Evaluation of the Genetic Association and mRNA Expression of the COL1A1,BMP2,and BMP4 Genes in the Development of Otosclerosis

Abstract

Background:

Otosclerosis (OTSC) is a genetically heterogeneous disorder, characterized by abnormal bone growth in the middle ear, affecting the stapes bone. Previous studies have shown that single nucleotide polymorphisms (SNPs) of the COL1A1, BMP2, and BMP4 genes are linked to susceptibility of OTSC, musculoskeletal degenerative diseases, and bone remodeling.

Aims

: To evaluate the genetic association and expression levels of COL1A1, BMP2, and BMP4 genes with OTSC in the Indian population.

Methods

: A total of 320 otosclerotic and 320 control samples were screened for four SNPs (rs1107946, rs11327935, rs2269336, and rs1800012) of the COL1A1 gene; rs3178250 of the BMP2 gene; and rs17563 of the BMP4 gene using single-strand conformation polymorphism analysis, and restriction fragment length polymorphism analyses. Genotypic, haplotypic, and linkage disequilibrium analyses were performed to assess the potential associations of these SNPs with OTSC. COL1A1, BMP2, and BMP4 mRNA expression levels were analyzed by semiquantitative RT-PCR and real-time PCR.

Results

: Genotypes of two SNPs, rs1800012 and rs17563, were found to be associated with OTSC (the rs1800012 GT genotype, p = 0.0022, OR = 0.481; and the rs17563 TC genotype, p = 0.0225, OR = 1.471). Haplotypic analyses revealed that the COL1A1 haplotype G-T-C-T (p = 0.021) was significantly increased among controls. Functional studies revealed an unexpected decrease in mRNA expression of COL1A1 but an increased expression of the BMP2 and BMP4 genes in otosclerotic stapes tissues.

Conclusions

: Our findings suggest that OTSC is a heterogeneous disorder, but that the GT genotype of the rs1800012 locus is protective and that the TC genotype at the rs17563 locus is a risk factor. In addition, our studies indicate that changes in the expression of the COL1A1, BMP2, and BMP4 genes may contribute to the genetic susceptibility of OTSC by regulating their mRNA levels.

Introduction

Otosclerosis (OTSC) is a complex hearing disorder that is characterized by abnormal bone remodeling in the otic capsule, which causes progressive hearing loss in young adults. This disease condition develops when there are irregular bone growths around the stapes footplate; becoming worse when it fixes to the oval window. Fixation of the stapes leads to an abnormal conduction of acoustic waves hindering their transmission to the inner ear causing conductive and/or sensorineural hearing loss. The prevalence of clinical OTSC ranges from 0.2% to 1.0% among Caucasian populations, whereas in Asians, Black Africans, and Native Americans, it is rarely found (Gordon, 1989). Compared with men, women are twice as likely to develop OTSC. It is usually inherited in an autosomal dominant manner with reduced penetrance (Batson and Rizzolo, 2017).

The exact pathogenesis of OTSC remains obscure; however, most researchers believe that both genetic and environmental factors are involved in its development (Babcock and Liu, 2018). Genetic factors that play a role in regulating the OTSC bone-remodeling pathways include osteoprotegerin (OPG), receptor activator of nuclear factor κ B (RANK), receptor activator of nuclear factor κ B ligand (RANKL), transforming growth factor beta 1 (TGF-β1), collagen type I alpha 1 chain (COL1A1), and bone morphogenetic proteins (BMPs). It has been shown that there are extensive differences in the occurrence of different mutations and polymorphisms in these genes among patients from different ethnic populations (Khalfallah et al., 2011; Priyadarshi et al., 2015).

The COL1A1 gene has been described as an important regulator, and it has been implicated in the pathogenesis of many bone disorders in humans, including OTSC and metabolic bone diseases such as osteoporosis and osteogenesis imperfecta type I (Stover and Verrelli, 2010). Previous studies have shown that promoter and intronic variants of this gene are significantly associated with OTSC in multiple ethnic populations (Schrauwen et al., 2012). However, these findings could not be replicated in the Spanish, Hungarian, and British populations, possibly due to relatively small cohort sizes and/or different ethnic origins (Rodríguez et al., 2004; Sommen et al., 2014; Mowat et al., 2018). In addition, in vitro functional studies have supported the genetic findings that there are specific disease susceptibility and protective haplotypes within the COL1A1 gene (Chen et al., 2007). There is also evidence that COL1A1 mRNA expression is reduced in cultured fibroblasts from skin biopsies of otosclerotic patients (McKenna et al., 2002). It has been reported that synthesis of collagen type 1 polypeptides is controlled by the TGF-β1 signaling pathway (Cutroneo et al., 2007). Further studies have demonstrated RUNX2-mediated stimulation of transcription factors by BMP2 increase COL1A1 transcription in vitro in cells of osteoblastic lineage (Ortuño et al., 2013).

