A Case-Control Study of the Association Between GSTP1 Gene Polymorphisms (rs1695 and rs1138272) and the Susceptibility to Male Infertility in the Moroccan Population

Abstract

Background:

Infertility affects 10-15% of couples worldwide, with male factors accounting for half of cases. Environmental, behavioral, and genetic problems contribute to spermatogenic failure in 30% of idiopathic male infertility cases. Other factors, such as oxidative stress (OS), cause impaired spermatogenesis, abnormal sperm morphology, and reduced motility, eventually triggering male infertility. In the male reproductive tract, glutathione S-transferase (GST) family antioxidants are essential for preventing OS, detoxification, and DNA damage protection.

Methods:

GSTP1 isoenzyme, one of GST members, has previously been linked to male infertility, and this case-control study is the first to assess the possible association of GSTP1 gene polymorphisms (rs1695 and rs1138272) with nonobstructive azoospermia and severe oligospermia within 300 patients and 300 controls from the Moroccan population using an allele-specific PCR. The statistical analysis was performed with the R programming language.

Results:

Genotyping of GSTP1 polymorphisms fitted the Hardy-Weinberg equilibrium in both cases and controls (p > 0.05), but no significant association was found in rs1695 (odds ratio [OR] = 1.238, 95% confidence interval [CI] = 0.855 to 1.794, p = 0.258, power = 0.204) and in rs1138272 (OR = 1.192, 95% CI = 0.852 to 0.1668, p = 0.304, power = 0.176). Likewise, results from haplotype analysis (OR = 1.25, 95% CI = 0.61 to 2.57, p = 0.537) and SNP-SNP interactions (OR = 1.522, 95% CI = 0.838 to 2.762, p = 0.166) demonstrated no correlation with the risk of male infertility.

Conclusion:

The two SNPs (rs1695 and rs1138272) of the GSTP1 gene loci are not associated with male infertility susceptibility in Moroccan subjects. Yet, future investigations with a larger sample size may conclusively help to confirm this association.

Introduction

Infertility is a global health issue caused by frequent, unprotected sexual intercourse (Vander Borght and Wyns, 2018). About 50% of reproductive failure cases are due to male infertility factors, including behavioral, environmental, immunological, hormonal, genetic, and genital issues (Dohle, 2010; Krausz, 2011; Leaver, 2016; Schlosser et al., 2007; Wiesenfeld et al., 2012). These factors can act alone or in combination and alter sperm quality, quantity, or function (Levine et al., 2017). Yet, the exact etiology in half of all cases remains unknown, and the subject’s infertility is classified as idiopathic (Ambulkar et al., 2014).

Genetic polymorphisms involved in metabolic and antioxidant systems responsible for male infertility are increasingly being studied (García Rodríguez et al., 2019), where the balance between reactive oxygen species (ROS) and antioxidants plays a crucial role in spermatogenesis control and germ cell growth (Aitken et al., 2016; Ribas-Maynou and Yeste, 2020). In human testis, excessive ROS induce oxidative stress (OS), which leads to lipid peroxidation, DNA damage, reduced sperm motility, and apoptosis (Agarwal et al., 2008a; Smith et al., 2002). Thus, OS and a high concentration of ROS exceeding spermatozoa’s antioxidant capacity are two main causes of male infertility.

Long-term xenobiotic exposure can increase OS in the male reproductive tract (Bonde and Giwercman, 2014; Hekim et al., 2020). The detoxification system enzymes, including the glutathione S-transferase (GSTs, E.C.2.5.1.18) family, target and metabolize toxic substances in two stages, regulating ROS levels, controlling drug resistance, and safeguarding spermatozoa from environmental stressors (Alahmar, 2019; Mannucci et al., 2021). Moreover, glutathione, as a cofactor for GSTs and a vital component of the human body’s defense against oxidative damage, is an essential endogenous protector (Franco et al., 2007; Llavanera et al., 2020), and its roles in human seminal fluid are still being processed.

GSTs form a superfamily of multifunctional enzymes that perform vital functions in cell integrity, DNA damage protection, cell signaling, antiapoptotic activity, and OS regulation (Chatterjee and Gupta, 2018). They catalyze glutathione conjugation to hydrophobic and electrophilic compounds, primarily produced by exogenous xenobiotics or endogenous substances (Allocati et al., 2018; Llavanera et al., 2020; Strange et al., 2001). GST enzymes are classified into three types based on their subcellular location: mitochondrial, cytoplasmic, and microsomal (Allocati et al., 2018). The cytosolic family is the most diverse group recognized as phase II detoxification enzymes and includes the GSTA, GSTM, GSTK, GSTO, GSTP, GSTT, and GSTZ proteins (Behrens et al., 2019; Chatterjee and Gupta, 2018). They are expressed differently in various tissues and cell types, with GSTA1 expression highest in the liver, kidney, and testis and GSTT1 mostly in kidney and liver (Coles et al., 2001; Söderdahl et al., 2007). Whereas the nonhepatic isoenzyme GSTP1, which has previously been related to tumor development and therapy resistance (Aguilera et al., 2001; Ghobadloo et al., 2004), is very abundant in proliferating cells and has been proposed as a prostate cancer biomarker (Crocitto et al., 2004).

Generally, several studies have linked GSTs expression with carcinogenesis and drug resistance (McIlwain et al., 2006), with many members overexpressed in neoplastic cells (Allocati et al., 2018; Oguztuzun et al., 2011). Also, GSTs are present in the male reproductive tract, ensuring successful spermatogenesis (Llavanera et al., 2020) and playing three distinct roles: (a) detoxification (Hemachand and Shaha, 2003); (b) regulation of cellular signaling pathways linked to sperm capacitation and spermatogenesis (Hemachand and Shaha, 2003; Teskey et al., 2018); and (c) fertilization, by assuring the attachment of spermatozoa to oocytes and the sperm nuclear decondensation (Hamilton et al., 2019; Hemachand et al., 2002; Petit et al., 2013). Particularly, since they can attach to sperm, GSTM3 and GSTP can help in the maturation, motility, and function of spermatozoa (Llavanera et al., 2020; Utleg et al., 2003).

In light of its increasingly pleiotropic role in human pathologies such as asthma (Dai et al., 2021; Mukhammadiyeva et al., 2022), neurodegenerative diseases (Allocati et al., 2018), inflammatory conditions (Kim et al., 2006; Wang et al., 2014), cancer (Kudhair et al., 2024), and more recently even male infertility (Huang et al., 2017), this paper focuses on the GSTP1 isoform, a highly polymorphic gene on chromosome 11 containing six introns and seven exons. This gene is methylated in liver tissue, while hypermethylation can inhibit its production (Ahmed, 2010; Jain et al., 2012; Song et al., 2002). Additionally, its expression is strongly influenced by noncoding RNAs (Cech and Steitz, 2014) and transcription factors such as specificity protein 1, AP1, NF-B, and GATA binding protein 1 (Li et al., 2016; Schnekenburger et al., 2003; Slonchak et al., 2009; Song et al., 2002).

Polymorphism of Pi-GST is most often a point mutation (SNP). Board et al. were the first to report them by isolating cDNA clones of the human GSTP1 gene (Board et al., 1989). The first variant is an A1578G substitution observed with exon 5 (rs1695), leading to the change of Ile (isoleucine) to Val (valine) at codon 105. This section is critical for the biological function of the GSTP1 protein; thus, both the enzyme’s catalytic activity and thermal stability are reduced by its substitution, leading to significantly lower conjugating activity (Huang et al., 2017). The second variant is a C2508T substitution located in exon 6 (rs1138272), which converts alanine (Ala) to valine (Val) at codon 114 (Kudhair et al., 2020). However, the biological function of the GSTP1 protein does not depend on this fragment, so replacing it does not influence the catalytic activity and thermal stability of the enzyme (Cote et al., 2009).

