain and are functionally related (Di Fonzo et al., 2005; Marin, 2006; Taylor et al., 2007). Given the high degree of homology within the genes and encoded proteins, both genes are reasonable candidate genes for ET susceptibility (Deng et al., 2006; Tan et al., 2008; Vitale et al., 2009; Clark et al., 2010).

This study proposes to explore whether the LRRK1 gene variant rs2924835 (p.Gly1938Asp), and the three LRRK2 gene variants rs34594498 (p.Ala419Val), rs34410987 (p.Pro755Leu), and rs33949390 (p.Arg1628Pro) are associated with ET in a cohort of Han Chinese patients residing in mainland China.

Materials and Methods

Subjects

Two hundred Han Chinese patients with ET (male/female: 100/100; age: 50.7 ± 15.5 years; age at onset: 41.4 ± 18.5 years) and 434 unrelated gender, age, and ethnically matched healthy controls (male/female: 217/217; age: 52.1 ± 16.5 years) with no history of neurologic disorders were enrolled in the Third Xiangya Hospital, Changsha, China. The diagnosis of ET was clinically made by two independent neurologists according to published criteria (Deuschl et al., 1998). There were no other diagnostic neurologic signs. All patients presented with bilateral, largely symmetric, postural, or kinetic tremors of the hands and forearms. Patients with other isolated tremors, such as head, voice, and task-specific writing tremors, or atypical symptoms were excluded (Deuschl et al., 1998). Healthy volunteer controls were recruited from the same geographic region, and those with suspected movement disorders or positive family history were not included. All participants signed a written informed consent. Ethical approval was given by the Institutional Review Board of the Third Xiangya Hospital, Central South University, Changsha, China. Coding mutations in two paralogous genes, LINGO1 and LINGO4, were excluded in 48% (96/200) of the ET patients, and 74.5% (149/200) had been previously screened as negative for coding variants in the FUS RNA binding protein gene (FUS) (Zheng et al., 2013).

Methods

Three previously reported LRRK2 variants associated with PD, rs34594498, rs34410987, and rs33949390, were selected (Wu et al., 2006, 2012; Li et al., 2015). A variant of the LRRK1 gene, rs2924835, was enrolled based on the previously described inclusion criteria with minor allele frequency higher than 5% in the Single Nucleotide Polymorphism database and predicted potential damaging effect by bioinformatics analysis (Yuan et al., 2016a).

Peripheral venous blood sampled from all participants was used to extract genomic DNA, through a standard phenol-chloroform protocol (Yuan et al., 2015). Mass spectrometric genotype assays of the four variants were performed at Bioyong Technologies (Beijing, China) (Yuan et al., 2016a, 2016b; Chen et al., 2017). Specific primers were designed and the primer sequences used are shown in Table 1. Sanger sequencing was employed to confirm genotyping for all variants in 5% of the randomized samples for reliability and accuracy (Zheng et al., 2013; Yuan et al., 2016a). Statistical differences in genotypic and allelic frequencies between ET patients and controls were analyzed using the Pearson's χ² test by Predictive Analytics Software Statistics 18.0 (SPSS, Inc., Chicago, IL). The Hardy-Weinberg equilibrium for genotypic frequencies was tested for both groups. Haplotype analysis of the three LRRK2 gene variants was performed by the web-based platform, SHEsis (http://analysis.bio-x.cn/myAnalysis.php) (Shi and He, 2005; Li et al., 2009). A value of p < 0.05 was deemed statistically significant.

Table 1.

