The Engineered MARCH8-Resistant Vesicular Stomatitis Virus Glycoprotein Enhances Lentiviral Vector Transduction

Abstract

Lentiviral vectors are one of the most commonly used viral delivery systems for gene therapy. Vesicular stomatitis virus-G envelope glycoprotein (VSV G)-pseudotyped lentiviral vectors have been widely used in clinical studies for treatment of virus infections and genetic deficient diseases. However, the efficiency of lentiviral vector transduction has been long recognized as a limiting factor in clinical gene therapy application, especially in transducing hematopoietic stem cells. MARCH8 (membrane-associated RING-CH 8), an E3 ubiquitin ligase, has been reported to target and downregulate VSV G. Results in this study show that MARCH8 induces ubiquitination and lysosome degradation of VSV G, and knockout of MARCH8 in virus-producing cells increases lentiviral vector transduction by elevating the level of VSV G protein. We then engineered VSV G mutant that has the lysine residues in the cytoplasmic domain substituted for arginine, and showed that this G mutant resists degradation by MARCH8, and allows the enhancement of transduction efficiency of lentiviral vector particles than the parental VSV G protein. This engineered VSV G mutant thus further advances the lentiviral vector system as a powerful tool in gene therapy.

Introduction

Lentiviral vector is one of the most prominent tools for stable gene delivery. It has been approved in clinical applications as gene therapeutics. Because of their capacity of transducing dividing and nondividing cells, and accommodating relatively large transgene fragments, lentiviral vectors have become one of the few gene delivery systems commonly used in research and in clinics.^1

–6 The recent generation of lentiviral vectors show relatively safe integration profiles in host chromosomes, and generate long-term expression of the delivered genes, while induce only moderate immune responses.^7

–11 Therefore, they have been widely used for treatment of virus infections, cure of genetic deficient diseases, and generation of chimeric antigen receptors or epitope-specific transgenic T cell receptors T cells for cancer immune therapies.^{12

–29}

Lentiviral vector system consists of a set of plasmids, the packaging DNA construct encoding Gag/Gag-Pol and HIV regulatory protein Rev, the envelope protein, and a transgene transfer vector.^4,6,30,31 Stable producer cell lines were also used to produce batches of high titer LV for large clinical trials.^32

–36 VSV G (vesicular stomatitis virus-G envelope glycoprotein) is one of the most commonly used viral envelope proteins. It binds to the low-density lipoprotein receptor (LDLR), a ubiquitously expressed cell surface protein, thus warrants a broad spectrum of target cells.^37
–39 VSV G is stable with virus particles, and allows the application of ultracentrifugation and column chromatography to produce high-titer virus stocks.^38,40

While having a number of advantages for gene delivery, lentiviral vectors still have several weaknesses that await further improvement. One issue is the low transduction efficiency of resting T lymphocytes, B cells and hematopoietic stem cells (HSCs) due to the low level of LDLR, cell cycle quiescence, proteasome-mediated inhibition, and high level of restriction factors such as IFITM3.^{41

–54} Increasing transduction efficiency presents one strategy to deliver genes into these cell types. Potential solutions include cytokine stimulation, increasing multiplicity of infection (MOI), sequential transductions, and genetic modification of VSV G.^{53,55

–59} Recent studies found that agents such as mammalian target of rapamycin (mTOR) inhibitor, caraphenol A, cyclosporine H could overcome IFITM3 antiviral activity and enhance the transduction of stem cells.^49,60
–62

VSV G was recently reported to be downregulated by human MARCH8 (hMARCH8).⁶³ MARCH8 belongs to the MARCH (membrane-associated RING-CH) family, which were first discovered in virus as E3 ubiquitin (Ub) ligases and downregulated MHC class I molecule (MHC I).^64,65 Mammalian MARCH proteins were subsequently shown to modulate plasma membrane proteins turnover.^66

–70 For example, cell surface MHC I, MHC II, CD44, and CD98 were reduced by hMARCH8.^{66,67,71
–73}

MARCH8 was shown to inhibit the incorporation of HIV-1 Env and VSV G into viral particles.⁶³ A recent report demonstrated that MARCH8 targeted HIV-1 Env and VSV G by two different mechanisms: MARCH8 downregulated HIV-1 Env from cell surface through tyrosine motif-dependent pathway, while induced VSV G lysosome degradation by ubiquitination-dependent pathway.⁷⁴ In this study, we report that hMARCH8 inhibits lentiviral vector transduction through downregulating VSV G expression, and knockout of hMARCH8 in virus-producing cells enhances lentiviral vector transduction efficiency. Furthermore, we engineered the hMARCH8-resistant VSV G mutant V5R, which enhances transduction efficiency of lentiviral vector. Our findings thus provide one tool to further advance the clinical application of lentiviral vectors.