Lately, numerous case-control studies have examined the relationship between male infertility and GSTP1 gene polymorphisms, but controversial results from different populations were reported. Thus, the question of whether these polymorphisms are genetic factors susceptible to cause male infertility still remains. The current work aims to explore the association of the two polymorphic loci Ile105Val and Ala114Val in the GSTP1 gene with the risk of nonobstructive azoospermia (NOA) and severe oligospermia and their interference with demographic factors through a case-control study in Moroccan subjects. The relevance of this study lies in the selected patients since it is the first one to target GSTP1 polymorphisms among the Moroccan population and in the potential implications of its results in future meta-analyses, thus emphasizing the need to end the debate that arose over the association of these variants with male infertility risk over the last 10 years.

Materials and Methods

Population sample

To study the association between functionally significant GSTP1 polymorphisms and idiopathic male infertility, a case-control was carried out. Infertile men (age range 25-46 years) with NOA and severe oligospermia (n = 300) visited the Pasteur Institute of Morocco in Casablanca for recruitment. As controls, the study included the same number of normozoospermic males (age range: 25-46 years) who belonged to the same ethnic group, had the same language and geographic ancestry and had comparable socioeconomic position. According to WHO guidelines, fertile males had fathered at least one child without the use of assisted reproductive technologies and had normal semen characteristics; infertile patients, on the contrary, failed to achieve a pregnancy after at least 2 years of unprotected sexual relations with the same partner.

Inclusion and exclusion criteria

After eligibility screening and fulfilling the exclusion and inclusion criteria of the study, the participants were selected. Physical examination findings, hormonal balance, family histories, known disorders, and laboratory results were retrospectively collected for the medical records.

Additionally, a questionnaire gathering details on demographic characteristics (age, BMI, and health status), smoking, alcohol consumption, and heat exposure was completed on all subjects (Table 1). Exclusion criteria for patients were secondary infertility, Y-chromosome microdeletions, karyotype abnormalities, testicular malignancy, genital tract or semen infections, prescribed drug usage, and radiation therapy.

Table 1.

Demographic and Clinical Characteristics of Cases and Controls

Parameters	Cases (n = 300)	Controls (n = 300)	p value
Age (median [IQR])	31 [28-37]	32 [28-39]	0.043
BMI (median [IQR])	25 [20-30.25]	23 [20-26]	<0.001
Health status (Good/Poor)	243/57	263/37	0.025
Smoking (Yes/No)	166/134	122/178	<0.001
Alcohol (Yes/No)	33/267	15/285	0.007
Heat exposure (Yes/No)	156/144	123/177	0.007
Family history (Yes/No)	42/258	19/281	0.002

BMI, body mass index; IQR, interquartile range.

Ethics statement

After being given full information about the study, each participant completed an informed consent form indicating their unconditional consent to take part in it. The protocol of this study was approved by the Ethics Committee of the Faculty of Medicine and Pharmacy in Casablanca, Morocco, and carried out in accordance with the Helsinki Declaration.

DNA extraction

Following the manufacturer’s instructions, genomic DNA was extracted from peripheral blood using the QIAamp DNA Blood Mini Kit (QIAGEN, USA).

Genotyping of GSTP1 gene polymorphisms

The genotyping of the two common polymorphisms in the GSTP1 gene, c.313A > G (Ile105Val, rs1695) and c.341C > T (Ala114Val, rs1138272), was executed by PCR-RFLP using specific primers and enzymes. By using PCR, the GSTP1 gene’s polymorphic sequence was amplified in a 15 µL overall volume that contained about 7.5 µL of Green Taq DNA Polymerase, 4.5 µL of pure water, 0.5 µL (100 µM) of each forward and reverse primer, and 2.5 µL of genomic DNA. PCR products were observed with a ultra-violet (UV) visualizer to determine whether target gene fragments were amplified. Table 2 shows primer sequences, restriction enzymes, and digestion products for each polymorphism, and the RFLP products for each genotype are shown in Supplementary Figure S1.

Table 2.

The Enzymes and Primers Sequences Utilized for PCR-RFLP of the GSTP1 Gene

Gene (SNP and size)	Primers (5′ to 3′)	Restriction enzyme	Alleles (resulted fragment)
GSTP1 (rs1695) (433 bp)	Sense: R 5′AGGTTGTGTCTTGTCCCAGG 3′	BsmAI	AA = Digested fragment (328 and 105 bp). AG = Digested fragment (328, 222, and 105/106 bp). GG = Digested fragment (222 and 105/106 bp).
GSTP1 (rs1695) (433 bp)	Antisense: F 5′CTGCTGTGTGGCAGTCTCTC 3′	BsmAI
GSTP1 (rs1138272) (367 bp)	Sense: R 5′ATGGCTCACACCTGTGTCCATC 3′	AciI	CC = Digested fragment (195 and 172 bp). CT = Digested fragment (367,195 and 172 bp). TT= Intact fragment (367 bp).
GSTP1 (rs1138272) (367 bp)	Antisense: F 5′CAAGGATGGACAGGCAGAATGG 3′	AciI

GST, glutathione S-transferase.

In each PCR run, negative controls were included into the reaction mix in order to assess the level of contamination. The amplification cycles consist of an initial denaturation at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 62°C for 30 s (for both polymorphisms), extension at 72°C for 45 s, final extension at 72°C for 7 min, and finally the cycle stopped at 4°C. After PCR amplification, the RFLP was proceeded with 5 U of BsmAI (d’Alw26I-BcoDl) restriction enzyme for rs1695 at 55°C/15 min and with 10 U of AciI (SsiI) enzyme for rs1138272 at 37°C/1 h (Table 2). A digestion mixture with a final volume of 20 μL was prepared, containing, in addition to 10 μL of PCR products: 6.5 μL of pure water, 3.4 μL of CutSmart Buffer (Bovine serum albumin (BSA) included), and 0.1 μL of enzymes. UV light was used to visualize the results of the RFLP electrophoresis on a 3% agarose gel.

Statistical analysis

The deviation of rs1695 and rs1138272 polymorphisms from the Hardy-Weinberg equilibrium (HWE) was evaluated using Pearson’s chi-squared test. Through a logistic regression analysis, we assessed the correlation between GSTP1 genotypes, haplotypes, and SNP-SNP interactions and the risk of male infertility. Quantitative parameters in this study followed a normal distribution and were compared using the Mann-Whitney U test. Associations between qualitative variables were assessed using Pearson’s chi-squared test. Utilizing the R Statistical Programming Language (version 3.6.3), all of these analyses were completed with a p value <0.05 as an indicator of significance. Also, Power and Sample Size Calculation (PS) program (version 3.1.2) was used to evaluate the statistical power in our study.

Results

Genetic association analysis

The demographic and clinical data of enrolled participants are presented in Table 1. There was a statistically significant difference in age, BMI, and health status (p < 0.05). The presence of smoking, alcohol, and heat exposure was significantly higher in the patient group compared to the control group (p < 0.001, p = 0.007, and p = 0.007, respectively). Regarding the family history score, it was frequent among cases with a p = 0.02 (Table 1).

For rs1695, the frequencies of the wild-type (A) and variant (G) alleles were 84.67% and 15.33% in patients, and 87.17% and 12.83% in controls. Likewise, for both patients and controls, the wild-type (C) allele frequency (78.67% vs. 21.33%) was greater than that of the variant (T) allele (81.33% vs. 18.67%), respectively, for rs1138272. However, for both polymorphisms, association analysis revealed no statistically significant variations in allele frequencies among patients and controls (p > 0.05) (Table 3).

Table 3.