Primer Sequences for the LRRK1 and LRRK2 Gene Variants

dbSNP ID	Prediction ^a	Forward primer sequence (5′→3′)	Reverse primer sequence (5′→3′)	Product size	Extending primer sequence (5′→3′)
rs2924835	D/B/Po	acgttggatgGGGTTTTGGTTGCTTAGGCG	acgttggatgAGCTCTCGGGCTTTTAAGAC	107 bp	TGGCCTGGAGAAGGATTCTG
rs34594498	D/Pos/DC	acgttggatgAGCTCATAGGGAAGTGATGC	acgttggatgAAACATGGCCCACTGCTTAC	121 bp	ttgtAAGTTTTCCAGGCATCTG
rs34410987	T/B/DC	acgttggatgGCCAGTCTCCTAAAAGGAAG	acgttggatgTCACGAGATCCACTATTCAG	126 bp	GTGAGAAAGAGAGCAGTC
rs33949390	D/P/DC	acgttggatgGTTGTCCAAAACACCCTAAG	acgttggatgCTATTGGCAAAGCAATCTGG	138 bp	AAGAAATTTTTCCACATCTCTA

The lowercase letters in the primer sequences are 5′-end tags (forward/reverse primers) or nonhomologous sequences (extending primers) to increase the molecular weights.

Three bioinformatics tools, including Sorting Intolerant from Tolerant, Polymorphism Phenotyping version 2, and MutationTaster, were used for predicting deleterious effect of variants.

D, damaging; B, benign; Po, polymorphism; Pos, possibly damaging; DC, disease causing; T, tolerated; P, probably damaging; LRRK1, the leucine-rich repeat kinase 1 gene; LRRK2, the leucine-rich repeat kinase 2 gene; dbSNP, Single Nucleotide Polymorphism database.

Results

Genotypic distribution of all variants in both patient and control groups followed the Hardy-Weinberg equilibrium (all p > 0.05). Genotypic and allelic frequencies of the LRRK1 variant (rs2924835) and LRRK2 variants (rs34594498, rs34410987, and rs33949390) are noted in Table 2. No statistical differences were observed in either genotypic or allelic frequencies of variants between the patient and the control group for the three variants (rs2924835, rs34410987, and rs33949390, all p > 0.05). No LRRK2 c.1256C>T (p.Ala419Val and rs34594498) variant was observed in either group. No haplotypes of the LRRK2 gene were found to be associated with ET risk (all p > 0.05) after haplotype examination of the three variants, presented in Table 3.

Table 2.

Genotypic and Allelic Distributions of LRRK1 and LRRK2 Gene Variants in Han Chinese Patients with Essential Tremor and Matched Controls

dbSNP ID	Genotype/allele	Patients (%)	Controls (%)	χ²	p	OR (95% CI)
rs2924835	GG	80 (40.0)	182 (41.9)
	GA	83 (41.5)	202 (46.6)
	AA	37 (18.5)	50 (11.5)	5.759	0.056	—
	G	243 (60.8)	566 (65.2)
	A	157 (39.2)	302 (34.8)	2.356	0.125	1.211 (0.948-1.546)
rs34594498	CC	200 (100)	434 (100)
	CT	0 (0)	0 (0)
	TT	0 (0)	0 (0)	—	—	—
	C	400 (100)	868 (100)
	T	0 (0)	0 (0)	—	—	—
rs34410987	CC	196 (98.0)	432 (99.5)
	CT	4 (2.0)	2 (0.5)
	TT	0 (0)	0 (0)	3.460	0.063	0.227 (0.041-1.249)
	C	396 (99.0)	866 (99.8)
	T	4 (1.0)	2 (0.2)	3.444	0.064	0.229 (0.042-1.254)
rs33949390	GG	191 (95.5)	420 (96.8)
	GC	9 (4.5)	14 (3.2)
	CC	0 (0)	0 (0)	0.636	0.425	1.414 (0.601-3.323)
	G	391 (97.8)	854 (98.4)
	C	9 (2.2)	14 (1.6)	0.624	0.430	1.404 (0.603-3.272)

CI, confidence interval; OR, odds ratio.

Table 3.

Haplotype Analysis of LRRK2 Gene Variants (rs34594498, rs34410987, and rs33949390) Comparing Between Essential Tremor Patients and Matched Controls

Haplotype	Patient (%)	Control (%)	χ²	p	OR (95% CI)
C-C-G	97.0	98.2	0.279	0.597	0.790 (0.330-1.896)
C-C-C	2.0	1.6	0.279	0.597	1.265 (0.528-3.034)
C-T-G	0.8	0.2	—	—	—
C-T-C	0.2	0.0	—	—	—

Haplotypes with frequency <0.01 were excluded in analysis.

