Application of Single-Tube Tri-Primer ARMS-PCR to Detect the NFKB1 ATTG Insertion/Deletion Polymorphism

Abstract

Aims:

The −94 ATTG insertion/deletion polymorphism (rs28362491) is an important functional polymorphism in the NFKB1 gene. It has been shown that rs28362491 is associated with many diseases. The purpose of this study was to establish a simple and reliable method to detect the ATTG insertion/deletion polymorphism.

Methods:

On the basis of the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) method, a single-tube tri-primer ARMS-PCR method was developed to detect the ATTG insertion/deletion polymorphism in 93 samples. The results of the single-tube tri-primer ARMS-PCR method were validated by DNA sequencing.

Results:

After optimization of the PCR conditions, the single-tube tri-primer ARMS-PCR was established to detect the insertion/deletion polymorphism using agarose gel electrophoresis. In 93 volunteers, the genotype frequencies were 30.1% for Ins/Ins, 19.4% for Del/Del, and 50.5% for Ins/Del, respectively. The results of the single-tube tri-primer ARMS-PCR method were consistent with the results of DNA sequencing.

Conclusions:

This single-tube tri-primer ARMS-PCR is a reliable, simple, and cost-efficient genotyping method for the detection of the ATTG insertion/deletion polymorphism in the NFKB1 gene.

Introduction

As an important transcription factor, nuclear factor of kappa light polypeptide gene enhancer in B-cells (NF-κB) regulates many physiological and pathological processes, including apoptosis, proliferation, cell adhesion, inflammation, the innate and adaptive immunity, the cellular stress response, and tissue remodeling (Perkins, 2007). In mammals, the NF-κB family has five members, including NFKB1 (p105/p50). The human NFKB1 gene is located at chromosome 4q24, and encodes the p105 and p50 proteins. The −94 ATTG insertion/deletion (Ins/Del) polymorphism, namely, single nucleotide polymorphism (SNP) rs28362491, was the first identified functional polymorphism in the NFKB1 gene, and when compared with the wild-type (−94insATTG) luciferase construct, the −94delATTG-containing luciferase construct exhibited significantly less luciferase activity (Karban et al., 2004).

Numerous investigations have investigated the associations between rs28362491 and the susceptibility of diseases, such as ulcerative colitis (Karban et al., 2004), sporadic colorectal cancer (Mohd Suzairi et al., 2013), non-small cell lung cancer (Wang et al., 2015), breast cancer (Eskandari-Nasab et al., 2016), coronary artery disease (Yang et al., 2014), liver cancer (Gao et al., 2014), chronic obstructive pulmonary disease (Korytina et al., 2016), ovarian cancer (Chen et al., 2015), and systemic lupus erythematosus (Gao et al., 2012).

The most frequently employed detection methods for NFKB1 rs28362491 are polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) (Karban et al., 2004; Mohd Suzairi et al., 2013; Wang et al., 2015) and the TaqMan assay (Gao et al., 2014; Yang et al., 2014; Korytina et al., 2016). Other available methods include DNA sequencing (Karban et al., 2004), SNapshot (Karban et al., 2004), SNP chip (Chen et al., 2015), polymerase chain reaction-polyacrylamide gel electrophoresis (PCR-PAGE) (Gao et al., 2012), and allele-specific polymerase chain reaction (AS-PCR) (Eskandari-Nasab et al., 2016).

The tri-primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) (Ramadan et al., 2016) and tetra-primer amplification refractory mutation system-polymerase chain reaction (T-ARMS-PCR) (Ye et al., 2001; Etlik et al., 2011; Ahlawat et al., 2014; Honardoost et al., 2014) are simple, fast, reliable, and cost-efficient approaches for the detection of mutations and SNPs.

Delvaux et al. performed a comparison of the following four methods: T-ARMS-PCR, PCR-RFLP, TaqMan probe, and DNA direct sequencing. The results revealed that the T-ARMS-PCR was the most cost-efficient, simple, and rapid method for SNP genotyping and was suitable for use in developing countries (Delvaux et al., 2015). In this study, we introduced a single-tube tri-primer ARMS-PCR, not a T-ARMS-PCR method, for the detection of the −94 ATTG insertion/deletion polymorphism in the NFKB1 gene.

Materials and Methods

Participants

Oral swab samples were provided by students of Nanchang University, including 24 males aged 19 to 26 years and 69 females aged 18 to 26 years. Written informed consent was obtained from all participants. The study was approved by the Medical Ethics Committee of the Second Affiliated Hospital of Nanchang University.