Among the BMPs, BMP2 and BMP4, members of the TGF-β superfamily, play a crucial role in the regulation of bone formation and bone homeostasis. Dysregulated BMP signaling results in several bone disorders in humans (Wu et al., 2016), including ossification disorders, joint diseases, and skeletal developmental defects (Hao et al., 2008). Studies have also shown the involvement of BMP2 and BMP4 in otic capsule formation during development of the chicken inner ear (Chang et al., 2002). Previously, two important polymorphisms of BMP2 and BMP4 have been shown to be significantly associated with OTSC in Belgian, Dutch, and French populations (Schrauwen et al., 2008). However, in Tunisian (Khalfallah et al., 2011), German (Ealy et al., 2014), and Hungarian populations (Sommen et al., 2014) these single nucleotide polymorphisms (SNPs) were not found to be associated with OTSC, which might be due to the limited power of these studies. Histological analyses have also shown higher expressions of BMP2 and BMP4 in otosclerotic foci indicating the possibility of increased bone turnover in the stapes footplate (Csomor et al., 2012b).

Most of the association studies performed to date have been restricted to Caucasian and European populations and there is no information regarding the role these polymorphisms play with regard to OTSC susceptibility among the Indian population. Therefore, to determine the association between the COL1A1, BMP2, and BMP4 genes and their potential role in OTSC, we performed comparative genotypic and gene expression analyses between Indian OTSC cases and ethnically matched controls.

Materials and Methods

Study subjects

A case-control study was carried out with 320 OTSC patients and 320 normal control subjects. These patients visited the ear, nose, and throat, units of Capital Hospital, Bhubaneswar, and SCB Medical College and Hospital, Cuttack, Odisha, India. A diagnosis of OTSC was based on audiological, clinical, and stapes surgery as described in our previous study (Priyadarshi et al., 2015). The controls were randomly recruited healthy individuals without any history of hearing loss and/or bone-related disorders in their family. The patients and controls were matched for gender and ethnicity. All of the participants signed an informed consent and Institutional Ethical Committees approved the study protocol.

Genotyping

Peripheral blood was collected in vacutainer tubes containing EDTA as an anticoagulant; DNA was isolated by a rapid nonenzymatic method (Lahiri and Nurnberger Jr, 1991). The genotyping methods, primers sequences, amplification conditions, and restriction enzymes used are listed in Table 1. Single-strand conformation polymorphism analyses were carried out with denatured PCR products electrophoresed through a 12% native polyacrylamide gel (PAGE). Visualization of the separated DNA strands was achieved using silver staining. The restriction digests were separated by electrophoresis through an 8% PAGE gel containing ethidium bromide. To validate the genotyping method employed in this study, we randomly selected 5% of the samples for sequencing using the BigDye Terminator v3.1 Sequencing Kit. Sequences were determined on an ABI 3500 Genetic Analyzer (Applied Biosystems). The sequencing results in all cases examined were found to be concordant with genotyping results.

Table 1.

Genotyping Methods and Primers

Gene	SNP	Primer sequence (5′-3′)	Annealing	Genotyping method	Reference
COL1A1	rs1107946	F: AGGACTAGGGGGCTGAGGT	60°C	RFLP	Khalfallah et al. (2011)
COL1A1	rs1107946	R: GAAGCAAGGAAGTGGACAGG		BsmA1	Khalfallah et al. (2011)
	rs11327935	F: TAGCCCCTGCAGTCTCCCTC	62°C	SSCP	Garcia-Giralt et al. (2002)
	rs11327935	R: AAGATTCCATTGCCTCCCCC	62°C	SSCP	Garcia-Giralt et al. (2002)
	rs2269336	F: AGGCCTTCTCTCAGCCCTAC	59°C	RFLP	Khalfallah et al. (2011)
	rs2269336	R: CCCACTGCCTCATCTCTTTC		BccI	Khalfallah et al. (2011)
	rs1800012	F: GGCCTCCCTTCCAATCAG	58°C	RFLP	Khalfallah et al. (2011)
	rs1800012	R: CGCTGAAGCCAAGTGAAATA		Pf1M1	Khalfallah et al. (2011)
BMP2	rs3178250	F: ACCCCACCCCAGTTGACA	58°C	RFLP	Hao et al. (2008)
BMP2	rs3178250	R: CCTTGATGAGGGCCACGA		Msp1	Hao et al. (2008)
BMP4	rs17563	F: CCTAACTGTGCCTAG	50°C	RFLP	Savitha et al. (2015)
BMP4	rs17563	R: CATAACCTCATAAATGTTTATACGG		Hph1	Savitha et al. (2015)

SNP, single nucleotide polymorphism; F, forward primer, R, reverse primer; SSCP, single-strand conformation polymorphism; RFLP, restriction fragment length polymorphism.

Statistical analysis

Power calculations were conducted with the genetic power calculator program (Purcell et al., 2003). The disease prevalence was set at 0.44%, and estimated the power based on the odds ratio and the disease allelic frequencies from previous studies (Chen et al., 2007; Schrauwen et al., 2008).

Case-Control analyses and Hardy-Weinberg equilibrium (HWE) tests of the SNPs were performed using SNPalyze V8.0.2 (Dynacom, Japan). The statistical analyses were carried out using GraphPad prism V8.0. The differences in allelic and genotypic frequencies between the control and case groups were analyzed by Fisher's exact test. A p-value of 0.05 was considered statistically significant. Linkage disequilibrium (LD) between SNPs was evaluated by the r² of pairwise LD using SNPalyze V8.0.2. Haplotypic frequencies were estimated by using the expectation-maximization algorithm and a maximum likelihood approach. Permutation p-values were calculated by comparing haplotype frequencies between the cases and controls on the basis of 10,000 replications.