Materials and Methods

Cells

293T cells and HeLa cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS; Gibco), 1% penicillin (100 U/mL) and streptomycin (100 μg/mL) (Solarbio). SupT1 cells and THP1 cells were cultured in complete RPMI 1640 supplemented with 10% FBS (Gibco). Peripheral blood mononuclear cells (PBMCs) isolated from healthy donors were purchased from AllCells (Shanghai, China), and cultured in RPMI 1640 media containing 10% FBS (Gibco). Frozen granulocyte colony stimulating factor-mobilized peripheral blood (mPB) CD34⁺ cells were purchased from AllCells (Shanghai, China). This research is exempt from approval to allow use for research purposes only. mPB-CD34⁺ cells were cultured in StemSpan™ SFEM II (STEMCELL), supplemented with recombinant human cytokines thrombopoietin, Flt3L, IL3, and stem cell factor (STEMCELL). hMARCH8 knockout 293T cells were created using the CRISPR-Cas9 system. 293T cells were transfected with lentiCRISPR v2 (Addgene) control vector or CRISPR-Cas9 carrying guide RNAs that target hMARCH8 (g1, GTAAGACCAAAGAAAAGGAG; g3, GTGCGAGAGAAGGAGGACAC), followed by selection with puromycin (0.6 μg/mL; Sigma-Aldrich). Pools of puromycin-resistant cells were diluted and plated in 96-well plates to obtain single-cell clones. The genotype of knockout clones was confirmed by sequencing.

Plasmids and antibodies

The cDNAs of hMARCH8 and W114A mutant, pLenti-GFP (green fluorescent protein) were kindly provided by Dr. Zhaohui Qian.⁷⁵ Nine different Ub expression plasmids were obtained from Addgene. Lysine mutants of VSV G were generated with KOD-Plus-Mutagenesis Kit (TOYOBO). Plasmid DNA was transfected into cells using polyethyleneimine (Sigma-Aldrich) in accordance with the manufacturer's instruction. The following antibodies were used in this study: anti-VSV G (V5507; Sigma-Aldrich), anti-Flag antibody (F3165; Sigma-Aldrich), anti-β-actin (A1978; Sigma-Aldrich), anti-p24 (11695-RP01; Sino Biological), anti-MARCH8 (14119-1-AP; Proteintech), anti-HA tag (hemagglutinin tag) (H6908; Sigma-Aldrich), and anti-GFP (50430-2-AP; Proteintech).

Viral vector production and transduction

293T cells were seeded in 10-cm dishes in DMEM with 10% FBS, then transfected with 3:3:1 of psPAX2 encoding the structural polyproteins Gag-Pol, pLenti-GFP containing the GFP and luciferase reporters, and pMD.G encoding VSV G envelope, in the presence or absence of hMARCH8. After 48 h, supernatants were clarified by centrifugation, passed through a 0.45 μm filter, and measured with p24-antigen capture enzyme-linked immunosorbent assay (ELISA). Cells were transduced with 10 ng of p24 antigen of hMARCH8-expressing lentiviral vector or the control vector for 72 h, and then harvested for luciferase assay and flow cytometry. The relative luciferase activities were determined using a Luciferase Assay System (Promega) in a Modulus Microplate Reader (Turner Biosystems). GFP signal was determined with FACS Canto II (BD).

Flow cytometry

Cells transfected with VSV G and hMARCH8 or control vector were suspended in phosphate-buffered saline containing 1% paraformaldehyde (Solarbio), permeabilized with 0.1% Triton X-100, and immunostained with the antibody against VSV G (Sigma-Aldrich), followed by incubation with anti-mouse Alexa Fluor^® 488-conjugated antibody (Thermo Scientific). VSV G expression was analyzed with FACS Canto II (BD).

Immunofluorescence staining and confocal microscopy

HeLa cells transfected with VSV G and Flag-hMARCH8 or control vector were fixed in 4% paraformaldehyde, and permeabilized with 0.1% Triton X-100 for 10 min. Then cells were stained with anti-VSV G antibody (Sigma-Aldrich) and anti-Flag antibody (Sigma-Aldrich) for 1 h, followed by incubation with anti-mouse IgG conjugated with Alexa Fluor 488 (Thermo Scientific), and anti-rabbit IgG conjugated with Alexa Fluor 594 (Thermo Scientific). Nuclei were stained by DAPI. A Leica TCS SP5 inverted microscope (Leica Microsystems) were used to acquire images.

Western blotting and immunoprecipitation

Western blotting was performed as described previously.⁷⁶ Cells were lysed in RIPA buffer containing 25 mM Tris/HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.25% sodium deoxycholate, and a proteinase inhibitor cocktail (Sigma-Aldrich). After centrifugation, proteins in lysates were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred onto the nitrocellulose membranes (Millipore). Membranes were probed with indicated antibodies, followed by incubation with IRDye secondary antibodies (Li-Cor). Then membranes were scanned with Odyssey Infrared Imaging System (Li-Cor).

For immunoprecipitation and ubiquitination assay, 293T cells in 10-cm dishes were transfected with 2 μg HA-Ub, 3 μg VSV G, and 1 μg hMARCH8 or W114A mutant. After 48 h, cells were harvested and lysed in RIPA buffer. After clarification with centrifugation, cell lysates were incubated with anti-VSV G Ab and Dynabeads™ magnetic beads (Invitrogen) at 4°C for 4 h. After washing with RIPA buffer, immunoprecipitates were denatured by heating in RIPA buffer containing 1% SDS for 5 min. The elutes were diluted with RIPA buffer and reimmunoprecipitated with anti-VSV G Ab and Dynabeads magnetic beads. After extensive wash, agarose was boiled in SDS-PAGE sample buffer, and samples were analyzed by Western blotting as described above.

BlaM-Vpr assay

BlaM-Vpr pseudoviral particle fusion assay was performed as previously described.^77,78 In brief, cells were transfected with VSV G, psPAX2, and BlaM-Vpr. Forty-eight hours after transfection, 293T cells were incubated with BlaM-Vpr pseudoviral particles for 8 h, and then loaded with CCF2-AM substrate (Invitrogen) for 2 h according to the manufacturer's instruction. Following substrate loading, cells were collected for flow cytometry analysis.