DNA extraction

A salting-out method was utilized to extract genomic DNA from the oral swab samples (Zhu et al., 2013). The concentration of the DNA was measured using a Nanodrop2000 spectrophotometer (Thermo Fisher Scientific), and the samples were subsequently diluted to 10 ng/μL. The diluted DNA samples were stored at −20°C until use.

Primer design

Online computer software (http://primer1.soton.ac.uk/primer1.html) was applied to design the primers. Table 1 listed the sequences of the primers used in the tri-primer ARMS-PCR. Primer Del-R2 was devised on the basis of primer Del-R1 by conserving the sequence and adding a 30 nt nucleotide fragment to the 5′ terminus of the primer Del-R1, which allowed the two primers to bind to the same site and aimed to solve the problem of amplicon size. Figure 1 was a graphic illustration of the PCR assay used.

FIG. 1.

Graphic illustration of the PCR assay. Arrows show the positions where the primers sit on the NFKB1 gene. Rectangle in red represents the 30 nt nucleotide fragment attached. Color images available online at www-liebertpub-com.web.bisu.edu.cn/gtmb

Table 1.

Primers for Tri-Primer Amplification Refractory Mutation System-Polymerase Chain Reaction

Primer	Sequence ^a (5′ to 3′)	The nucleotide position of the primers in the NFKB1 gene
F	TCTGGCATGCTTGGATCCATGCCGACCC	−225 to −198 (Ins allele)
		−221 to −194 (Del allele)
Ins-R	CGCCTGCCGGGCCCAATCAATG C TC	−102 to −78 (Ins allele)
Del-R1	AAGCGCCTGCCGGGCCCAATG T TC	−98 to −75 (Del allele)
Del-R2	AAATAAATAATAAAATAATAAATAAATAATAAGCGCCTGCCGGGCCCAATG T TC	−98 to −75 (Del allele)

Specificity-enhancing mismatches are shown in bold italics.

F: Forward primer; Ins-R: Insertion allele reverse primer; Del-R1: Deletion allele reverse primer 1; Del-R2: Deletion allele reverse primer 2. A nucleotide fragment of 30 nt (bold) was added to the 5′ terminus of the primer Del-R1.

PCR amplification

Ten samples were used to test the amplification efficiency of each pair of primers: (1) primer F and primer Ins-R; (2) primer F and primer Del-R1; and (3) primer F and primer Del-R2. The PCR (10 μL) contained 5 μL of 2 × Taq master mix (Jinan, Shanghai, China), 0.4 μM of each primer (Invitrogen, Shanghai, China), and 5 ng of genomic DNA. PCR was performed on a MG96G thermal cycler (LongGene, Hangzhou, China). The PCR thermal cycling conditions were an initial denaturation at 94°C for 3 min, followed by 35 cycles at 94°C for 20 s, 58°C for 20 s, and 72°C for 20 s, and a final extension at 72°C for 5 min. The PCR products were identified by electrophoresis on a 2% agarose gel that contained 0.5 μg ethidium bromide mL⁻¹ at 120 V for 30 min. The agarose gel was photographed using a JS-680B gel imaging system (Peiqing, Shanghai, China).

Single-tube tri-primer ARMS-PCR

The PCR (10 μL) contained 5 μL of 2 × Taq master mix, 0.8 μM primer F, 1.5 μM primer Ins-R, and 0.6 μM primer Del-R2, as well as 5 ng of genomic DNA. The cycling conditions included an initial denaturation at 94°C for 3 min, followed by 35 cycles of 20 s at 94°C, 20 s at 62°C, and 20 s at 72°C, and a final extension step at 72°C for 5 min. The PCR products were run on 3% agarose gels at 120 V for 35 min.

Method validation

Ten samples showing three different band patterns on agarose gel electrophoresis were randomly selected for sequencing. Primer F (Table 1) and the reverse primer (5′-GCCCCTGCGGGGCTCTGGCTTCCT-3′) were used to amplify a target fragment containing rs28362491. The PCR (20 μL) contained 10 μL of 2 × Taq master mix, 0.8 μM of each primer, and 10 ng of genomic DNA. The thermal cycling program was the same as PCR amplification, except that the annealing temperature was 56°C. The PCR products were sent to a company (Sangon, Shanghai, China) for sequencing.

Results

PCR amplification

Both the Ins allele and the Del allele were amplified (Fig. 2). Primer F and primer Del-R1 produced lower luminance bands than the bands produced by primer F and primer Del-R2 (Fig. 2B, C).

FIG. 2.