Gene expression analysis

Stapes tissue samples were obtained from eight OTSC patients (four male and four female) who underwent stapedectomies. For the controls, normal stapes tissue samples were collected from eight individual cadavers (six male and two female) referred for very early postmortem analyses (4-8 h after death). The mean age of the patients (37.25 ± 3.104 years) and controls (37.00 ± 3.071 years) were statistically similar (p = 0.9551). All of the cases and controls were from the same ethnic background (Odisha, India). The samples were collected in RNAlater (Qiagen, Germany) and stored at −80°C for further analysis. Total RNA extraction and cDNA synthesis was carried out according to previous methods (Priyadarshi et al., 2015).

The COL1A1, BMP2, and BMP4 expression analyses were carried out by reverse transcription (RT)-PCR and real-time PCR using previously reported specific primers (Hayashi et al., 2014; Sádaba et al., 2016). The RT-PCR was carried out using 2 μL of cDNA as a template in Go green PCR master mix (Promega, Madison, WI) with the following amplification conditions: an initial denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s for 35 cycles; with a final extension at 72°C for 5 min (Proflex PCR system; Applied Biosystems). The amplified products were visualized using an ethidium bromide-stained 1.5% agarose gel. The quantifications of the expressed genes in the stapes tissue samples were performed by quantitative real-time PCR on an ABI StepOne Real-Time PCR system (Applied Biosystems). The reactions contained 2.0 μL cDNA, 0.5 μM primers, 5 μL SYBR Green (Qiagen, Germany) and RNase-free water in a total volume of 10 μL. The reactions were performed in triplicate under the following conditions: 95°C for 3 min as a polymerase activation step, 40 cycles of 95°C for 15 s for denaturation, 60°C for 30 s for primer annealing, 72°C for 30 s for extension and fluorescence detection. Relative expression was calculated using the comparative ΔC_T method (ΔΔC_T method). The results were normalized to GAPDH and a comparison between the cases and their control counterparts were performed by applying a Student's t-test.

Results

The detailed clinical characteristics of the enrolled OTSC patients are shown in Supplementary Table S1. Our power calculation showed that a sample size of 320 cases and 320 controls has 40%-99.8% power to detect the genetic association with the studied SNPs (Table 2). The six selected SNPs were successfully genotyped and were all within HWE in both the cases and controls (p > 0.05). The distribution of the genotypic and the allelic frequencies of all the studied polymorphisms are shown in Table 3. Significant differences between patients and controls were detected for rs1800012 of COL1A1 and rs17563 of BMP4. The frequency of the GT genotype and the T allele of rs1800012 were decreased significantly in the patients (p = 0.002, OR = 0.481; p = 0.004, OR = 0.523, respectively) compared with the controls, whereas frequencies of the TC genotype and the C allele for rs17563 were significantly increased in the patients (p = 0.022, OR = 1.471; p = 0.024, OR = 1.335, respectively) compared with the controls. No significant differences were observed with the other four tested SNPs.

Table 2.

Power Calculation for Each Single Nucleotide Polymorphism in the Indian Population

Gene	rs number	DAF	OR	Power (%)
COL1A1	rs1107946	0.85	NA	NA
	rs11327935	0.18	1.71	97.8
	rs2269336	0.84	1.51	71.0
	rs1800012	0.18	1.55	89.6
BMP2	rs3178250	0.76	2.03	99.8
BMP4	rs17563	0.51	1.21	40.0

Power calculations were done based on previously reported data (Chen et al. 2007; Schrauwen et al., 2008).

DAF, disease allele frequency; OR, odds ratio; NA, not applicable.

Table 3.

Genotypic and Allelic Frequencies of COL1A1, BMP2, and BMP4 Single Nucleotide Polymorphisms in the Otosclerosis Cases and Controls

Gene	rs number position	Genotype allele	Cases (N = 320)	Controls (N = 320)	OR (95% CI)	p-Value
COL1A1	rs1107946	GG	164 (51.3)	167 (52.2)	Reference
	c.-2116 G > T	GT	138 (43.1)	130 (40.6)	1.108 (0.814-1.510)	0.5749
		TT	18 (5.6)	23 (7.2)	0.769 (0.414-1.448)	0.5189
		G	466 (72.8)	464 (72.5)	0.984 (0.771-1.257)	0.9500
		T	174 (27.2)	176 (27.5)
	rs11327935	TT	262 (81.9)	264 (82.5)	Reference
	c.-1782 del T	TdT	53 (16.6)	55 (17.2)	0.956 (0.637-1.431)	0.9160
		dTdT	5 (1.5)	1 (0.3)	5.063 (0.696-59.85)	0.2165
		T	577 (90.2)	583 (91.1)	1.117 (0.772-1.625)	0.6318
		dT	63 (9.8)	57 (8.9)
	rs2269336	CC	168 (52.5)	170 (53.1)	Reference
	c.-1482 C > G	CG	138 (43.1)	126 (39.4)	1.167 (0.856-1.594)	0.3771
		GG	14 (4.4)	24 (7.5)	0.564 (0.288-1.119)	0.1313
		C	474 (74.1)	466 (72.8)	0.937 (0.731-1.202)	0.6578
		G	166 (25.9)	174 (27.2)
	rs1800012	GG	287 (89.7)	259 (80.9)	Reference
	c.104-441 G > T	GT	32 (10)	60 (18.8)	0.481 (0.299-0.755)	0.0022
		TT	01 (0.3)	01 (0.3)	1.000 (0.052-19.05)	1.0000
		G	606 (94.7)	578 (90.3)	0.523 (0.340-0.797)	0.0040
		T	34 (5.3)	62 (9.7)
BMP2	rs3178250	TT	163 (50.9)	173 (54.1)	Reference
	c.^*465 T > C	TC	140 (43.8)	120 (37.5)	1.296 (0.949-1.775)	0.1261
		CC	17 (5.3)	27 (8.4)	0.608 (0.328-1.159)	0.1591
		T	466 (72.8)	466 (72.8)	1.000 (0.782-1.278)	1.0000
		C	174 (27.2)	174 (27.2)
BMP4	rs17563	TT	154 (48.1)	187 (58.4)	Reference
	c.455 T > C	TC	136 (42.5)	107 (33.4)	1.471 (1.069-2.037)	0.0225
		CC	30 (9.4)	26 (8.2)	1.170 (0.672-1.986)	0.6750
		T	444 (69.4)	481 (75.2)	1.335 (1.048-1.707)	0.0245
		C	196 (30.6)	159 (24.8)