The Distribution of Genotypic and Allelic Frequency of GSTP1 Polymorphisms among Infertile Patients and Controls

SNP	Model	Genotype	Cases (n = 300) (%)	Controls (n = 300) (%)	OR [95% CI]	p value	Power
GSTP1 (rs1695)	Codominant	AA	219 (73%)	231 (77%)	Reference
		AG	70 (23.30%)	61 (20.30%)	1.21 [0.82-1.788]	0.336	0.161
		GG	11 (3.70%)	8 (2.70%)	1.45 [0.573-3.673]	0.431	0.126
	Dominant	AA	219 (73%)	231 (77%)	Reference
	Dominant	AG+GG	81 (27%)	69 (23%)	1.238 [0.855-1.794]	0.258	0.204
	Recessive	AA+AG	289 (96.30%)	292 (97.30%)	Reference
	Recessive	GG	11 (3.70%)	8 (2.70%)	1.389 [0.551-3.504]	0.484	0.108
	Alleles	A	508 (84.67%)	523 (87.17%)	Reference
	Alleles	G	92 (15.33%)	77 (12.83%)	1.230 [0.887-1.705]	0.213	0.142
	HWE		0,07	0,1
GSTP1 (rs1138272)	Codominant	CC	189 (63%)	201 (67%)	Reference
		CT	94 (31.30%)	86 (28.70%)	1.162 [0.816-1.655]	0.404	0.135
		TT	17 (5.70%)	13 (4.30%)	1.391 [0.658-2.941]	0.386	0.142
	Dominant	CC	189 (63%)	201 (67%)	Reference
	Dominant	CT+TT	111 (37%)	99 (33%)	1.192 [0.852-1.668]	0.304	0.176
	Recessive	CC+CT	283 (94.30%)	287 (95.70%)	Reference
	Recessive	TT	17 (5.70%)	13 (4.30%)	1.326 [0.632-2.781]	0.454	0.116
	Alleles	C	472 (78.67%)	488 (81.33%)	Reference
	Alleles	T	128 (21.33%)	112 (18.67%)	1.181 [0.890-1.569]	0.248	0.128
	HWE		0,24	0,33

CI, confidence interval; GST, glutathione S-transferase; OR, odds ratio.

Despite the high prevalence of allele G carriers in the patient population, there was no statistically significant difference in this result (odds ratio [OR] = 1.230, 95% confidence interval [CI] = 0.887 to 1.705, p = 0.213) with low power (0.142), suggesting that it is not associated with male infertility risk. Additionally, compared to controls, the frequency of T allele carriers in the patient population was greater. Moreover, allele analysis revealed that it is not associated with the risk of male infertility (OR = 1.181, 95% CI = 0.890 to 1.569, p = 0.248) with smaller power (0.128) (Table 3).

Compared to the control group, the distribution of AG+GG and CT+TT genotypes (27% and 37%) was greater in the patient group (23% and 33%) for both GSTP1 polymorphisms, although this variation was not statistically important (OR = 1.238, 95% CI = 0.855 to 1.794, p = 0.258, power = 0.204) for rs1695 and (OR = 1.192, 95% CI = 0.852 to 0.1668, p = 0.304, power = 0.176) for rs1138272 (Table 3).

According to the statistical analysis, there is no correlation between the homozygote genotype GG and an elevated incidence of male infertility (OR = 1.45, 95% CI = 0.573 to 3.673, p = 0.431, power = 0.126), as is AG genotype (OR = 1.21, 95% CI = 0.82 to 1.788, p = 0.336, power = 0.161). Similarly, for rs1138272, the analysis showed that the heterozygote CT (OR = 1.162, 95% CI = 0.816 to 1.655, p = 0.404, power = 0.135) and the homozygote TT (OR = 1.391, 95% CI = 0.658 to 2.941, p = 0.386, power = 0.142) genotypes are not associated with the male infertility (Table 3).

To examine the combined effect of the two variants (c.313A > G, Ile105Val, rs1695) and (c.341C > T, Ala114Val, rs1138272) in the GSTP1 gene, a haplotype analysis was conducted (Table 4). There were four haplotypes identified in our population, with different frequencies among the two studied groups. No significant association was remarked between the H2, H3, and H4 haplotypes and the susceptibility to male infertility, showing (OR = 1.20, 95% CI = 0.87 to 0.166, p = 0.262), (OR = 1.25, 95% CI = 0.85 to 1.84, p = 0.248), and (OR = 1.25, 95% CI = 0.61 to 2.57, p = 0.537) values, respectively. Data about the four haplotype associations and their estimated frequencies are listed in Table 4.

Table 4.

Haplotype Analysis of GSTP1 Gene Polymorphisms Associated with Male Infertility

Haplotype	rs1695	rs1138272	Cases	Controls	OR [95% CI]	p value
H1	A	C	0.668	0.713	Reference Haplotype
H2	A	T	0.178	0.158	1.20 [0.87-1.66]	0.262
H3	G	C	0.118	0.100	1.25 [0.85-1.84]	0.248
H4	G	T	0.035	0.028	1.25 [0.61-2.57]	0.537

CI, confidence interval; GST, glutathione S-transferase; OR, odds ratio.

Furthermore, the association of male infertility with GSTP1 polymorphisms was evaluated using SNP-SNP interaction. After combining the genotypes of the two common SNPs, four groups were generated: no risk alleles (AA:CC) for both GSTP1 polymorphisms; no risk allele for rs1695 and any risk allele for rs1138272 (AA: CT+TT); no risk allele for rs1138272 or any risk allele for rs1695 (AG + GG: CC); and the emergence of two risk alleles (AG + GG: CT+TT). The GSTP1 (rs1695) and GSTP1 (rs1138272) primary risk alleles were identified as G and T, respectively. Results are shown in Table 5 and indicate that independent of the existence of the GSTP1 risk allele (rs1138272), the presence of any risk allele (rs1695) is uncorrelated with the likelihood of male infertility. The risk of male infertility within the CC: AG+GG population was not statistically significant (OR = 1.211, 95% CI = 0.766 to 1.915, p = 0.413), as was the risk among the CT+TT: AA population (OR = 1.174, 95% CI = 0.797 to 1.729, p = 0.417). Besides, no significant correlation was detected among the carriers of the two-risk allele (OR = 1.522, 95% CI = 0.838 to 2.762, p = 0.166) (Table 5).

Table 5.

Results of SNP-SNP Interaction

GSTP1 (rs1138272)	GSTP1 (rs1695)	Cases (n = 300) (%)	Controls (n = 300) (%)	OR [95% CI]	p value
0	0	138 (46)	154 (51.33)	Reference
0	1	51 (17)	47 (15.67)	1.211 [0.766-1.915]	0.413
1	0	81 (27)	77 (25.67)	1.174 [0.797-1.729]	0.417
1	1	30 (10)	22 (7.33)	1.522 [0.838-2.762]	0.166

CI, confidence interval; GST, glutathione S-transferase; OR, odds ratio.

0: 0 = CC: AA; 0: 1 = CC: AG+GG; 1: 0 = CT+TT: AA; 1: 1 = CT+TT: AG+GG.

Discussion

Around the world, male infertility has been linked to several problems, including lifestyle, environmental, or genetic factors, as well as possible signs of androgen deficiency or endocrine pathology contributing to impaired spermatogenesis (Levine et al., 2017; Oliveira et al., 2017). In fact, numerous loci have been linked to the incidence of oligozoospermia and/or azoospermia by genome-wide association studies (Aston et al., 2010; Cerván-Martín et al., 2020; Kosova et al., 2012), and proper spermatozoa production during spermatogenesis has been attributed to approximately 2300 genes that are predominantly expressed in the testes (Bellil et al., 2021; Krausz and Riera-Escamilla, 2018; Lu et al., 2019).

At physiological levels, ROS and fertilization characteristics are related, including chromatin compaction, sperm capacitation, hyperactivation, motility, chemotaxis, and oocyte interaction (Agarwal et al., 2019, 2018). On the contrary, ROS overproduction and decreased antioxidant defense leads to redox imbalance, causing apoptosis, DNA damage, membrane integrity loss, and higher permeability, negatively impacting sperm quality and function (Smith et al., 2002). This was reported in idiopathic infertile men exhibiting significantly higher seminal ROS levels and weaker antioxidant properties compared to healthy controls (Agarwal et al., (2008a) Ribas-Maynou and Yeste, 2020).

As a part of the body’s defense systems, GSTs are members of a multigene family that helps in the detoxification of various substances, such as xenobiotics, carcinogens, chemotherapeutic drugs, and toxins, as well as bioactivation by catalyzing glutathione conjugation to xenobiotics or Phase I metabolic products (Hayes et al., 2005; Sheehan et al., 2001). Since then, GST enzymes have been the most researched, with much of the literature focusing on their detoxification properties and cellular redox homeostasis.