Statistical analysis

All data were analyzed using Microsoft Excel or GraphPad Prism 5. Statistical significance was determined by Student's t-test, *p < 0.05; **p < 0.01.

Results

hMARCH8 affects VSV G levels and diminishes the transduction efficiency of lentiviral vectors

VSV G is an essential component of the lentiviral vector system, and is critical for the transduction efficiency of lentiviral vectors. Consistent with the previous report,^63,74 VSV G was downregulated by hMARCH8 in a dose-dependent manner, no effect was observed for GFP (Fig. 1A). Immunofluorescence imaging of VSV G further showed that VSV G expression was decreased in hMARCH8-expressing cells (Fig. 1B), which was confirmed by flow cytometry analysis of VSV G levels (Fig. 1C). Given that hMARCH8 reduces VSV G levels, we tested whether hMARCH8 diminishes the transduction efficiency of lentiviral vector by producing VSV G-pseudotyped lentiviruses from 293T cells that transiently expressing hMARCH8. As shown in Fig. 1D, levels of VSV G in virus-producing cells and in the progeny viruses decreased as a result of hMARCH8 expression (Supplementary Fig. S1A), with similar levels of viral p24 proteins as shown by the result of p24-antigen capture ELISA (Fig. 1E and Supplementary Fig. S1B). 293T cells and SupT1 cells were transduced with lentiviral vector of the same viral p24 amounts, and transduction efficiency was evaluated with luciferase assay and flow cytometry. The results showed that hMARCH8 strongly inhibited lentiviral vector transduction of 293T (Fig. 1F, G) and SupT1 cells (Fig. 1H, I) in a dose-dependent manner (Supplementary Fig. S1C–F). The lowest dose of hMARCH8 DNA (0.05 μg) already diminished the transduction efficiency by 70% (Supplementary Fig. S1), consistent with previous report that hMARCH8 profoundly reduced infectivity of VSV G pseudotyped virus.⁶³ This decrease of transduction was caused by the inhibition of VSV G expression and impaired incorporation into virions in MARCH8-expressing producer cells.

Figure 1.

hMARCH8 reduces VSV G expression. (A) 293T cells were transfected with 200 ng VSV G, 100 ng GFP, and increasing amounts of hMARCH8 or the vector DNA (pCDNA3.1). Forty-eight hours posttransfection, immunoblotting was performed with anti-VSV G, anti-GFP, anti-Flag antibody, and anti-actin as a loading control. (B) HeLa cells were transfected with VSV G, together with control vector (pCDNA3.1) or hMARCH8 for 24 h. After fixation and permeabilization, cells were stained with anti-VSV G antibody (green) and anti-Flag antibody (red). Nuclei were stained by DAPI. Images were acquired with a confocal microscope (scale bars: 10 μm). Asterisk indicated hMARCH8-transfected cells. (C) 293T cells were transfected with VSV G, together with hMARCH8 or the vector DNA for 48 h. After fixation and permeabilization, cells were stained with the antibody against VSV G, and analyzed by flow cytometry. The results of flow cytometry in three independent experiments were summarized in the bar graphs. (D) 293T cells were transfected with VSV G, psPAX2, and lenti-GFP, together with hMARCH8. Forty-eight hours posttransfection, lentiviral particles were concentrated through a sucrose cushion by ultracentrifugation. (E) Virion production was analyzed by p24 antigen capture ELISA. (F–I) 293T cells (F, G) and SupT1 cells (H, I) were transduced with lentiviral vectors produced in (D) for 72 h. Transduction efficiency was determined with luciferase activity assay (F, H) and flow cytometry (G, I). Con, control vector. Data were acquired from three independent experiments, and shown as mean ± SD. Statistical significance was determined by the Student's t-test, **p < 0.01. ELISA, enzyme-linked immunosorbent assay; GFP, green fluorescent protein; hMARCH8, human MARCH8; MARCH, membrane-associated RING-CH; SD, standard deviation; VSV G, vesicular stomatitis virus-G envelope glycoprotein.

Knockout of hMARCH8 in virus-producing cells enhances the transduction property of lentiviral vector

We next created hMARCH8-knockout 293T cells using CRISPR-Cas9 and investigated the effect of endogenous hMARCH8 on the transduction activity of lentiviral vectors. The genotype of knockout clones was analyzed by sequencing (Supplementary Fig. S2A). VSV G-pseudotyped lentiviruses were produced in hMARCH8-knockout 293T cells. As shown in Fig. 2A, the expression of MARCH8 was depleted in hMARCH8-knockout 293T cells, and the level of VSV G increased. hMARCH8 knockout did not affect virus production (Fig. 2B). Results of luciferase assay showed that knockout of hMARCH8 in virus-producing cells enhanced the transduction efficiency of lentiviral vectors in different cell types, including 293T cells (Fig. 2C), SupT1 cells (Fig. 2D), THP1 cells (Fig. 2E), PBMCs (Fig. 2F), and human mPB-CD34⁺ cells (Fig. 2G) by twofold to fourfold. The enhancement of transduction efficiency using hMARCH8-knockout cells was still observed with exogenous hMARCH8 expression (Supplementary Fig. S2B–D). Together, these data support the inhibitory effect of hMARCH8 on VSV G levels and the transduction property of lentiviral vectors.