The p-values were calculated by Fisher's exact test. Bold numbers indicate significance (p < 0.05), OR, odds ratio; 95% confidence interval (CI) is given within parentheses.

We performed a sex-stratified analysis to test the gender-specific associations. Significant differences among males were detected for rs1800012 of COL1A1 and rs17563 of the BMP4 gene. The frequency of the GT genotype and T allele of rs1800012 in male cases decreased significantly (p = 0.004, OR = 0.396; p = 0.008, OR = 0.448) compared with the females. The SNP rs17563 TC genotype and C allele were significantly increased in male patients (p = 0.001, OR = 1.980; p = 0.007, OR = 1.542, respectively) when compared with female patients. No significant differences were found among the males and females for other studied SNPs (Table 4).

Table 4.

Genotype Distribution and Allelic Frequencies of Polymorphisms in the COL1A1, BMP2, and BMP4 Genes in Otosclerosis Cases and Controls with Regard to Gender

Gene	SNP		Male				Female
Gene	SNP	Genotype allele	Cases (N = 200)	Controls (N = 200)	OR (95% CI)	p-Value	Cases (N = 120)	Controls (N = 120)	OR (95% CI)	p-Value
COL1A1	rs1107946	GG	103	106	Reference		61	61	Reference
	c.-2116 G > T	GT	83	82	1.021 (0.689-1.512)	1.0000	55	48	1.269 (0.762-2.129)	0.4340
		TT	14	12	1.179 (0.553-2.643)	0.8397	4	11	0.341 (0.116-1.000)	0.1069
		G	289	294	1.065 (0.776-1.451)	0.7505	177	170	0.864 (0.579-1.284)	0.5407
		T	111	106			63	70
	rs11327935	TT	167	170	Reference		95	94	Reference
	c.-1782 del T	TdT	30	29	1.041 (0.591-1.839)	1.0000	23	26	0.857 (0.453-1.593)	0.7490
		dTdT	3	1	3.303 (0.447-39.54)	0.6231	2	0	Inf (0.463-Inf)	0.4979
		T	364	369	1.177 (0.719-1.959)	0.6100	213	214	1.043 (0.595-1.837)	1.0000
		dT	36	31			27	26
	rs2269336	CC	106	103	Reference		62	67	Reference
	c.-1482 C > G	CG	83	82	1.021 (0.689-1.512)	1.0000	55	44	1.462 (0.871-2.481)	0.1897
		GG	11	15	0.717 (0.326-1.558)	0.5437	3	9	0.316 (0.091-1.198)	0.1358
		C	295	288	0.915 (0.674-1.256)	0.6333	179	178	0.978 (0.644-1.485)	1.0000
		G	105	112			61	62
	rs1800012	GG	183	163	Reference		104	96	Reference
	c.104-441 G > T	GT	16	36	0.396 (0.210-0.732)	0.0044	16	24	0.615 (0.316-1.197)	0.2250
		TT	1	1	1.000 (0.052-19.09)	1.0000	0	0	NA	NA
		G	382	362	0.448 (0.248-0.793)	0.0080	224	216	0.642 (0.323-1.246)	0.2474
		T	18	38			16	24
BMP2	rs3178250	TT	100	106	Reference		63	67	Reference
	c.^*465 T > C	TC	89	79	1.228 (0.831-1.820)	0.3619	51	41	1.424 (0.838-2.360)	0.2321
		CC	11	15	0.717 (0.326-1.558)	0.5437	6	12	0.473 (0.174-1.275)	0.2197
		T	289	291	1.025 (0.749-1.405)	0.9369	177	175	0.958 (0.637-1.438)	0.9178
		C	111	109			63	65
BMP4	rs17563	TT	91	124	Reference		63	63	Reference
	c.455 T > C	TC	87	56	1.980 (1.299-3.000)	0.0017	49	51	0.933 (0.556-1.563)	0.8959
		CC	22	20	1.112 (0.580-2.064)	0.8706	8	6	1.357 (0.444-4.076)	0.7842
		T	269	304	1.542 (1.131-2.092)	0.0076	175	177	1.044 (0.695-1.569)	0.9178
		C	131	96			65	63

The p-values were calculated by Fisher's exact test. Bold numbers indicate significance (p < 0.05), OR, odds ratio; 95% confidence interval (CI) is given within parentheses; NA, not applicable; Inf, Infinite.