Discussion

ET is thought to be a highly genetic-associated disorder with at least 50% of the patients having a family history and concordance rate of 77% in monozygotic twins (Louis and Ottman, 1996; Lorenz et al., 2004; Wider et al., 2010; Tio and Tan, 2016). Five disease-causing loci for familial ET were nominated by the Online Mendelian Inheritance in Man (OMIM) through either genome-wide linkage studies or exome sequencing: ETM1 (OMIM 190300) on chromosome 3q13.31, ETM2 (OMIM 602134) on chromosome 2p25-p22, ETM3 (OMIM 611456) on chromosome 6p23, ETM4 (OMIM 614782) on chromosome 16p11.2, and ETM5 (OMIM 616736) on chromosome 11q14.1 (Merner et al., 2012; Hor et al., 2015; Tio and Tan, 2016). Infrequent mutations in FUS, HTRA2, the teneurin transmembrane protein 4 gene (TENM4), the sortilin 1 gene (SORT1), the sodium voltage-gated channel alpha subunit 4 gene (SCN4A), the nitric oxide synthase 3 gene (NOS3), the potassium voltage-gated channel modifier subfamily S member 2 gene (KCNS2), the hyaluronan and proteoglycan link protein 4 gene (HAPLN4), the ubiquitin-specific peptidase 46 gene (USP46), and SCN11A have been identified by exome sequencing in a few ET families (Deng et al., 2014; Unal Gulsuner et al., 2014; Bergareche et al., 2015; Hor et al., 2015; Liu et al., 2016; Leng et al., 2017). Association studies have proposed variants in at least 11 genes, including LINGO1, LINGO2, SNCA, the dopamine receptor D3 gene (DRD3), the solute carrier family 1 member 2 gene (SLC1A2), the heme oxygenase 1 gene (HMOX1), HMOX2, the microtubule associated protein tau gene (MAPT), the serine/threonine kinase 32B gene (STK32B), the PPARG coactivator 1 alpha gene (PPARGC1A), and the catenin alpha 3 gene (CTNNA3), may exert susceptibility of ET development, although some replication studies yielded mixed results (Vilarino-Guell et al., 2011; Muller et al., 2016; Chen et al., 2017).

The ET and PD relationships have been studied over a long time, and the common convergence of the susceptibility genes provides genetic evidence of a link between these two conditions (Fekete and Jankovic, 2011; Chen et al., 2017). PD patients with LRRK2 mutations have been described to present initially with ET, and the LRRK2 p.Arg1628Pro (rs33949390) carriers had a twofold increased risk of developing ET (Chao et al., 2015). LRRK1, the only human paralog of LRRK2, encodes a highly homologous protein sharing an analogous domain structure with LRRK2, implying potential similar functionality (Haugarvoll et al., 2007).

Here, we examined the association of the LRRK1 rs2924835 variant and three LRRK2 variants (rs34594498, rs34410987, and rs33949390) with ET susceptibility. The results suggest that these four variants are unlikely to play a vital role in the development of ET in Han Chinese population. The LRRK2 haplotypes of rs34594498, rs34410987, and rs33949390 also appear to be uninvolved. This study does not exclude the possibility that other LRRK1 or LRRK2 variants confer susceptibility to ET.

The findings may be explained by the fact that LRRK2 variants may be relatively frequent in certain specific ethnicities (Di Fonzo et al., 2005; Deng et al., 2006; Haugarvoll et al., 2007; Tan et al., 2008; Vitale et al., 2009; Clark et al., 2010; Ross et al., 2011), or the notion that a primary genetic basis for ET and PD may be unrelated. Confounding factors, such as inconsistent diagnostic criteria, limited sample size, sample composition, ethnic and/or geographic differences, and environmental or epigenetic factors, could not be excluded. Systematic genome-wide analysis of a large number of potential pathogenic variants, including missense alterations and changes in the regulatory sequences by multicenter cooperation, in diverse populations, may reveal a common genetic basis for PD and ET. This would contribute to the underlying pathogenic mechanism and improve ET diagnostic and therapeutic strategies.