To date, one of the most rapidly developing areas of study in the genetics of male infertility is the examination of gene polymorphisms related to spermatogenesis. Variations in these genes are thought to be possible risk factors that might increase the severity of sperm failure. Additionally, the exploration of GST polymorphisms has provided a comprehensive picture of how individual and population differences in response to the OS pathway may be related. For this reason, genes such as GSTP1, GSTM1, and GSTT1 have undergone a very extensive investigation in relation to male infertility in the past few years.

The GSTP1, GSTT1, and GSTM1 genes are located on chromosomes 11q13, 22q11.23, and 1p13.3, respectively (Gong et al., 2012). The deletion polymorphism identified in the GSTM1 and GSTT1 genes (null genotype) has been linked to decreased enzymatic activity and heightened susceptibility to chromosomal damage (Norppa, 2004; Xu et al., 2013). Moreover, they can decrease the harmful effects of OS on male germ lines (Tremellen, 2008) and are believed to be genetic factors leading to male infertility (Ying et al., 2013).

On the contrary, the Pi-class enzyme is the most remarkable GST among all classes mentioned in the rising formation of conjugated products and has received the greatest attention because of its possible role in various disorders, with higher expression in a variety of human cancers, such as the bladder, mouth, kidney, esophagus, lung, colon, ovary, testis, and stomach tumors (Kudhair et al., 2020; Ogino et al., 2019; Yadav et al., 2020).

Publications exploring the association between GSTP1, GSTM1, or GSTT1 polymorphisms and male infertility report conflicting findings; thus, more studies are necessary to validate their results in the future, and an updated meta-analysis should be conducted to reexamine the controversy. Hence, in this work, we hypothesized that the abovementioned GSTP1 polymorphisms were associated with male infertility susceptibility in the Moroccan population and tested this hypothesis based on a case-control study.

The clinical information of cases and controls is summarized in Table 1. In that vein, we evaluated a variety of risk factors, since in case-controlled studies a selection bias can exist and potentially detrimental habits may be contributing to male infertility, thus affecting the identification of meaningful associations. Of these factors, we examined the subjects age, BMI, health state, smoking and drinking habits, heat exposure according to their profession, and family histories.

Notably, for men in their 30s, the fertility rate has risen by 21%, and for those over 40, it has risen by about 30% (Harris et al., 2011). Also, in comparison to men of normal BMI, increased male weight has been linked to decreased testosterone levels, lower-quality sperm, and decreased fertility (Katib, 2015). Notably, an individual’s health status is their relative state of wellness and illness, taking into consideration any symptoms, functional impairment, and biological or physiological malfunction (Zhang et al., 2023). It varies from excellent, good, fair, or poor state, that is, a good physical condition or “managing a chronic disease.”

Furthermore, lifestyle factors, such as tobacco smoking and alcohol consumption, have been reported to impact semen quality and male fertility overall (Joo et al., 2012). Apparently, drinking affects both sperm production and morphology, while toxins released by smoking mainly impair the quality of seminal fluid and sperm motility (Basic et al., 2023). Reports about exposure to high temperatures affirmed that it can impair sperm production and quality, hence leading to reduced sperm count (Melinawati et al., 2023). Also, excessive heat can decrease sperm motility by reducing the body’s adenosine triphosphate levels and mitochondrial activity (Hoang-Thi et al., 2022).

In this work, there was no divergence from Hardy-Weinberg equilibrium among cases and control groups, according to our genotype distribution data, indicating that the studied genotypes follow this genetic law (Table 3). The analysis of GSTP1 polymorphism frequencies revealed non statistically significant differences and small statistical power. The distribution of GSTP1 genotypes was also compared by considering codominant, recessive, and dominant genetic models, but no correlation between any of these models and the mentioned polymorphisms was found (p > 0.05). Taking together, the relatively low statistical power of these analyses is substantially due to the smaller OR values, although our population size (n = 600) is certainly sufficient to detect any significant association. Regarding c.313 and c.341 polymorphisms, minor allele frequency (MAF) (G) or (T) was higher among cases compared to control subjects (Table 6). In a further investigation, we analyzed GSTP1 haplotypes and SNP-SNP interaction effects on male infertility susceptibility, but no significant results were detected among all four classes of risk alleles.

Table 6.

Comparison of MAF Values Collected from Ensembl Database with Current Data

Population	AFR	AMR	EAS	EUR	SAS	ALL	Current data
SNPs	AFR	AMR	EAS	EUR	SAS	ALL	Cases(n = 300)	Controls(n = 300)
rs1695 (MAF=G)	(n = 635)	(n = 330)	(n = 180)	(n = 333)	(n = 288)	(n = 1766)	(n = 600)
rs1695 (MAF=G)	48%	48%	18%	33%	29%	35%	15.33%	12.83%
rs1138272 (MAF=T)	(n = 7)	(n = 20)	(n = 1)	(n = 71)	(n = 69)	(n = 168)	(n = 600)
rs1138272 (MAF=T)	1%	3%	0%	7%	7%	3%	21.33%	18.67%

In this case-control study, there was a significantly greater frequency of the A allele (84.67%) compared to the G allele (15.33%) in infertile men. These results match those calculated using 1000 Genomes Project Phase 3 allele frequencies (Auton et al., 2015) and collected from the Ensembl database. Accordingly, alleles frequencies in different populations were (A: 52% and G: 48%) for African (AFR) and American (AMR) population; (A: 82% and G: 18%) for East Asian (EAS); (A: 67% and G: 33%) for European (EUR); and (A: 71% and G: 29%) for South Asian (SAS) population (Table 6). Similarly, for the second SNP, the frequency of the C allele was greater (78.67%) than the T allele frequency (21.33%) in the patient group. Our results support those reported in Ensembl database (Auton et al., 2015) among different population groups and with highly significant percentages: Africa (C: 99% and T: 1%); America (C: 97% and T: 3%); East Asia (C: 100% and T: 0%); and Europe and South Asia (C: 93% and T: 7%) (Table 6).

Using the three databases, PubMed, Biomed Central, and Scopus, a literature search was conducted to find all papers that analyzed the association between male infertility and two GSTP1 gene polymorphisms. Up to date, 23 case-control studies have addressed this topic with contradictory findings and are distributed as follow: 13 articles focused solely on rs1695 polymorphism (Feng et al., 2015; He et al., 2023; Hekim et al., 2020; Kulchenko et al., 2021; Li et al., 2013; Messaros et al., 2009; Safarinejad et al., 2010; Tang et al., 2012; Xiong et al., 2015; Yarosh et al., 2015; Yin et al., 2020; Zhang et al., 2021; Zhang et al., 2022), whereas a single investigation targeted rs1138272 polymorphism (Myandina et al., 2019). Six others covered both polymorphisms (Kurashova et al., 2020, 2019a, 2019b; Lakpour et al., 2013; Mirfeizollahi et al., 2009; Trang et al., 2018). Just three papers about rs1695 polymorphism (Economopoulos et al., 2010; Huang et al., 2017; Safarinejad et al., 2012) and none regarding rs1138272 polymorphism were published in the context of meta-analyses. Among all of the aforesaid publications, nine align with our findings versus 12 others that reported the reverse.

In the current paper, no difference in the frequencies of Ile105Val polymorphism in infertile men has been detected. These results match with a study conducted in a Turkish population where no correlation between Ile105Val polymophism and male infertility was detected (p = 0.192) (Hekim et al., 2020). Likewise, there was no significant association between rs1695 polymorphism and the risk of idiopathic male infertility in a case-controlled study using the Mass ARRAY platform for genotyping in a Chinese population (Yin et al., 2020).

In the same ethnic background, researchers from Guiyang revealed that GSTM1 and GSTT1 gene deletions could increase OS damage and contribute to idiopathic male infertility, with no significant difference in GSTP1 distribution (OR = 1.006; 95% CI: 0.615 to 1.645; p = 0.982) between the infertile and control groups (Zhang et al., 2022).