LD and haplotypic analyses were carried out among the four COL1A1 polymorphisms tested. The pairwise linkage disequilibrium (D′) is shown for each pair of SNPs (Table 5). From the observed pairwise D′ values it can be seen that three pairs of the SNPs were in complete LD, two pairs were in strong LD, and one pair was in moderate LD. Therefore, we carried out a haplotype analysis among these four SNPs for both cases and controls (Table 6). From the six haplotypes considered, the distribution frequency of the haplotype G-T-C-T in the control group was significantly higher than in the case group (p = 0.021). When the haplotypes were stratified based on gender, the frequency of the G-T-C-T haplotype significantly increased in the controls among males (p = 0.017) when compared with the cases.

Table 5.

Pairwise Linkage Disequilibrium Coefficient (D′) of Different Single Nucleotide Polymorphisms of the COL1A1, BMP2, and BMP4 Genes

rs number	rs1107946	rs11327935	rs2269336
rs1107946
rs11327935	−1
rs2269336	0.9405	−0.7634
rs1800012	−1	0.7237	−1

D′ = 1 or −1 indicates the complete linkage disequilibrium (LD), D′ > 0.75 indicates strong LD, D′ = 0.5-0.74 indicates moderate LD, D′ < 0.49 indicates weak LD and D′ = 0 indicated the absence of LD.

Table 6.

COL1A1 Common Haplotypes and Frequencies in Otosclerosis Cases and Controls

	Overall			Male			Female
Haplotype	Case	Control	p	Case	Control	p	Case	Control	p
G-T-C-G	60.94	57.44	0.201	61.55	59.29	0.515	60.29	55.34	0.272
T-T-G-G	24.81	23.15	0.486	25.06	22.32	0.362	24.13	24.08	0.989
G-dT-C-G	5.69	3.78	0.107	5.55	2.98	0.072	5.51	4.35	0.557
G-dT-C-T	3.74	4.97	0.281	3.24	4.09	0.522	4.91	6.48	0.458
T-T-C-G	2.37	2.91	0.546	2.53	1.69	0.408	2.12	4.47	0.149
G-T-C-T	1.32	3.24	0.021	0.88	3.28	0.017	1.76	2.9	0.407

dT indicates deletion of a T nucleotide. Significant haplotypes (p < 0.05) are marked as bold. p-Values are based on 1000 permutations.

A gene expression analysis was carried out to compare the mRNA expression levels of COL1A1, BMP2, and BMP4 between the otosclerotic stapes tissues and normal stapes tissues. RT-PCR analysis detected the expression of these genes in all of the tissues. Based on the intensity of fluorescence of the agarose gels, we observed expression differences between the studied genes for the cases and controls (Fig. 1A). Measuring the expression levels by qRT-PCR revealed that the BMP4 mRNA levels were significantly elevated in the stapes tissues of OTSC cases compared with the controls (p = 0.0019). Although no significant statistical differences were observed in the expression levels of the COL1A1 and BMP2 mRNAs between the overall case and control tissue samples, we did observe an increased pattern of BMP2 expression and a decreased pattern of COL1A1 expression in individual samples between the cases and control tissues (Fig. 1B-D).

FIG. 1.

Expression levels of COL1A1, BMP2, and BMP4 genes in the stapes tissues of the cases and controls by semiquantitative and real-time RT-PCR. (A) Semiquantitative RT-PCR products of COL1A1 (146 bp), BMP2 (228 bp), BMP4 (170 bp), and GAPDH (147 bp) on ethidium bromide stained agarose gels. Expression levels of these genes were quantified by qRT-PCR normalized to the expression of GAPDH. (B, C) No significant changes were observed in the expression of COL1A1 (p = 0.1551) and BMP2 (p = 0.8756) between the cases and controls. (D) BMP4 expression was found to be significantly higher in the stapes tissues of cases (p = 0.0019) compared with the controls. Values are expressed as mean ± SEM. ns p>0.05, **p<0.01. ns, not significant.

Discussion

We carried out a case-control study to investigate the association of SNPs in the COL1A1 (rs1107946, rs11327935, rs2269336, and rs1800012), BMP2 (rs3178250), and BMP4 (rs17563) genes in OTSC patients. Previous studies concerning the association between these polymorphisms and OTSC have provided very different results depending on ethnogeographic differences. In some cases the studies may have been underpowered. Thus, we performed this study to clarify the association of these SNPs with OTSC in the Indian population.