Footnotes

Acknowledgments

We thank all the participating patients and healthy volunteers for their cooperation. This work was supported by grants from the New Xiangya Talent Project of the Third Xiangya Hospital of Central South University, China (JY201501, Han Chen).

Author Disclosure Statement

No competing financial interests exist.

References

Bergareche

, Bednarz

, Sanchez

, et al. (2015) SCN4A pore mutation pathogenetically contributes to autosomal dominant essential tremor and may increase susceptibility to epilepsy. Hum Mol Genet, 24:7111-7120.

Chao

, Ng

, Tan

, et al. (2015) Lrrk2 R1628P variant is a risk factor for essential tremor. Sci Rep, 5:9029.

Chen

, Song

, Yuan

, et al. (2017) Genetic analysis of PITX3 variants in patients with essential tremor. Acta Neurol Scand, 135:373-376.

Clark

, Kisselev

, Park

, et al. (2010) Mutations in the Parkinson's disease genes, Leucine Rich Repeat Kinase 2 (LRRK2) and Glucocerebrosidase (GBA), are not associated with essential tremor. Parkinsonism Relat Disord, 16:132-135.

Deng

, Gao

, Jankovic

(2014) The role of FUS gene variants in neurodegenerative diseases. Nat Rev Neurol, 10:337-348.

Deng

, Le

, Davidson

, et al. (2006) The LRRK2 I2012T, G2019S and I2020T mutations are not common in patients with essential tremor. Neurosci Lett, 407:97-100.

Deuschl

, Bain

, Brin

(1998) Consensus statement of the Movement Disorder Society on Tremor. Ad Hoc Scientific Committee. Mov Disord, 131(Suppl 3):2-23.

Di Fonzo

, Rohe

, Ferreira

, et al. (2005) A frequent LRRK2 gene mutation associated with autosomal dominant Parkinson's disease. Lancet, 365:412-415.

Fekete

, Jankovic

(2011) Revisiting the relationship between essential tremor and Parkinson's disease. Mov Disord, 26:391-398.

10.

Guo

, Hu

, Chen

, et al. (2013) The LRRK2 gene is mutated in a Chinese autosomal-dominant Parkinson's disease family. Genet Test Mol Biomarkers, 17:131-134.

11.

Haugarvoll

, Toft

, Ross

, et al. (2007) Variants in the LRRK1 gene and susceptibility to Parkinson's disease in Norway. Neurosci Lett, 416:299-301.

12.

Hor

, Francescatto

, Bartesaghi

, et al. (2015) Missense mutations in TENM4, a regulator of axon guidance and central myelination, cause essential tremor. Hum Mol Genet, 24:5677-5686.

13.

Larson

(2014) Deep brain stimulation for movement disorders. Neurotherapeutics, 11:465-474.

14.

Leng

, Qi

, Zhou

, et al. (2017) Gain-of-function mutation p.Arg225Cys in SCN11A causes familial episodic pain and contributes to essential tremor. J Hum Genet, 62:641-646.

15.

, Tang

, Liu

, et al. (2015) LRRK2 A419V variant is a risk factor for Parkinson's disease in Asian population. Neurobiol Aging, 36:2908.e11-15.

16.

, Zhang

, He

, et al. (2009) A partition-ligation-combination-subdivision EM algorithm for haplotype inference with multiallelic markers: update of the SHEsis (http://analysis.bio-x.cn). Cell Res, 19:519-523.

17.

Liu

, Hernandez

, Kisselev

, et al. (2016) Identification of candidate genes for familial early-onset essential tremor. Eur J Hum Genet, 24:1009-1015.

18.

Lorenz

, Frederiksen

, Moises

, et al. (2004) High concordance for essential tremor in monozygotic twins of old age. Neurology, 62:208-211.

19.