In Northwestern China, a study based on OS assessment in infertile men with varicoceles and the roles of GSTM1, GSTT1, and GSTP1 genes supported our findings, where differences in GSTP1 allelic variation were not statistically significant among cases and controls (Tang et al., 2012). In the Chinese Han population, the M1 (-/-) and P1 (Val/Val or Ile/Val) genotypes and the M1 (-/-), T1 (+/+), and P1 (Val/Val or Ile/Val) genotypes were linked to a decreased risk of azoospermia (Li et al., 2013).

A study of 95 infertile Iranian men with OAT found no significant correlation between GSTM1 and GSTP1 polymorphisms and seminal OS, sperm chromatin integrity, or maturity at conventional or molecular levels (Lakpour et al., 2013). Another case-control study showed that GSTM1 null genotype deficiency did not influence total GST activity or sperm parameters, possibly due to GSTP1 compensatory activity (Mirfeizollahi et al., 2009). In Michigan, prolonged exposure to dichlorodiphenyltrichloroethane (DDT) and its metabolites (DDE-DDT) can negatively affect sperm concentration, motility, and morphology, with the GSTT1 null polymorphism causing the effect more than GSTP1 polymorphism (Messaros et al., 2009).

Our results coincided with a meta-analysis consisting of nine case-control investigations, where the Ile105Val polymorphism was not significantly correlated with male infertility in the general population. However, significant associations were found under the heterozygote (OR = 1.29, 95% CI = 1.08 to 1.53, I2 = 26.8%) and dominant (OR = 1.23, 95% CI = 1.04 to 1.46, I² = 32.2%) models after eliminating studies for which the data failed to meet the HWE (Huang et al., 2017).

Disagreeing with the current work, a strong link between GSTP1 variant genotypes (AG and GG) and higher infertility risk in men with NOA and oligospermia from southwest China. Besides, carriers of the GSTT1 null genotype and GSTP1 variant alleles were proven to have a 2-fold increased risk of developing male factor infertility in this same paper (Xiong et al., 2015).

In Moscow, 138 men were examined to study the association of rs1695 polymorphism with pathospermia. As a result, this polymorphism can be regarded as a genetic marker, with the GG genotype predominant in cases and the AA genotype in controls (Kulchenko et al., 2021). Likewise, males of reproductive age are at risk for both teratospermia and asthenozoospermia due to the GSTP1 polymorphism (rs1138272) in that same region (Myandina et al., 2019).

Kurashova et al. published three case-control studies to analyze the correlation between OS and GSTP1 polymorphisms (Ile105Val and Ala114Val) in the Russian population. Interestingly, Ile105Val polymorphism was associated with male infertility, but Ala114Val polymorphism wasn’t. In infertile men, the wild-type (Ile/Ile) genotype and the major allele (A) are found statistically significant more often than in controls (Kurashova et al., 2020, 2019a, 2019b). Another investigation in Russia demonstrated that patients with the I105V heterozygous allele have a higher risk of infertility, with a phenotypic effects of the GSTP1 gene exacerbated by cigarette smoking (Yarosh et al., 2015).

In Vietnam, the two SNPs (rs1695 and rs1138272) were investigated using ARMS-PCR and were considered as new genetic markers for male infertility (Trang et al., 2018). Also, in Henan, Feng et al. confirmed that the rs1695 polymorphism might be associated with idiopathic male infertility (Feng et al., 2015).

A case-control study at Xi’an Jiaotong University found that genetic variants in GSTP1 may be a risk factor for men with primary idiopathic infertility by affecting semen quality (Zhang et al., 2021). In Guiyang, a recent paper revealed that GSTP1 may be responsible for an individual’s vulnerability to OS damage and that the wild-type genotype (AA) is an indicative predictor of idiopathic male infertility (He et al., 2023).

Research about the effects of rs1695 polymorphism on male infertility provided confusing results, and a reasoned discussion emerged by Safarinejad et al. (Economopoulos et al., 2010), since they demonstrated a higher infertility risk in GSTP1 wild-type (Ile/Ile) carriers combined with GSTT1 and GSTM1 genotypes and inverse relationships between semen parameters and GSTP1 wild-type genotype (Safarinejad et al., 2010). After integrating 11 studies, Safarinejad et al. noticed that variant allele (Val) carriers have significantly lower enzymatic GSTP1 activity, while carriers of the Ile/Val genotype were protected against infertility (Safarinejad et al., 2012).

In summary, the complexity and heterogeneity of infertility status, research design, inclusion and exclusion criteria, ethnicity differences, gene-environment interactions, and the study size might all contribute to these inconsistent and even contradictory reports. Nonetheless, the GST family antioxidants play an important role by counteracting oxidative stressors. Another set of functional antioxidants or gene polymorphisms suggested in ROS detoxifying may be crucial for identifying the vulnerability to male infertility, despite not being discovered yet.

Finally, it is noteworthy that our study has some limitations, including not adjusting the data for potential confounders since no significant association was found for both GSTP1 polymorphisms and not assessing gene-gene and gene-environment interactions. Consequently, as several studies have shown interethnic variations in GST allelic frequencies, a large-scale evaluation of these polymorphisms in relation to the previously described interactions may yield more accurate results. Similarly, additional research should provide prospective and efficient insights into the mechanism and capacity of how OS affects male infertility.

Conclusion

Similar to other complex conditions, it is really challenging to examine the impact of each aspect involved in the occurrence of male infertility, particularly the pathogenesis linked to genetic factors. Results about the possible association of GSTP1 gene polymorphisms (rs1695 and rs1138272) with male infertility are still controversial. Otherwise, our case-control suggests that these polymorphisms are not associated with an increased probability of this condition. However, there are certain restrictions in this work, including not accounting for the possible confounding effects. Also, only two SNPs were examined in our study, so we can’t overlook the possibility that additional SNPs or certain haplotypes may significantly affect a person’s genetic susceptibility to this disease because there are so many potential SNP-SNP interaction combinations to take into consideration. Furthermore, more attention to OS-related pathological manifestations should be paid to carriers of GSTP1 alone or in combination with other GST genotypes to draw a definitive conclusion about whether the two polymorphisms could be considered biomarkers for screening susceptible infertile men.

Footnotes

Acknowledgments

The authors would like to thank the patients, recruited from the Department of Urology at Ibn-Rochd University Hospital and the Laboratory of Medical Analysis at LABOMAC in Casablanca, Morocco, and the responsible doctors for their collaboration in this study.

Authors’ Contributions

H.H. and H.R. established the concept and the aims of this work. H.H. handled the recruitment process and authored the article. The genotyping was carried out by H.H. and S.R. The statistics were performed by H.H. and H.C. A.B., O.A.F., and H.R. took part in the data analysis. All authors reviewed the final article.

Data Availability Statement

Upon request, the corresponding author will provide all data associated with this study.

Ethical Approval

The present study was approved by the local Committee of the Faculty of Medicine and Pharmacy in Casablanca, Morocco.

Consent for Participation

Informed consent was obtained from all participants included in the study.

Consent for Publication

Patients agreed to participate in this work.

Author Disclosure Statement

The authors declare that they have no conflicts of interest.

Funding Information

There were no funds for this study.