COL1A1 partly encodes the alpha 1 chain of type I collagen, the most abundant protein of the bone extracellular matrix. Studies have demonstrated that the COL1A1 rs1800012, rs11327935, rs229336, and rs1107946 polymorphisms contribute to the risk of OTSC (Chen et al., 2007; Khalfallah et al., 2011). We selected these four COL1A1 variants because they were previously reported to contribute to various musculoskeletal diseases and bone remodeling. For instance, rs1800012 in the COL1A1 gene has been linked to osteoarthritis and intervertebral disk degeneration (Zhong et al., 2017); in addition, this polymorphism is located within the Sp1 transcription factor binding site in intron 1 that has been shown to influence bone mineral density and the prevalence of fractures in postmenopausal women with osteoporosis (Dytfeld et al., 2016). Within this study, we showed that rs1800012 is significantly associated with OTSC. The control group was found to have a higher frequency of minor allele T carriers when compared with cases, showing its protective association with regard to the development of OTSC. Previous studies have shown that the T allele increases the binding affinity for the specificity protein 1 (Sp1) transcription factor resulting in increased COL1A1 gene and protein expression levels (Mann et al., 2001). In vitro and in vivo studies have demonstrated that T allele carriers had decreased ability to produce mineralized bone, due to an imbalance in the COL1A1:COL1A2 ratio that affects bone deposition and resorption, and probably reduces the risk of OTSC (García-Giralt et al., 2005). Previous studies have also shown a significant association of the rs1800012 polymorphism with OTSC in multiple geographically and ethnically defined populations, including American (McKenna et al., 2004; Chen et al., 2007), German (Chen et al., 2007), Egyptian (El Gezeery, 2012), and Turkish (Ertugay et al., 2013). These associations, however, were not replicated in Tunisian (Khalfallah et al., 2011), Spanish (Rodríguez et al., 2004), Hungarian (Sommen et al., 2014), and British populations (Mowat et al., 2018), which might have been due to lack of statistical power, or differences in interacting gene allele frequencies. We did not find any significant association with the other three polymorphisms of COL1A1 that we tested in this study. Significant associations were found with the rs11327935 SNP in American, German, and Tunisian population, whereas the rs2269336 SNP only showed an association in American and German populations (Khalfallah et al., 2011). When the combined data of these populations were analyzed by meta-analysis, rs11327935 was found to be significantly associated with OTSC (Schrauwen et al., 2012). No evidence of the association between rs2269336 and rs1107946 was previously reported in any of the studied populations (Schrauwen et al., 2012).

It has been reported that interactions of these polymorphisms through LD may be important for modulating the transcriptional and translational activities. Furthermore, it is believed that multiple loci may provide more information than any single-point analysis. From the constructed haplotypes in this study, the G-T-C-T haplotype was tightly linked with a significant decrease in the risk of OTSC. This haplotype possesses the protective allele ‘T’ of rs1800012, which is consistently over-represented in healthy controls relative to patients, suggesting a leading role of selected polymorphisms in protectiveness determination (Table 6). Previous functional studies have also shown that the COL1A1 haplotypes affect transcriptional activity, likely leading to differences in the susceptibility toward OTSC (Chen et al., 2007). Similar haplotypic associations have also been observed in osteoporosis and hip fractures (Garcia-Giralt et al., 2002; Urreizti et al., 2012; Singh et al., 2013). The calculated LDs demonstrated that the protective SNP rs1800012 was in complete LD with the remaining COL1A1 variants (Table 5). This might explain the influence of the combined effects of genetic variations toward OTSC susceptibility.

Among the BMPs, bone morphogenetic protein 2, 4, and 7 are known to be of major importance in bone formation and repair. Human recombinant rhBMP2 and rhBMP7 have been clinically approved and are administrated in orthopedics to induce bone formation in fracture healing. Two important SNPs of BMP2 and BMP4 (rs3178250 and rs17563, respectively) have been widely studied in relationship to multiple bone-related diseases, including OTSC (Schrauwen et al., 2008). Previously, these two SNPs were shown to be associated with OTSC in Belgian-Dutch and French populations (Schrauwen et al., 2008); yet there was a failure to detect any association in German (Ealy et al., 2014) and Hungarian populations (Sommen et al., 2014), most likely due to the small population sizes analyzed in these studies. A recent study conducted in the British population also showed a negative association of rs3178250 with OTSC (Mowat et al., 2018). Furthermore, meta-analysis data revealed the trend toward association across Dutch-Belgian and Tunisian populations strengthening the association of BMP4 polymorphism (rs17563) with OTSC (Khalfallah et al., 2011). This polymorphism was also shown to be significantly associated with a nonsyndromic cleft lip palate in Indian population (Savitha et al., 2015). Among the two genotyped SNPs in our study, we confirmed a statistically significant association of rs17563 with OTSC even with an underpowered sample size (40%, Table 2). This SNP is located in exon 4 (c.455T>C) of the BMP4 gene, a nonsynonymous change in the amino acid at position 152 from valine to alanine. The risk allele C is more prevalent in OTSC patients, which is consistent with an earlier study (Schrauwen et al., 2008). Studies have shown that this polymorphism affects mRNA stability and expression without altering the protein secondary structures (Mu et al., 2012). BMP4 is a growth factor secreted by the bone-forming cell, the osteoblasts, and is implicated in the morphogenesis of a variety of tissues and organs (Salazar et al., 2016). These effects could be studied in otosclerotic tissue by functional analysis with respect to associated polymorphisms. We did not observe any significant difference of the BMP2 SNP rs3178250 between the cases and controls even though the sample size had good statistical power.