Electrophoretograms of 10 samples with different pairs of primers. (A) The PCR products (148 bp) were amplified by primer F and primer Ins-R. Lanes 2, 3, 4, 6, 7, 9, and 10 reveal the Ins allele. Lane 11 is a negative control and lane M is a DNA marker. (B) The PCR products (147 bp) were amplified by primer F and primer Del-R1. Lanes 1, 2, 5, 7, 8, and 9 reveal the Del allele. Lane 11 is a negative control and lane M is a DNA marker. (C) The PCR products (177 bp) were amplified by primer F and primer Del-R2. Lanes 1, 2, 5, 7, 8, and 9 reveal the Del allele. Lane 11 is a negative control and lane M is a DNA marker.

Single-tube tri-primer ARMS-PCR

A representative single-tube tri-primer ARMS-PCR electrophoretogram is shown in Figure 3. Among the 93 samples, 28 samples (30.1%) were the Ins/Ins genotype, 18 samples (19.4%) were the Del/Del genotype, and 47 samples (50.5%) were the Ins/Del genotype. The allele frequencies were 55.4% and 44.6% for the Ins allele and Del allele, respectively. The genotype distribution was in Hardy-Weinberg equilibrium (χ² = 0.047; df = 1; p = 0.83).

FIG. 3.

Agarose gel electrophoretogram of single-tube tri-primer ARMS-PCR. Lanes 1 and 2 show the Ins/Ins genotype; lanes 3 and 4 show the Del/Del genotype; and lanes 5 and 6 represent the Ins/Del genotype. Lane 7 is a negative control. Lane M is a DNA marker. ARMS-PCR, amplification refractory mutation system-polymerase chain reaction.

DNA sequencing

The results of the DNA sequencing (Fig. 4) were completely consistent with the results of the single-tube tri-primer ARMS-PCR.

FIG. 4.

DNA sequence analysis of rs28362491. (A) Ins/Ins genotype; (B) Del/Del genotype; (C) Ins/Del genotype. There are two adjacent ATTG in (A), one ATTG in (B), which is followed by GGCC, and in (C), the second ATTG overlaps with GGCC, showing two peaks. Color images available online at www-liebertpub-com.web.bisu.edu.cn/gtmb

Discussion

Regarding detection methods for rs28362491, such as PCR-RFLP, TaqMan assay, and PCR-PAGE, all methods possess unique features. PCR-RFLP provides accurate results, but the operation procedure is tedious and restriction enzyme is expensive. TaqMan assay is a specific and rapid method for SNP genotyping, but expensive probes and equipment are needed. A considerable advantage of PCR-PAGE is that it can detect numerous samples with a low cost. However, this method is complicated due to a series of steps after electrophoresis, including dyeing, rinsing, and developing. The use of ARMS-PCR is extremely straightforward since special equipment and restriction enzyme are not required.

At first, we intended to adopt T-ARMS-PCR to detect NFKB1 rs28362491. However, only the Ins allele (primer F and primer Ins-R) produced a specific PCR product. To amplify the Del allele, we designed new primers aiming at the Del allele, but they also could not produce specific PCR products (data not shown). This was consistent with the results of other studies (Medrano and de Oliveira, 2014; Mesrian Tanha et al., 2015) that some SNPs could not be genotyped by T-ARMS-PCR. Considering that a tri-primer ARMS-PCR could be used to detect SNPs, we designed primer Del-R1. Primer F and primer Del-R1 had a recognizable band when the samples had the Del allele, but the length of the Del allele amplicon (147 bp) was too similar to that of the Ins allele (148 bp). Therefore, two PCRs were required to obtain the genotype of a sample. To simplify the operational steps and lower costs, a nucleotide fragment of 30 nt that contains repetitive bases A and T was added to the 5′ terminus of primer Del-R1 to obtain primer Del-R2, altering the length of the Del allele amplicon to 177 bp. Only a single PCR tube was required because the amplicons of the Ins allele (148 bp) and the Del allele (177 bp) can be easily distinguished using agarose gel electrophoresis. As shown in Figure 3, the 148 bp and 177 bp specific fragments of the Ins/Del genotype had similar luminance, which suggested that the PCR was appropriately optimized.

Compared with the conventional two-tube tri-primer AS-PCR and two-tube tri-primer ARMS-PCR (Eskandari-Nasab et al., 2016; Ramadan et al., 2016), the single-tube tri-primer ARMS-PCR has the advantage of fewer operational steps and higher detection efficiency. Compared with primer Del-R1, primer Del-R2 and primer F produced a brighter band (Fig. 2B, C), which indicated that primer Del-R2 had a higher affinity for the DNA template than primer Del-R1. Moreover, we discovered that this 30 nt fragment of primer Del-R2 could also be added to the 5′ terminus of other primers to obtain brighter PCR products (data not shown). The results of the DNA sequencing and tri-primer ARMS-PCR were identical, which confirmed the reliability of the tri-primer ARMS-PCR method.