Figure 2.

Knockout of hMARCH8 in virus-producing cells enhances the transduction efficiency of lentiviral particles. (A) MARCH8-knockout 293T cells were transfected with VSV G, psPAX2 and lenti-GFP. Representative Western blotting images of virion pellets and cell lysates are shown (Con, control CRISPR-Cas9 vector; MARg1 and MARg3, CRISPR-Cas9 carrying guide RNAs targeting hMARCH8). VSV G band intensities normalized by p24 were measured with ImageJ. Data of mean ± SD from three independent experiments were shown in histograms. (B) Virion production was analyzed by p24 antigen capture ELISA. (C–G) 293T cells (C), SupT1 cells (D), THP1 (E), PBMCs (F), and human mPB-CD34⁺ cells (G) were transduced with lentiviral vector produced in (A). Transduction efficiency was determined by measuring luciferase activity. Relative transduction efficiency was normalized to that of the control cells arbitrarily set as 100. Data from three biological independent experiments are shown as mean ± SD. Statistical significance was determined by the Student's t-test, **p < 0.01. mPB, mobilized peripheral blood; PBMC, peripheral blood mononuclear cell.

hMARCH8 induces ubiquitination and lysosome degradation of VSV G

MARCH8 downregulates several immunomodulatory proteins, such as MHC II, CD44, CD88, and CD98, through the proteasome or lysosome pathway via ubiquitination of the target proteins.^{66,67,71
–73} To determine which degradation pathway hMARCH8 uses to degrade VSV G, we treated hMARCH8 and VSV G transfected cells with proteasome inhibitor MG132 or the lysosome inhibitor chloroquine (CQ). CQ but not MG132 inhibited degradation of VSV G by ectopic hMARCH8 (Fig. 3A) and endogenous hMARCH8 (Fig. 3B), indicating that hMARCH8-mediated degradation of VSV G depends on the lysosome pathway. hMARCH8 is an E3 ubiquitin ligase, and its W114A mutant loses the E3 ligase activity. When hMARCH8 or its W114A mutant DNA was transfected into HeLa cells together with VSV G, results of Western blotting and immunofluorescence imaging showed that VSV G was downregulated by wild-type hMARCH8 but not by the W114A mutant (Fig. 3C, D), supporting the critical role of the E3 ligase activity of hMARCH8 in VSV G degradation. Immunoprecipitation assay showed that ubiquitination of VSV G was caused by hMARCH8, not W114A mutant (Fig. 3E), consistent with a recent report.⁷⁴ Since different types of polyubiquitination occur to protein substrates, we investigated which type of ubiquitination hMARCH8 adds to VSV G. MARCH8, VSV G, and wild-type ubiquitin, or ubiquitin mutants each has only one lysine (K6, K11, K27, K29, K33, K48, K63), or K0, which has no lysine transfected in 293T cells. Then VSV G was immunoprecipitated and ubiquitin was probed with HA antibody. As shown in Fig. 3F, hMARCH8 mainly induced K27-linked ubiquitination of VSV G. Then ubiquitination assay was performed in hMARCH8 knockout 293T cells, and the results showed that ubiquitination of VSV G was decreased in hMARCH8 knockout cells (Fig. 3G), indicating ubiquitination of VSV G by endogenous hMARCH8. Together, these results demonstrate that hMARCH8 causes K27-linked ubiquitination and lysosome degradation of VSV G.

Figure 3.

hMARCH8 causes ubiquitination and lysosome degradation of VSV G. (A) 293T cells were transfected with VSV G, GFP, together with increasing hMARCH8. Cells were then treated with the proteasome inhibitor MG132 for 16 h or the lysosome inhibitor CQ for 8 h. VSV G expression was analyzed by Western blotting. (B) 293T cells were transfected with 5, 10, 20, 40, 60, and 80 ng VSV G DNA, and then treated with CQ for 8 h. VSV G expression was analyzed by Western blotting. VSV G band intensities were measured with ImageJ. Data of mean ± SD from five independent experiments were shown in histograms. (C) 293T cells were transfected with VSV G, together with increasing amounts of hMARCH8 or the W114A mutant. VSV G expression was analyzed by Western blotting. VSV G band intensities were measured with ImageJ. Data of mean ± SD from three independent experiments were shown in histograms. (D) Indirect immunofluorescence analysis of HeLa cells transfected with VSV G (anti-VSV G, green), together with Flag-MARCH8 or W114A mutant (anti-Flag, red). Nuclei were stained by DAPI (blue). Scale bars: 10 μm. Asterisk indicated hMARCH8 transfected cells. The VSV G fluorescence intensity in hMARCH8- or W114A-positive cells was normalized by the signals in the negative cells and shown in histograms. (E) 293T cells were transfected with VSV G, HA-tagged Ub, together with hMARCH8 or the W114A mutant. Protein was harvested and immunoprecipitated with anti-VSV G antibodies and further analyzed by Western blotting with anti-HA antibody. (F) 293T cells were transfected with 0.5 μg Flag-MARCH8 and 2 μg HA-tagged ubiquitin or the indicated Ub mutants, together with 3 μg VSV G for 48 h. CQ was added 8 h before harvesting cells. Cell lysates were immunoprecipitated with anti-VSV G antibody and subject to Western blotting with anti-HA antibody. (G) hMARCH8-knockout 293T cells (MARg1, MARg3) were transfected with VSV G and HA-Ub DNA. CQ was added 8 h before harvesting cells. Lysates were immunoprecipitated with anti-VSV G antibody and immunoblotted with anti-HA antibody. Data from three biological independent experiments are shown as mean ± SD. Statistical significance was determined by the Student's t-test, *p < 0.05; **p < 0.01. CQ, chloroquine; HA, anti-HA tag (hemagglutinin tag); Ub, ubiquitin.