Louis

, Ottman

(1996) How familial is familial tremor? The genetic epidemiology of essential tremor. Neurology, 46:1200-1205.

20.

Marin

(2006) The Parkinson disease gene LRRK2: evolutionary and structural insights. Mol Biol Evol, 23:2423-2433.

21.

Merner

, Girard

, Catoire

, et al. (2012) Exome sequencing identifies FUS mutations as a cause of essential tremor. Am J Hum Genet, 91:313-319.

22.

Muller

, Girard

, Hopfner

, et al. (2016) Genome-wide association study in essential tremor identifies three new loci. Brain, 139:3163-3169.

23.

Rajput

, Ross

, Bernales

, et al. (2015) VPS35 and DNAJC13 disease-causing variants in essential tremor. Eur J Hum Genet, 23:887-888.

24.

Ross

, Soto-Ortolaza

, Heckman

, et al. (2011) Association of LRRK2 exonic variants with susceptibility to Parkinson's disease: a case-control study. Lancet Neurol, 10:898-908.

25.

Shahed

, Jankovic

(2007) Exploring the relationship between essential tremor and Parkinson's disease. Parkinsonism Relat Disord, 13:67-76.

26.

Shi

, He

(2005) SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res, 15:97-98.

27.

Tan

, Lee

, Lim

, et al. (2008) Essential tremor and the common LRRK2 G2385R variant. Parkinsonism Relat Disord, 14:569-571.

28.

Taylor

, Hulihan

, Kachergus

, et al. (2007) Leucine-rich repeat kinase 1: a paralog of LRRK2 and a candidate gene for Parkinson's disease. Neurogenetics, 8:95-102.

29.

Tio

, Tan

(2016) Genetics of essential tremor. Parkinsonism Relat Disord, 22(Suppl 1):S176-S178.

30.

Unal Gulsuner

, Gulsuner

, Mercan

, et al. (2014) Mitochondrial serine protease HTRA2 p.G399S in a kindred with essential tremor and Parkinson disease. Proc Natl Acad Sci U S A, 111:18285-18290.

31.

Vilarino-Guell

, Soto-Ortolaza

, Rajput

, et al. (2011) MAPT H1 haplotype is a risk factor for essential tremor and multiple system atrophy. Neurology, 76:670-672.

32.

Vitale

, Ciotti

, Gulli

, et al. (2009) Common mutations in the LRRK2 exon 41 are not responsible for essential tremor in Italian patients. Parkinsonism Relat Disord, 15:162-163.

33.

Wider

, Ross

, Wszolek

(2010) Genetics of Parkinson disease and essential tremor. Curr Opin Neurol, 23:388-393.

34.

, Zeng

, Ding

, et al. (2006) A novel P755L mutation in LRRK2 gene associated with Parkinson's disease. Neuroreport, 17:1859-1862.

35.

, Tang

, Li

, et al. (2012) Quantitative assessment of the effect of LRRK2 exonic variants on the risk of Parkinson's disease: a meta-analysis. Parkinsonism Relat Disord, 18:722-730.

36.

Yahr

, Orosz

, Purohit

(2003) Co-occurrence of essential tremor and Parkinson's disease: clinical study of a large kindred with autopsy findings. Parkinsonism Relat Disord, 9:225-231.

37.

Yuan

, Deng

, Song

, et al. (2015) Genetic analysis of the RAB39B gene in Chinese Han patients with Parkinson's disease. Neurobiol Aging, 36:2907.e11-12.

38.

Yuan

, Song

, Deng

, et al. (2016a) Systematic analysis of genetic variants in Han Chinese patients with sporadic Parkinson's disease. Sci Rep, 6:33850.

39.

Yuan

, Song

, Deng

, et al. (2016b) Genetic analysis of FGF20 variants in Chinese Han patients with essential tremor. Neurosci Lett, 620:159-162.

40.

Zheng

, Deng

, Liang

, et al. (2013) Genetic analysis of the fused in sarcoma gene in Chinese Han patients with essential tremor. Neurobiol Aging, 34:2078.e3-4.