Replication studies, including our previous (Priyadarshi et al., 2013) and this study, on the genetic associations and gene expression analysis of OTSC point toward the involvement of the TGF-β1 pathway. TGF-β1 enhances BMP2-induced osteoblastogenesis during the bone remodeling process (Tachi et al., 2011). Although TGF-β1 signaling also induces the expression of COL1A1 in several organs, the exact mechanism is not fully understood. We determined the tissue-specific expression of COL1A1, BMP2, and BMP4 mRNA in stapes tissues of otosclerotic patients. Although our quantitative data revealed that there were no statistically significant differences for COL1A1 and BMP2 mRNA levels between otosclerotic and normal tissues, which could be due to heterogeneity among patients; we did observe a trend toward decreased expression of COL1A1 and increased BMP2 expression in the diseased tissues. Previous studies have demonstrated that COL1A1 expression is not altered in otosclerotic tissues (Csomor et al., 2012b) and patient fibroblasts (Chen et al., 2007). The BMP4 mRNA levels were significantly higher in otosclerotic tissues when compared with normal stapes in this study. Previous immunohistochemical studies have described increased BMP2 and BMP4 protein expression levels in Hungarians with OTSC (Csomor et al., 2012a). It has been shown that alterations in these genes disturb the BMP signaling pathway, leading to disorganization of chondrocyte proliferation, differentiation, and apoptosis (Shu et al., 2011). Based on these previous studies, we hypothesized that the genes analyzed in this study might be involved in type of pathologically increased bone turnover observed in OTSC. The results of this study strengthen our previous findings (Priyadarshi et al., 2013, 2016) with regard to the contribution of the TGF-β1 pathway to otosclerotic susceptibility. This study, however, was not without limitations; we were not able to establish the allele-specific gene expression in stapes tissues, which would provide the exact involvement of the individual studied SNPs for each patient.

This study suggests that OTSC is a genetically heterogeneous disorder involving the protective role of the GT genotype at the COL1A1 rs1800012 locus, and the disease-promoting role of the BMP4 TC genotype at rs17563. Altered expression of these genes in diseased tissues provides an insight into the molecular mechanisms underlying otosclerotic development. Functional studies of these genetic variants may reveal the complex molecular mechanism through which they interact to induce otosclerotic development.

Footnotes

Acknowledgments

We thank all the subjects who participated in this study and Department of Science and Technology, Government of India, for the support.

Author Disclosure Statement

No competing financial interests exist.

Funding Information

A joint research grant was established under the India/Tunisia agreement on Science and Technology Cooperation (Grant Sanction # DST/INT/TUNISIA/P-19/2017; EPIGENOTOS).

Supplementary Material

References

Babcock

, Liu

(2018) Otosclerosis From Genetics to Molecular Biology. Otolaryngol Clin N Am, 51:305-318.

Batson

, Rizzolo

(2017) Otosclerosis: an update on diagnosis and treatment. J Am Acad Phys, 30:17-22.

Chang

, ten Dijke

, Wu

(2002) BMP pathways are involved in otic capsule formation and epithelial-mesenchymal signaling in the developing chicken inner ear. Dev Biol, 251:380-394.

Chen

, Meyer

, McKenna

, et al. (2007) Single-nucleotide polymorphisms in the COL1A1 regulatory regions are associated with otosclerosis. Clin Genet, 71:406-414.

Csomor

, Liktor

, et al. (2012a) Expression of bone morphogenetic protein 2, 4, 5, and 7 correlates with histological activity of otosclerotic foci. Acta Oto-laryngol, 132:624-631.

Csomor

, Liktor

, et al. (2012b) No evidence for disturbed COL1A1 and A2 expression in otosclerosis. Eur Arch Oto-Rhino-Laryngol, 269:2043-2051.

Cutroneo

, White

, Phan

, et al. (2007) Therapies for bleomycin induced lung fibrosis through regulation of TGF-β1 induced collagen gene expression. J Cell Physiol, 211:585-589.

Dytfeld

, Marcinkowska

, Drwęska-Matelska

, et al. (2016) Association analysis of the COL1A1 polymorphism with bone mineral density and prevalent fractures in Polish postmenopausal women with osteoporosis. Arch Med Sci, 12:288-294.

Ealy

, Meyer

, Corchado

, et al. (2014) Rare variants in BMP2 and BMP4 found in otosclerosis patients reduce Smad signaling. Otol Neurotol, 35:395-400.

10.

El Gezeery

(2012) Otosclerosis: association of COLIA1 Sp1 binding site polymorphism in Alexandria, Egypt. Asian Biomed, 6:747-752.

11.

Ertugay

, Ata

, Ertugay

, et al. (2013) Association of COL1A1 polymorphism in Turkish patients with otosclerosis. Am J Otolaryngol, 34:403-406.

12.

García-Giralt

, Enjuanes

, Bustamante

, et al. (2005) In vitro functional assay of alleles and haplotypes of two COL1A1-promoter SNPs. Bone, 36:902-908.

13.

Garcia-Giralt

, Nogues

, Enjuanes

, et al. (2002) Two new single-nucleotide polymorphisms in the COL1A1 upstream regulatory region and their relationship to bone mineral density. J Bone Miner Res, 17:384-393.

14.

Gordon

(1989) The genetics of otosclerosis: a review. Am J Otol, 10:426-438.

15.

Hao

, Yang

Z-h

, Liu

D-m

, et al. (2008) Association between two polymorphisms of the bone morpho-genetic protein-2 gene with genetic susceptibility to ossification of the posterior longitudinal ligament of the cervical spine and its severity. Chinese Med J, 121:1806-1810.

16.

Hayashi

, Nomoto

, Hishida

, et al. (2014) Identification of the collagen type 1 alpha 1 gene (COL1A1) as a candidate survival-related factor associated with hepatocellular carcinoma. BMC Cancer, 14:108.

17.

Khalfallah

, Schrauwen

, Mnejja

, et al. (2011) Association of COL1A1 and TGFB1 polymorphisms with otosclerosis in a Tunisian population. Ann Hum Genet, 75:598-604.