Ubiquitination of VSV G occurs to the five lysine residues in the cytoplasmic region

Since the ubiquitin chain is attached to lysines exposed to the cytoplasm, we mutated the five lysine residues in the cytoplasmic region of VSV G, either individually or in combinations (Fig. 4A). The results showed that hMARCH8 still drastically downregulated the 491R, 493R, 496R, 497R, and 511R VSV G mutants, whereas moderately decreased the V4R mutant (491R/493R/496R/497R) (Fig. 4B). The V5R (491R/493R/496R/497R/511R) mutant completely resisted hMARCH8 degradation (Fig. 4B, C). Immunofluorescence (Fig. 4D) and flow cytometry analysis (Fig. 4F) confirmed that VSV G expression was reduced by hMARCH8, while expression of V5R was not affected. Furthermore, the V5R VSV G mutant was refractory to hMARCH8-mediated ubiquitination (Fig. 4E).

Figure 4.

hMARCH8 causes VSV G ubiquitination at five lysines in the cytoplasmic region. (A) Schematic representation of lysine substitution mutations. (B) 293T cells were transfected with VSV G or its mutants, GFP, together with increasing amounts of MARCH8 DNA. VSV G expression was analyzed by Western blotting. (C) 293T cells were transfected with VSV G or V5R, GFP, together with increasing amounts of MARCH8 DNA. VSV G expression was analyzed by Western blotting. VSV G band intensities were measured with ImageJ. Data of mean ± SD from three independent experiments were shown in histograms. (D) Indirect immunofluorescence analysis of HeLa cells transfected with VSV G or V5R (anti-VSV G, green), together with Flag-MARCH8 or the W114A mutant (anti-Flag, red). Nuclei were stained by DAPI (blue). Scale bars: 10 μm. The VSV G/V5R fluorescence intensity in hMARCH8 or W114A-positive cells was normalized by negative cells and shown in histograms. (E) 293T cells were transfected with VSV G WT or its mutants, HA-Ub, and hMARCH8. Cell lysates were immunoprecipitated with anti-VSV G antibody and immunoblotted with anti-HA antibody. (F) 293T cells were transfected with VSV G or V5R, together with Flag-MARCH8 or the W114A mutant DNA. VSV G and V5R expression was analyzed by flow cytometry. The results of flow cytometry in three independent experiments were summarized in the bar graphs. Data from three biological independent experiments are shown as mean ± SD. Statistical significance was determined by the Student's t-test, **p < 0.01.

VSV G mutant V5R resists hMARCH8-mediated impairment of lentiviral vector transduction

Since the V5R mutant was resistant to degradation by hMARCH8, we asked whether V5R allows the production of hMARCH8-resistant lentiviral vectors from hMARCH8-expressing cell. We therefore produced VSV G or V5R-pseudotyped lentiviruses from 293T cells transiently expressing hMARCH8. Levels of VSV G in cell lysates and virions dramatically decreased by hMARCH8, whereas no such effect was observed for V5R (Fig. 5A). Results of p24-antigen ELISA assay showed that hMARCH8 did not affect the virion production (Fig. 5B). Results of luciferase assay showed that hMARCH8 in producer cells reduced VSV G levels and the transduction efficiency of VSV G-pseudotyped lentiviral vector (Fig. 5C, D). In contrast, transduction by the V5R-pseudotyped lentivirus was not affected by hMARCH8 (Fig. 5C, D). These results indicate that the V5R VSV G mutant resists hMARCH8-mediated inhibition of lentiviral vector transduction, consistent with this recent report showing that virus pseudotyped with VSV G K/R mutant was resistant to MARCH8.⁷⁴

Figure 5.

V5R resists hMARCH8-mediated impairment of lentiviral vector transduction. (A) 293T cells were transfected with VSV G or V5R, psPAX2, and lenti-GFP, together with increasing amounts of hMARCH8 DNA. Representative Western blot images of virions and cell lysates are shown. (B) Virion production was analyzed by p24 antigen capture ELISA. (C, D) 293T cells (C) and SupT1 cells (D) were transduced with lentiviral vector produced in (A). Transduction efficiency was determined by luciferase assay. Relative transduction efficiency was normalized to VSV G transfected control cells. Data from three biological independent experiments are shown as mean ± SD. Statistical significance was determined by the Student's t-test, **p < 0.01.

The V5R mutant produces lentiviral vectors of higher transduction efficiency than VSV G

Finally, we assessed whether the V5R mutant is superior to VSV G in producing more efficient lentiviral vectors. We thus produced VSV G, V4R, or V5R-pseudotyped lentiviruses by transfecting 293T cells. The levels of V4R and V5R were moderately higher than VSV G in virus particles, while p24 levels were the same (Fig. 6A, B). Results of transduction experiments showed that lentiviral vectors bearing V4R or V5R exhibited higher transduction efficiency in 293T cells (Fig. 6C), SupT1 cells (Fig. 6D), THP1 cells (Fig. 6E), PBMCs (Fig. 6F), and mPB-CD34⁺ cells (Fig. 6G), compared to lentiviral vector having VSV G. BlaM-Vpr assay showed that V4R or V5R allows a better entry of lentiviral vectors than VSV G (Fig. 6H). These data support the advantage of using VSV G variant to enhance the transduction efficiency of lentiviral vectors.