Supplementary Material

References

Agarwal

, Makker

, Sharma

. Review article: Clinical relevance of oxidative stress in male factor infertility: An update. Am J Reprod Immunol, 2008a;59(1):2-11; doi: 10.1111/j.1600-0897.2007.00559.x

Agarwal

, Parekh

, Panner Selvam

, et al. Male Oxidative Stress Infertility (MOSI): Proposed terminology and clinical practice guidelines for management of idiopathic male infertility. World J Mens Health, 2019; 37(3):296-312; doi: 10.5534/wjmh.190055

Agarwal

, Rana

, Qiu

, et al. Role of oxidative stress, infection and inflammation in male infertility. Andrologia, 2018; 50(11):e13126; doi: 10.1111/and.13126

Aguilera

, Wichmann

, Sousa

, et al. Antibodies against glutathione S-transferase T1 (GSTT1) in patients with de novo immune hepatitis following liver transplantation. Clin Exp Immunol, 2001; 126(3):535-539; doi: 10.1046/j.1365-2249.2001.01682.x

Ahmed

. Promoter methylation in prostate cancer and its application for the early detection of prostate cancer using serum and urine samples. Biomark Cancer, 2010; 2:17-33; doi: 10.4137/BIC.S3187

Aitken

, Gibb

, Baker

, et al. Causes and consequences of oxidative stress in spermatozoa. Reprod Fertil Dev, 2016; 28(1-2):1-10; doi: 10.1071/RD15325

Alahmar

. Role of oxidative stress in male infertility: An updated review. J Hum Reprod Sci, 2019; 12(1):4-18; doi: 10.4103/jhrs.JHRS_150_18

Allocati

, Masulli

, Di Ilio

, et al. Glutathione transferases: Substrates, inihibitors and pro-drugs in cancer and neurodegenerative diseases. Oncogenesis, 2018; 7(1):8; doi: 10.1038/s41389-017-0025-3

Ambulkar

, Sigh

, Reddy

, et al. Genetic Risk of Azoospermia Factor (AZF) microdeletions in idiopathic cases of azoospermia and oligozoospermia in central Indian population. J Clin Diagn Res, 2014; 8(3):88-91; doi: 10.7860/JCDR/2014/7680.4116

10.

Aston

, Krausz

, Laface

, et al. Evaluation of 172 candidate polymorphisms for association with oligozoospermia or azoospermia in a large cohort of men of European descent. Hum Reprod, 2010; 25(6):1383-1397; doi: 10.1093/humrep/deq081

11.

Auton

, Brooks

, Durbin

, et al; 1000 Genomes Project Consortium. A global reference for human genetic variation. Nature, 2015; 526(7571):68-74; doi: 10.1038/nature15393

12.

Basic

, Mitic

, Krstic

, et al. Tobacco and alcohol as factors for male infertility—a public health approach. J Public Health (Oxf), 2023; 45(2):e241-e249; doi: 10.1093/pubmed/fdac042

13.

Behrens

, Jania

, Snouwaert

, et al. Beyond detoxification: Pleiotropic functions of multiple glutathione S-transferase isoforms protect mice against a toxic electrophile. PLoS One, 2019; 14(11):e0225449; doi: 10.1371/journal.pone.0225449

14.

Bellil

, Ghieh

, Hermel

, et al. Human testis-expressed (TEX) genes: A review focused on spermatogenesis and male fertility. Basic Clin Androl, 2021; 31(1):9; doi: 10.1186/s12610-021-00127-7

15.

Board

, Webb

, Coggan

. Isolation of a cDNA clone and localization of the human glutathione S-transferase 3 genes to chromosome bands 11q13 and 12q13-14. Ann Hum Genet, 1989; 53(3):205-213; doi: 10.1111/j.1469-1809.1989.tb01786.x

16.

Bonde

, Giwercman

. Environmental xenobiotics and male reproductive health. Asian J Androl, 2014; 16(1):3-4; doi: 10.4103/1008-682X.122191

17.

Cech

, Steitz

. The noncoding RNA revolution—trashing old rules to forge New Ones. Cell, 2014; 157(1):77-94; doi: 10.1016/j.cell.2014.03.008

18.

Cerván-Martín

, Bossini-Castillo

, Rivera-Egea

, et al. Evaluation of male fertility-associated loci in a European population of patients with severe spermatogenic impairment. J Pers Med, 2020; 11(1):22; doi: 10.3390/jpm11010022

19.

Chatterjee

, Gupta

. The multifaceted role of glutathione S-transferases in cancer. Cancer Lett, 2018; 433:33-42; doi: 10.1016/j.canlet.2018.06.028′

20.

Coles

, Morel

, Rauch

, et al. Effect of polymorphism in the human glutathione S-transferase A1 promoter on hepatic GSTA1 and GSTA2 expression. Pharmacogenetics and Genomics, 2001; 11(8):663-669.

21.

Cote

, Chen

, Smith

, et al. Meta- and pooled analysis of gstp1 polymorphism and lung cancer: A HuGE-GSEC review. Am J Epidemiol, 2009; 169(7):802-814; doi: 10.1093/aje/kwn417

22.

Crocitto

, Korns

, Kretzner

, et al. Prostate cancer molecular markers GSTP1 and hTERT in expressed prostatic secretions as predictors of biopsy results. Urology, 2004; 64(4):821-825; doi: 10.1016/j.urology.2004.05.007

23.

Dai

, Bui

, Lodge

. Glutathione S-Transferase gene associations and gene-environment interactions for Asthma. Curr Allergy Asthma Rep, 2021; 21(5):31; doi: 10.1007/s11882-021-01005-y

24.

Dohle

. Male infertility in cancers patients: Review of the literature. Int J Urol, 2010; 17(4):327-331; doi: 10.1111/j.1442-2042.2010.02484.x

25.

Economopoulos

, Sergentanis

, Choussein

. Glutathione-S-transferase gene polymorphisms (GSTM1, GSTT1, GSTP1) and idiopathic male infertility: Novel perspectives versus facts. J Hum Genet, 2010; 55(9):557-558; doi: 10.1038/jhg.2010.89

26.

Feng

, Jing

, Liu

, et al. Association of SPO11 and GST gene polymorphisms with idiopathic male infertility in ethnic Han Chinese. Zhonghua Yi Xue Yi Chuan Xue Za Zhi, 2015; 32(6):866-870; doi: 10.3760/cma.j.issn.1003-9406.2015.06.025

27.

Franco

, Schoneveld

, Pappa

, et al. The central role of glutathione in the pathophysiology of human diseases. Arch Physiol Biochem, 2007; 113(4-5):234-258; doi: 10.1080/13813450701661198

28.

García Rodríguez

, de la Casa

, Johnston

, et al. Association of polymorphisms in genes coding for antioxidant enzymes and human male infertility. Ann Hum Genet, 2019; 83(1):63-72; doi: 10.1111/ahg.12286

29.

Ghobadloo

, Yaghmaei

, Bakayev

, et al. GSTP1, GSTM1, and GSTT1 genetic polymorphisms in patients with cryptogenic liver cirrhosis. J Gastrointest Surg, 2004; 8(4):423-427; doi: 10.1016/j.gassur.2004.02.005

30.

Gong

, Dong

, Shi

, et al. Genetic polymorphisms of GSTM1, GSTT1 and GSTP1 with prostate cancer risk: A meta-analysis of 57 Studies. PLoS One, 2012; 7(11):e50587; doi: 10.1371/journal.pone.0050587

31.

Hamilton

, Suzuki

, Aguila

, et al. Sperm-borne glutathione-S-transferase omega 2 accelerates the nuclear decondensation of spermatozoa during fertilization in mice†. Biol Reprod, 2019; 101(2):368-376; doi: 10.1093/biolre/ioz082

32.

Harris

, Fronczak

, Roth

, et al. Fertility and the aging male. Rev Urol, 2011; 13(4):e184-e190.

33.

Hayes

, Flanagan

, Jowsey

. Glutathione transferases. Annu Rev Pharmacol Toxicol, 2005; 45:51-88; doi: 10.1146/annurev.pharmtox.45.120403.095857

34.

, Mu

, Liu

, et al. Glutathione S-transferase genetic polymorphisms and fluoride-induced reproductive toxicity in men with idiopathic infertility. Asian J Androl, 2023; 25(3):404-409; doi: 10.4103/aja202271

35.

Hekim

, Gure

, Metin Mahmutoglu

, et al. SNP’s in xenobiotic metabolism and male infertility. Xenobiotica, 2020; 50(3):363-370; doi: 10.1080/00498254.2019.1616850

36.

Hemachand

, Gopalakrishnan

, Salunke

, et al. Sperm plasma-membrane-associated glutathione S-transferases as gamete recognition molecules. J Cell Sci, 2002; 115(Pt 10):2053-2065; doi: 10.1242/jcs.115.10.2053

37.

Hemachand

, Shaha

. Functional role of sperm surface glutathione S-transferases and extracellular glutathione in the haploid spermatozoa under oxidative stress. FEBS Lett, 2003; 538(1-3):14-18; doi: 10.1016/s0014-5793(03)00103-0

38.