18.

Lahiri

, Nurnberger Jr

(1991) A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res, 19:5444.

19.

Mann

, Hobson

, Li

, et al. (2001) A COL1A1 Sp1 binding site polymorphism predisposes to osteoporotic fracture by affecting bone density and quality. J Clin Invest, 107:899-907.

20.

McKenna

, Kristiansen

, Tropitzsch

(2002) Similar COL1A1 expression in fibroblasts from some patients with clinical otosclerosis and those with type I osteogenesis imperfecta. Ann Otol Rhinol Laryngol, 111:184-189.

21.

McKenna

, Nguyen-Huynh

, Kristiansen

(2004) Association of otosclerosis with Sp1 binding site polymorphism in COL1A1 gene: evidence for a shared genetic etiology with osteoporosis. Otol Neurotol, 25:447-450.

22.

Mowat

, Crompton

, Ziff

, et al. (2018) Evidence of distinct RELN and TGFB1 genetic associations in familial and non-familial otosclerosis in a British population. Hum Genet, 137:357-363.

23.

, Xu

, Contreras

, et al. (2012) Phenotype characterization and sequence analysis of BMP2 and BMP4 variants in two Mexican families with oligodontia. Genet Mol Res, 11:4110-4120.

24.

Ortuño

, Susperregui

, Artigas

, et al. (2013) Osterix induces Col1a1 gene expression through binding to Sp1 sites in the bone enhancer and proximal promoter regions. Bone, 52:548-556.

25.

Priyadarshi

, Hansdah

, Ray

, et al. (2016) Otosclerosis associated with a de novo mutation −832G> A in the TGFB1 gene promoter causing a decreased expression level. Sci Rep, 6:1-6.

26.

Priyadarshi

, Ray

, Panda

, et al. (2013) Genetic association and gene expression profiles of TGFB1 and the contribution of TGFB1 to otosclerosis susceptibility. J Bone Miner Res, 28:2490-2497.

27.

Priyadarshi

, Ray

, Biswal

, et al. (2015) Genetic association and altered gene expression of osteoprotegerin in otosclerosis patients. Ann Hum Genet, 79:225-237.

28.

Purcell

, Cherny

, Sham

(2003) Genetic Power Calculator: design of linkage and association genetic mapping studies of complex traits. Bioinformatics, 19:149-150.

29.

Rodríguez

, Santiago

Hermida

, Juan

Frade

, et al. (2004) Proposed association between the COL1A1 and COL1A2 genes and otosclerosis is not supported by a case-control study in Spain. Am J Med Genet A, 128:19-22.

30.

Sádaba

, Martínez-Martínez

, Arrieta

, et al. (2016) Role for galectin-3 in calcific aortic valve stenosis. J Am Heart Assoc, 5:e004360.

31.

Salazar

, Gamer

, Rosen

(2016) BMP signalling in skeletal development, disease and repair. Nat Rev Endocrinol, 12:203-221.

32.

Savitha

, Sharma

, Veena

, et al. (2015) Single nucleotide polymorphism of bone morphogenetic protein 4 gene: A risk factor of non-syndromic cleft lip with or without palate. Indian J Plast Surg, 48:159-164.

33.

Schrauwen

, Khalfallah

, Ealy

, et al. (2012) COL1A1 association and otosclerosis: A meta-analysis. Am J Med Genet A, 158:1066-1070.

34.

Schrauwen

, Thys

, Vanderstraeten

, et al. (2008) Association of bone morphogenetic proteins with otosclerosis. J Bone and Miner Res, 23:507-516.

35.

Shu

, Zhang

, Xie

, et al. (2011) BMP2, but not BMP4, is crucial for chondrocyte proliferation and maturation during endochondral bone development. J Cell Sci, 124:3428-3440.

36.

Singh

, Singh

, Sing

, et al. (2013) A haplotype derived from the common variants at the −1997G/T and Sp1 binding site of the COL1A1 gene influences risk of postmenopausal osteoporosis in India. Rheumatol Int, 33:501-506.

37.

Sommen

, Van Camp

, Liktor

, et al. (2014) Genetic association analysis in a clinically and histologically confirmed otosclerosis population confirms association with the TGFB1 gene but suggests an association of the RELN gene with a clinically indistinguishable otosclerosis-like phenotype. Otol Neurotol, 35:1058-1064.

38.

Stover

, Verrelli

(2010) Comparative vertebrate evolutionary analyses of type I collagen: potential of COL1a1 gene structure and intron variation for common bone-related diseases. Mol Biol Evol, 28:533-542.

39.

Tachi

, Takami

, Sato

, et al. (2011) Enhancement of bone morphogenetic protein-2-induced ectopic bone formation by transforming growth factor-β1. Tissue Eng A, 17:597-606.

40.

Urreizti

, Garcia-Giralt

, Riancho

, et al. (2012) COL1A1 haplotypes and hip fracture. J Bone Miner Res, 27:950-953.

41.

, Chen

, Li

Y-P

(2016) TGF-β and BMP signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease. Bone Res, 4:16009.

42.

Zhong

, Huang

, Ma

, et al. (2017) Association of COL1A1 rs1800012 polymorphism with musculoskeletal degenerative diseases: a meta-analysis. Oncotarget, 8:75488-75499.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.02 MB