To summarize, the single-tube tri-primer ARMS-PCR is a reliable, simple, and cost-efficient method for the detection of the −94 ATTG insertion/deletion polymorphism in the NFKB1 gene. It facilitates the studies on the −94 ATTG insertion/deletion polymorphism in the NFKB1 gene and provides an alternative approach when an SNP cannot be genotyped by T-ARMS-PCR.

Footnotes

Acknowledgments

We thank the students who provided DNA samples for this study. This work was supported by the Natural Science Foundation of Jiangxi Province (Grant No. 20161BAB205260), the Science and Technology Plan of Health and Family planning commission of Jiangxi province (Grant No. 20155642), and the Training Program of Scientific Research of Nanchang University (Grant No. 1646).

Author Disclosure Statement

No competing financial interests exist.

References

Ahlawat

, Sharma

, Maitra

, et al. (2014) Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes. Meta Gene, 2:439-449.

Chen

, Cai

, Liang

(2015) Association of the genetic polymorphisms of NFKB1 with susceptibility to ovarian cancer. Genet Mol Res, 14:8273-8282.

Delvaux

, da Costa

, et al. (2015) Comparison of four methods of genotyping IL28B polymorphisms in chronic hepatitis C patients. J Virol Methods, 220:1-4.

Eskandari-Nasab

, Hashemi

, Ebrahimi

, et al. (2016) The functional 4-bp insertion/deletion ATTG polymorphism in the promoter region of NF-KB1 reduces the risk of BC. Cancer Biomark, 16:109-115.

Etlik

, Koksal

, Arican-Baris

, et al. (2011) Development and validation of a cost-effective in-house method, tetra-primer ARMS PCR assay, in genotyping of seven clinically important point mutations. Mol Cell Probes, 25:177-181.

Gao

, Xu

, Gao

, et al. (2014) Genetic polymorphism of NFKB1 and NFKBIA genes and liver cancer risk: a nested case-control study in Shanghai, China. BMJ Open, 4:e004427.

Gao

, Wang

, Sima

, et al. (2012) NFKB1 −94 insertion/deletion ATTG polymorphism contributes to risk of systemic lupus erythematosus. DNA Cell Biol, 31:611-615.

Honardoost

, Tabatabaeian

, Akbari

, et al. (2014) Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR, based on sequencing technique outcomes in IVS-II-I genotyping of beta thalassemia patients. Gene, 549:1-6.

Karban

, Okazaki

, Panhuysen

, et al. (2004) Functional annotation of a novel NFKB1 promoter polymorphism that increases risk for ulcerative colitis. Hum Mol Genet, 13:35-45.

10.

Korytina

, Akhmadishina

, Kochetova

, et al. (2016) Inflammatory and immune response genes polymorphisms are associated with susceptibility to chronic obstructive pulmonary disease in Tatars population from Russia. Biochem Genet, 54:388-412.

11.

Medrano

, de Oliveira

(2014) Guidelines for the tetra-primer ARMS-PCR technique development. Mol Biotechnol, 56:599-608.

12.

Mesrian Tanha

, Mojtabavi Naeini

, Rahgozar

, et al. (2015) Modified tetra-primer ARMS PCR as a single-nucleotide polymorphism genotyping tool. Genet Test Mol Biomarkers, 19:156-161.

13.

Mohd Suzairi

, Tan

, Ahmad Aizat

, et al. (2013) The functional −94 insertion/deletion ATTG polymorphism in the promoter region of NFKB1 gene increases the risk of sporadic colorectal cancer. Cancer Epidemiol, 37:634-638.

14.

Perkins

(2007) Integrating cell-signalling pathways with NF-kappaB and IKK function. Nat Rev Mol Cell Biol, 8:49-62.

15.

Ramadan

, Shawar

, Alghamdi

(2016) Development and validation of a simple diagnostic method to detect gain and loss of function defects in fibroblast growth factor-23. Horm Res Paediatr, 86:45-52.

16.

Wang

, Chen

, Pan

, et al. (2015) The association between NFKB1-94ins/del ATTG polymorphism and non-small cell lung cancer risk in a Chinese Han population. Int J Clin Exp Med, 8:8153-8157.

17.

Yang

, Zhang

, Ma

, et al. (2014) -94 ATTG insertion/deletion polymorphism of the NFKB1 gene is associated with coronary arterydisease in Han and Uygur women in China. Genet Test Mol Biomarkers, 18:430-438.

18.

, Dhillon

, Ke

, et al. (2001) An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res, 29:E88-8.

19.

Zhu

, Deng

, Jie

, et al. (2013) Detection of single nucleotide polymorphisms by PCR conformation-difference gel electrophoresis. Biotechnol Lett, 35:515-522.