Hoang-Thi

A-P

, Dang-Thi

A-T

, Phan-Van

, et al. The impact of high ambient temperature on human sperm parameters: A meta-analysis. Iran J Public Health, 2022; 51(4):710-723; doi: 10.18502/ijph.v51i4.9232

39.

Huang

X-K

, Huang

Y-H

, Huang

J-H

, Liang

J-Y

. Glutathione S-transferase P1 Ile105Val polymorphism and male infertility risk: An updated meta-analysis. Chin Med J (Engl), 2017; 130(8):979-985; doi: 10.4103/0366-6999.204102

40.

Jain

, Chen

, Chang

K-C

, et al. Impact of the location of CpG methylation within the GSTP1 gene on its specificity as a DNA marker for hepatocellular carcinoma. PLoS One, 2012; 7(4):e35789; doi: 10.1371/journal.pone.0035789

41.

Joo

, Kwon

, Myung

, et al. The effects of smoking and alcohol intake on sperm quality: Light and transmission electron microscopy findings. J Int Med Res, 2012; 40(6):2327-2335; doi: 10.1177/030006051204000631

42.

Katib

. Mechanisms linking obesity to male infertility. Cent European J Urol, 2015; 68(1):79-85; doi: 10.5173/ceju.2015.01.435

43.

Kim

J-H

, Park

S-G

, Lee

K-H

, et al. GSTM1 and GSTP1 polymorphisms as potential factors for modifying the effect of smoking on inflammatory response. J Korean Med Sci, 2006; 21(6):1021-1027; doi: 10.3346/jkms.2006.21.6.1021

44.

Kosova

, Scott

, Niederberger

, et al. Genome-wide association study identifies candidate genes for male fertility traits in humans. Am J Hum Genet, 2012; 90(6):950-961; doi: 10.1016/j.ajhg.2012.04.016

45.

Krausz

. Male infertility: Pathogenesis and clinical diagnosis. Best Pract Res Clin Endocrinol Metab, 2011; 25(2):271-285; doi: 10.1016/j.beem.2010.08.006

46.

Krausz

, Riera-Escamilla

. Genetics of male infertility. Nat Rev Urol, 2018; 15(6):369-384; doi: 10.1038/s41585-018-0003-3

47.

Kudhair

, Abdulridha

, Hussain

, et al. The association of combined GSTM1, GSTT1, and GSTP1 genetic polymorphisms with lung cancer risk in male Iraqi Waterpipe Tobacco (Nargila) smokers. Cancer Epidemiol, 2024; 93:102689; doi: 10.1016/j.canep.2024.102689

48.

Kudhair

, Alabid

, Taheri-Kafrani

, et al. Correlation of GSTP1 gene variants of male Iraqi waterpipe (Hookah) tobacco smokers and the risk of lung cancer. Mol Biol Rep, 2020; 47(4):2677-2684; doi: 10.1007/s11033-020-05359-w

49.

Kulchenko

, Myandina

, Alhejoj

, et al. Association of glutathione s-transferase gene polymorphism with risk of male infertility in Moscow region. Urologiia, 2021; 2021(2):69-73; doi: 10.18565/UROLOGY.2021.2.69-73

50.

Kurashova

, Belyaeva

, Ershova

, et al. The association of gstp1 polymorphisms with male idiopathic infertility. Urologiia, 2019a(2):50-54; doi: 10.18565/urology.2019.2.50-54

51.

Kurashova

, Dashiev

, Bairova

, et al; Scientific Centre for Family Health and Human Reproduction Problems, Irkutsk, Russian Federation. Association of polymorphic markers of GSTP1 gene with oxidative stress parameters in infertility men. Urologiia (Moscow, Russia : 1999), 2020; 2020:84-89.

52.

Kurashova

, Dashiev

, Dolgikh

, et al. Association of Lipid Peroxidation/Antioxidant system activity with glutathione S-Transferase P1 polymorphisms in infertile men. Ijbm, 2019b;9(4):329-333; doi: 10.21103/Article9(4)_OA11

53.

Lakpour

, Mirfeizollahi

, Farivar

, et al. The association of seminal plasma antioxidant levels and sperm chromatin status with genetic variants of GSTM1 and GSTP1 (Ile105Val and Ala114Val) in infertile men with oligoasthenoteratozoospermia. Dis Markers, 2013; 34(3):205-210; doi: 10.3233/DMA-120954

54.

Leaver

. Male infertility: An overview of causes and treatment options. Br J Nurs, 2016; 25(18):S35-S40; doi: 10.12968/bjon.2016.25.18.S35

55.

Levine

, Jørgensen

, Martino-Andrade

, et al. Temporal trends in sperm count: A systematic review and meta-regression analysis. Hum Reprod Update, 2017; 23(6):646-659; doi: 10.1093/humupd/dmx022

56.

, Ding

, Fu

, Chen

. [Association between glutathione-S-transferase gene polymorphisms (GSTM1, GSTT1 and GSTP1) and idiopathic azoospermia]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi, 2013; 30(1):102-105; doi: 10.3760/cma.j.issn.1003-9406.2013.01.025

57.

, Liang

, Liu

, et al. Ras association domain family member 10 suppresses gastric cancer growth by cooperating with GSTP1 to regulate JNK/c-Jun/AP-1 pathway. Oncogene, 2016; 35(19):2453-2464; doi: 10.1038/onc.2015.300

58.

Llavanera

, Mateo-Otero

, Bonet

, et al. The triple role of glutathione S-transferases in mammalian male fertility. Cell Mol Life Sci, 2020; 77(12):2331-2342; doi: 10.1007/s00018-019-03405-w

59.

, Oura

, Matsumura

, et al. CRISPR/Cas9-mediated genome editing reveals 30 testis-enriched genes dispensable for male fertility in mice†. Biol Reprod, 2019; 101(2):501-511; doi: 10.1093/biolre/ioz103

60.

Mannucci

, Argento

, Fini

, et al. The impact of oxidative stress in male infertility. Front Mol Biosci, 2021; 8:799294.

61.

McIlwain

, Townsend

, Tew

. Glutathione S-transferase polymorphisms: Cancer incidence and therapy. Oncogene, 2006; 25(11):1639-1648; doi: 10.1038/sj.onc.1209373

62.

Melinawati

, Prakosa

, Budihastuti

, et al. The impact of heat exposure, obesity, and physical activity on sperm quality: An Observational Study. Andrologia, 2023; 2023:1-7; doi: 10.1155/2023/9142450

63.

Messaros

, Rossano

, Liu

, et al. Negative effects of serum p,p′-DDE on sperm parameters and modification by genetic polymorphisms. Environ Res, 2009; 109(4):457-464; doi: 10.1016/j.envres.2009.02.009

64.

Mirfeizollahi

, Farivar

, Akhondi

, et al. GSTM1 and GSTP1 polymorphisms and glutathione s-transferase activity: Iranian infertile men. Tehran Univ Med J, 2009; 66:878-887.

65.

Mukhammadiyeva

, Bakirov

, Karimov

, et al. Analysis of the GSTP1 rs1695 polymorphism association with the development of asthma and phenotypic manifestations. J Asthma, 2022; 59(6):1065-1069; doi: 10.1080/02770903.2021.1910295

66.

Myandina

, Hasan

, Azova

, et al. Influence of GSTP1 gene polymorhism on decreased semen quality. Russ Open Med J, 2019; 8(4):411.

67.

Norppa

. Cytogenetic biomarkers and genetic polymorphisms. Toxicol Lett, 2004; 149(1-3):309-334; doi: 10.1016/j.toxlet.2003.12.042

68.

Ogino

, Konishi

, Ichikawa

, et al. Glutathione S‐transferase Pi 1 is a valuable predictor for cancer drug resistance in esophageal squamous cell carcinoma. Cancer Sci, 2019; 110(2):795-804; doi: 10.1111/cas.13896

69.

Oguztuzun

, Abu-Hijleh

, Coban

, et al. GST isoenzymes in matched normal and neoplastic breast tissue. neo, 2011; 58(4):304-310; doi: 10.4149/neo_2011_04_304

70.