Figure 6.

Transduction with lentiviral particles carrying VSV G mutant. (A) 293T cells were transfected with VSV G, V4R, or V5R, together with psPAX2 and lenti-GFP. Representative Western blot images of virions and cell lysates are shown. VSV G band intensities were measured with ImageJ. Data of mean ± SD from three independent experiments were shown in histograms. (B) Virion production was analyzed by p24 antigen capture ELISA. (C–G) 293T cells (C), SupT1 cells (D), THP1 cells (E), PBMCs (F), and mPB-CD34⁺ cells (G) were transduced with lentiviral vectors produced in (A). Transduction efficiency was determined by luciferase assay. Relative transduction efficiency as calculated with that of the VSV G-transfected cells arbitrarily set as 100. (H) 293T cells were transduced with lentivial particles carrying BlaM and VSV G, V4R, or V5R. Cells were loaded with CCF2-AM substrate, and virus entry was detected by flow cytometry. Data from three biological independent experiments are shown as mean ± SD. Statistical significance was determined by the Student's t-test, *p < 0.05; **p < 0.01.

Discussion

The VSV G is one of the few viral envelope proteins commonly used in lentiviral vector system. The E3 ubiquitin ligase hMARCH8 has been shown to reduce the infectivity of VSV G-pseudotyped viruses by downregulating VSV G expression.⁶³ We found that even a low level of hMARCH8 expression already profoundly reduces VSV G expression. Consistent with recent report showing that MARCH8 induces VSV G ubiquitination and downregulation,⁷⁴ we found hMARCH8 specifically induces K27-linked ubiquitination of VSV G and causes lysosome-dependent degradation of VSV G. Importantly, we engineered the VSV G mutant V5R, which has the five lysine residues in the cytoplasmic region of VSV G substituted for arginines, and this mutant resists hMARCH8-mediated ubiquitination and degradation, thus increases the transduction efficiency of lentiviral vectors without the need of depleting hMARCH8. Our data thus provide one strategy to increase the transduction efficiency of lentiviral vectors.

The relatively low transduction efficiency of unstimulated T cells, B cells, and HSCs has limited the application of lentiviral vectors in gene therapy, and in the meantime inspired efforts to discover solutions. For example, efficient transduction of these important target cell types has been attempted by preparation of lentivirus of high purity, transduction at high MOIs, sequential transductions, and prolonged ex vivo culture.^38,79
–81 Other strategies include the use of chimeric glycoproteins fused to ligands, IgG, or single-chain variable fragments, and the use of adjuvants including polycations or cationic liposomes.^{55
–57,82

–85} Alternatively, small molecules have been tested to overcome the intrinsic immune restriction factors that deter the transduction of lentiviral vectors. These include mTOR inhibitor rapamycin, the IFITM3-modulating cyclosporine, and caraphenol A, which have been shown to improve transduction through reducing the expression of antiviral effector IFITM3.^49,60
–62

However, some of these strategies raise safety concerns because they require treatment of the targeting cells, which are to be transfused back to the patients. Although whether it will help overcome the several cell-intrinsic barriers to transduction (such as IFITM3) need to be investigated, our study provides a new strategy to increase the transduction efficiency of lentiviral vectors through modifying viral envelope protein VSV G that is used to pseudotype lentiviral particles, thus avoiding manipulation of targeting cells. This strategy can be implemented using MARCH8-knockout cells to produce lentiviral particles, and/or using the MARCH8-resistant VSV G variant that was generated in this study. Since MARCH8 not only targets and degrades VSV G but also other viral envelopes that have been used in pseudotyping lentiviral particles or other viral gene delivery vectors, the MARCH8-knockout cells are recommended for producing different viral vectors of high titers. It is also worthwhile considering to develop other MARCH8-resistant viral envelopes that can be used to improve the efficiency of gene delivery.

Footnotes

Authors' Contributions

F.G., C.L., F.X., and X.L. conceived and designed the study. F.X., X.L., D.Z., F.Z., Z.F., S.H., S.M., Y.H., H.S., L.W., and L.G. performed the experiments. F.G., C.L., S.C., and J.W. discussed the results. F.G., C.L., and F.X. composed the article. All authors read and approved the final article.

Acknowledgments

We thank Dr. Zhaohui Qian for providing hMARCH8 DNAs and Dr. Conghui Wang for technical assistance in performing flow cytometry.

Author Disclosure

F.G., F.X., and X.L. are inventors on pending and issued patents on lentiviral vector technology and gene transfer. The other authors declare no competing interests.

Funding Information

This work was supported by funds from the National Key Plan for Scientific Research and Development of China (2018YFE0107600, 2016YFD0500307, and 2020YFA0707600), from the Ministry of Science and Technology of China (2018ZX10301408-003, 2018ZX10731101-001-018), from the National Natural Science Foundation of China (82072288, 81401673), from the CAMS Innovation Fund for Medical Sciences (CIFMS 2018-I2M-3-004, CIFMS 2020-I2M-2-014), from the Canadian Institutes of Health Research (CCI-132561), and from the CAMS general fund (2019-RC-HL-012).