Oliveira

, Sousa

, Silva

, et al. Obesity, energy balance and spermatogenesis. Reproduction, 2017; 153(6):R173-R185; doi: 10.1530/REP-17-0018

71.

Petit

, Serres

, Bourgeon

, et al. Identification of sperm head proteins involved in zona pellucida binding. Hum Reprod, 2013; 28(4):852-865; doi: 10.1093/humrep/des452

72.

Ribas-Maynou

, Yeste

. Oxidative stress in male infertility: Causes, effects in assisted reproductive techniques, and protective support of antioxidants. Biology (Basel), 2020; 9(4):77; doi: 10.3390/biology9040077

73.

Safarinejad

, Dadkhah

, Asgari

, et al. Glutathione S-transferase polymorphisms (GSTM1, GSTT1, GSTP1) and male factor infertility risk a pooled analysis of studies. Urology Journal, 2012; 9:541-548.

74.

Safarinejad

, Shafiei

, Safarinejad

. The association of glutathione-S-transferase gene polymorphisms (GSTM1, GSTT1, GSTP1) with idiopathic male infertility. J Hum Genet, 2010; 55(9):565-570; doi: 10.1038/jhg.2010.59

75.

Schlosser

, Nakib

, Carré-Pigeon

, et al. [Male infertility: Definition and pathophysiology]. Ann Urol (Paris), 2007; 41(3):127-133; doi: 10.1016/j.anuro.2007.02.004

76.

Schnekenburger

, Morceau

, Duvoix

, et al. Expression of glutathione S-transferase P1-1 in differentiating K562: Role of GATA-1. Biochem Biophys Res Commun, 2003; 311(4):815-821; doi: 10.1016/j.bbrc.2003.10.072

77.

Sheehan

, Meade

, Foley

, et al. Structure, function and evolution of glutathione transferases: Implications for classification of non-mammalian members of an ancient enzyme superfamily. Biochem J, 2001; 360(Pt 1):1-16.

78.

Slonchak

AМ

, Cwieduk

, Rzerzowska-Wolny

, et al. Crosstalk between transcription factors in regulation of the human glutathione S-transferase P1 gene expression in Me45 melanoma cells. Переговори між транскрипційними факторами у регуляції експресії гена Р1 глутатіон-S-трансферази людини у клітинах меланоми Ме45, 2009.

79.

Smith

, Perry

, Pryor

. Causes and consequences of oxidative stress in Alzheimer’s disease. Free Radic Biol Med, 2002; 32(11):1049; doi: 10.1016/S0891-5849(02)00793-11, 2 1Guest Editors: Mark A. Smith and George Perry 2This article is part of a series of reviews on “Causes and Consequences of Oxidative Stress in Alzheimer’s Disease.” The full list of papers may be found on the homepage of the journal

80.

Söderdahl

, Küppers-Munther

, Heins

, et al. Glutathione transferases in hepatocyte-like cells derived from human embryonic stem cells. Toxicol In Vitro, 2007; 21(5):929-937; doi: 10.1016/j.tiv.2007.01.021

81.

Song

, Stirzaker

, Harrison

, et al. Hypermethylation trigger of the glutathione-S-transferase gene (GSTP1) in prostate cancer cells. Oncogene, 2002; 21(7):1048-1061; doi: 10.1038/sj.onc.1205153

82.

Strange

, Spiteri

, Ramachandran

, Fryer

. Glutathione-S-transferase family of enzymes. Mutat Res, 2001; 482(1-2):21-26; doi: 10.1016/S0027-5107(01)00206-8

83.

Tang

, Xue

, Xing

, et al. Genetic polymorphisms of glutathione S-transferase M1, T1, and P1, and the assessment of oxidative damage in infertile men with varicoceles from northwestern China. J Androl, 2012; 33(2):257-263; doi: 10.2164/jandrol.110.012468

84.

Teskey

, Abrahem

, Cao

, et al. Glutathione as a marker for human disease. Adv Clin Chem, 2018; 87:141-159; doi: 10.1016/bs.acc.2018.07.004

85.

Trang

, Huyen

, Tuan

, et al. Association of N-acetyltransferase-2 and glutathione S-transferase polymorphisms with idiopathic male infertility in Vietnam male subjects. Chem Biol Interact, 2018; 286:11-16; doi: 10.1016/j.cbi.2018.03.001

86.

Tremellen

. Oxidative stress and male infertility-a clinical perspective. Hum Reprod Update, 2008; 14(3):243-258; doi: 10.1093/humupd/dmn004

87.

Utleg

, Yi

, Xie

, et al. Proteomic analysis of human prostasomes. Prostate, 2003; 56(2):150-161; doi: 10.1002/pros.10255

88.

Vander Borght

, Wyns

. Fertility and infertility: Definition and epidemiology. Clin Biochem, 2018; 62:2-10; doi: 10.1016/j.clinbiochem.2018.03.012

89.

Wang

, He

, Yuan

, et al. Epigenetic Changes of TIMP-3, GSTP-1 and 14-3-3 sigma genes as indication of status of chronic inflammation and cancer. Int J Biol Markers, 2014; 29(3):e208-e214; doi: 10.5301/jbm.5000104

90.

Wiesenfeld

, Hillier

, Meyn

, et al. Subclinical Pelvic inflammatory disease and infertility. Obstet Gynecol, 2012; 120(1):37-43; doi: 10.1097/AOG.0b013e31825a6bc9

91.

Xiong

D-K

, Chen

H-H

, Ding

X-P

, et al. Association of polymorphisms in glutathione S-transferase genes (GSTM1, GSTT1, GSTP1) with idiopathic azoospermia or oligospermia in Sichuan, China. Asian J Androl, 2015; 17(3):481-486; doi: 10.4103/1008-682X.143737

92.

X-B

, Liu

S-R

, Ying

H-Q

, et al. Null genotype of GSTM1 and GSTT1 may contribute to susceptibility to male infertility with impaired spermatogenesis in Chinese population. Biomarkers, 2013; 18(2):151-154; doi: 10.3109/1354750X.2012.755221

93.

Yadav

, Banerjee

, Boruah

, et al. Glutathione S-transferasesP1 AA (105Ile) allele increases oral cancer risk, interacts strongly with c-Jun Kinase and weakly detoxifies areca-nut metabolites. Sci Rep, 2020; 10(1):6032; doi: 10.1038/s41598-020-63034-3

94.

Yarosh

, Kokhtenko

, Churnosov

, et al. Joint effect of glutathione S-transferase genotypes and cigarette smoking on idiopathic male infertility. Andrologia, 2015; 47(9):980-986; doi: 10.1111/and.12367

95.

Yin

, Zhu

, Luo

, et al. Association of single-nucleotide polymorphisms in antioxidant genes and their gene-gene interactions with risk of male infertility in a Chinese population. Biomed Rep, 2020; 13(1):49-54; doi: 10.3892/br.2020.1306

96.

Ying

H-Q

, Qi

, Pu

X-Y

, et al. Association of GSTM1 and GSTT1 Genes with the Susceptibility to Male Infertility: Result from a Meta-Analysis. Genet Test Mol Biomarkers, 2013; 17(7):535-542; doi: 10.1089/gtmb.2012.0409

97.

Zhang

, He

, Zhao

, et al. Effect of glutathione S-transferase gene polymorphisms on semen quality in patients with idiopathic male infertility. J Int Med Res, 2021; 49(12):3000605211061045; doi: 10.1177/03000605211061045

98.

Zhang

H-Y

, Mu

, Chen

, et al. Metabolic enzyme gene polymorphisms predict the effects of antioxidant treatment on idiopathic male infertility. Asian J Androl, 2022; 24(4):430-435; doi: 10.4103/aja202180

99.

Zhang

, Vermeulen

, Krabbe

. Health status of US patients with one or more health conditions: Using a novel electronic patient-reported outcome measure producing single metric measures. Med Care, 2023; 61(11):765-771; doi: 10.1097/MLR.0000000000001919

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.14 MB