Supplementary Material

Supplementary Figure S1

Supplementary Figure S2

References

Bukrinsky

, Haggerty

, Dempsey

, et al. A nuclear localization signal within HIV-1 matrix protein that governs infection of non-dividing cells. Nature, 1993; 365:666–669.

Freed

, Martin

. HIV-1 infection of non-dividing cells. Nature, 1994; 369:107–108.

Thomas

, Ehrhardt

, Kay

. Progress and problems with the use of viral vectors for gene therapy. Nat Rev Genet, 2003; 4:346–358.

Naldini

, Blomer

, Gallay

, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science, 1996; 272:263–267.

Naldini

. Lentiviruses as gene transfer agents for delivery to non-dividing cells. Curr Opin Biotech, 1998; 9:457–463.

Naldini

, Blomer

, Gage

, et al. Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc Natl Acad Sci U S A, 1996; 93:11382–11388.

Naldini

. Gene therapy returns to centre stage. Nature, 2015; 526:351–360.

Biasco

, Baricordi

, Aiuti

. Retroviral integrations in gene therapy trials. Mol Ther, 2012; 20:709–716.

Biasco

, Pellin

, Scala

, et al. In vivo tracking of human hematopoiesis reveals patterns of clonal dynamics during early and steady-state reconstitution phases. Cell Stem Cell, 2016; 19:107–119.

10.

Sakuma

, Barry

, Ikeda

. Lentiviral vectors: basic to translational. Biochem J, 2012; 443:603–618.

11.

Nayak

, Herzog

. Progress and prospects: immune responses to viral vectors. Gene Ther, 2010; 17:295–304.

12.

McGarrity

, Hoyah

, Winemiller

, et al. Patient monitoring and follow-up in lentiviral clinical trials. J Gene Med, 2013; 15:78–82.

13.

Cavazzana-Calvo

, Payen

, Negre

, et al. Transfusion independence and HMGA2 activation after gene therapy of human beta-thalassaemia. Nature, 2010; 467:318–322.

14.

Biffi

, Montini

, Lorioli

, et al. Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy. Science, 2013; 341:1233158.

15.

Sessa

, Lorioli

, Fumagalli

, et al. Lentiviral haemopoietic stem-cell gene therapy in early-onset metachromatic leukodystrophy: an ad-hoc analysis of a non-randomised, open-label, phase 1/2 trial. Lancet, 2016; 388:476–487.

16.

Aiuti

, Biasco

, Scaramuzza

, et al. Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Science, 2013; 341:1233151.

17.

Cartier

, Hacein-Bey-Abina

, Bartholomae

, et al. Hematopoietic stem cell gene therapy with a lentiviral vector in X-linked adrenoleukodystrophy. Science, 2009; 326:818–823.

18.

Coleman

, Gern

. Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome. Pediatrics, 2014; 134(Suppl 3):S182–S183.

19.

Doering

, Denning

, Shields

, et al. Preclinical development of a hematopoietic stem and progenitor cell bioengineered factor VIII lentiviral vector gene therapy for hemophilia A. Hum Gene Ther, 2018; 29:1183–1201.

20.

, Li

, Nikolaishvili-Feinberg

, et al. Hematopoietic stem cell transplantation and lentiviral vector-based gene therapy for Krabbe's disease: present convictions and future prospects. J Neurosci Res, 2016; 94:1152–1168.

21.

Lofvall

, Rothe

, Schambach

, et al. Hematopoietic stem cell-targeted neonatal gene therapy with a clinically applicable lentiviral vector corrects osteopetrosis in oc/oc mice. Hum Gene Ther, 2019; 30:1395–1404.

22.

Ungari

, Montepeloso

, Morena

, et al. Design of a regulated lentiviral vector for hematopoietic stem cell gene therapy of globoid cell leukodystrophy. Mol Ther Methods Clin Dev, 2015; 2:15038.

23.

Wagemaker

. Lentiviral hematopoietic stem cell gene therapy in inherited metabolic disorders. Hum Gene Ther, 2014; 25:862–865.

24.

Bobisse

, Rondina

, Merlo

, et al. Reprogramming T lymphocytes for melanoma adoptive immunotherapy by T-cell receptor gene transfer with lentiviral vectors. Cancer Res, 2009; 69:9385–9394.

25.

Maude

, Frey

, Shaw

, et al. Chimeric antigen receptor T cells for sustained remissions in leukemia. N Engl J Med, 2014; 371:1507–1517.

26.

Turtle

, Hanafi

, Berger

, et al. CD19 CAR-T cells of defined CD4+:CD8+ composition in adult B cell ALL patients. J Clin Invest, 2016; 126:2123–2138.

27.

Sauter

, Riviere

, Bernal

, et al. Phase I trial of 19–28z chimeric antigen receptor modified T cells (19–28z CAR-T) post-high dose therapy and autologous stem cell transplant (HDT-ASCT) for relapsed and refractory (rel/ref) aggressive B-cell non-Hodgkin lymphoma (B-NHL). J Clin Oncol, 2015; 33:8515.

28.

Kochenderfer

, Somerville

, Lu

, et al. Anti-CD19 CAR T cells administered after low-dose chemotherapy can induce remissions of chemotherapy-refractory diffuse large B-cell lymphoma. Blood, 2014; 124:550.

29.

Schuster

, Svoboda

, Nasta

, et al. Recovery of humoral immunity in patients with durable complete responses following chimeric antigen receptor modified t cells directed against CD19 (CTL019). J Clin Oncol, 2016; 34:7564.

30.

Vannucci

, Lai

, Chiuppesi

, et al. Viral vectors: a look back and ahead on gene transfer technology. New Microbiol, 2013; 36:1–22.

31.

Dull

, Zufferey

, Kelly

, et al. A third-generation lentivirus vector with a conditional packaging system. J Virol, 1998; 72:8463–8471.

32.

Stewart

, Leroux-Carlucci

, Sion

CJM

, et al. Development of inducible EIAV-based lentiviral vector packaging and producer cell lines. Gene Ther, 2009; 16:805–814.

33.

Throm

, Ouma

, Zhou

, et al. Efficient construction of producer cell lines for a SIN lentiviral vector for SCID-X1 gene therapy by concatemeric array transfection. Blood, 2009; 113:5104–5110.

34.

Greene

, Lockey

, Mehta

, et al. Transduction of human CD34(+) repopulating cells with a self-inactivating lentiviral vector for SCID-X1 produced at clinical scale by a stable cell line. Hum Gene Ther Methods, 2012; 23:297–308.

35.

Manceur

, Kim

, Misic

, et al. Scalable lentiviral vector production using stable HEK293SF producer cell lines. Hum Gene Ther Methods, 2017; 28:330–339.

36.

Stewart

, Fong-Wong

, Strickland

, et al. A stable producer cell line for the manufacture of a lentiviral vector for gene therapy of Parkinson's disease. Hum Gene Ther, 2011; 22:357–369.

37.

Finkelshtein

, Werman

, Novick

, et al. LDL receptor and its family members serve as the cellular receptors for vesicular stomatitis virus. Proc Natl Acad Sci U S A, 2013; 110:7306–7311.

38.

Burns

, Friedmann

, Driever

, et al. Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc Natl Acad Sci U S A, 1993; 90:8033–8037.

39.

Cronin

, Zhang

, Reiser

. Altering the tropism of lentiviral vectors through pseudotyping. Curr Gene Ther, 2005; 5:387–398.

40.

Farley

, Iqball

, Smith

, et al. Factors that influence VSV-G pseudotyping and transduction efficiency of lentiviral vectors-in vitro and in vivo implications. J Gene Med, 2007; 9:345–356.

41.

Strappe

, Hampton

, Cachon-Gonzalez

, et al. Delivery of a lentiviral vector in a Pluronic F127 gel to cells of the central nervous system. Eur J Pharm Biopharm, 2005; 61:126–133.

42.

Lamb

Jr. , Bowersock

, Dasgupta

, et al. Engineered drug resistant gammadelta T cells kill glioblastoma cell lines during a chemotherapy challenge: a strategy for combining chemo- and immunotherapy. PLoS One, 2013; 8:e51805.

43.

Goujon

, Riviere

, Jarrosson-Wuilleme

, et al. SIVSM/HIV-2 Vpx proteins promote retroviral escape from a proteasome-dependent restriction pathway present in human dendritic cells. Retrovirology, 2007; 4:2.

44.

Huthoff

, Towers

. Restriction of retroviral replication by APOBEC3G/F and TRIM5alpha. Trends Microbiol, 2008; 16:612–619.

45.

Neil

, Zang

, Bieniasz

. Tetherin inhibits retrovirus release and is antagonized by HIV-1 Vpu. Nature, 2008; 451:425–430.

46.

Van Damme

, Goff

, Katsura

, et al. The interferon-induced protein BST-2 restricts HIV-1 release and is downregulated from the cell surface by the viral Vpu protein. Cell Host Microbe, 2008; 3:245–252.

47.

, Pan

, Rong

, et al. The IFITM proteins inhibit HIV-1 infection. J Virol, 2011; 85:2126–2137.

48.

Amirache

, Levy

, Costa

, et al. Mystery solved: VSV-G-LVs do not allow efficient gene transfer into unstimulated T cells, B cells, and HSCs because they lack the LDL receptor. Blood, 2014; 123:1422–1424.

49.

Ozog

, Timberlake

, Hermann

, et al. Resveratrol trimer enhances gene delivery to hematopoietic stem cells by reducing antiviral restriction at endosomes. Blood, 2019; 134:1298–1311.

50.

Roesch

, OhAinle

, Emerman

. A CRISPR screen for factors regulating SAMHD1 degradation identifies IFITMs as potent inhibitors of lentiviral particle delivery. Retrovirology, 2018; 15:26.

51.

Hornick

, Li

, Oakland

, et al. Human, pig, and mouse interferon-induced transmembrane proteins partially restrict pseudotyped lentiviral vectors. Hum Gene Ther, 2016; 27:354–362.

52.

Shi

, Ozog

, Torbett

, et al. mTOR inhibitors lower an intrinsic barrier to virus infection mediated by IFITM3. Proc Natl Acad Sci U S A, 2018; 115:E10069–E10078.

53.

de Sio

FRS

, Cascio

, Zingale

, et al. Proteasome activity restricts lentiviral gene transfer into hematopoietic stem cells and is down-regulated by cytokines that enhance transduction. Blood, 2006; 107:4257–4265.

54.

Sutton

, Reitsma

, Uchida

, et al. Transduction of human progenitor hematopoietic stem cells by human immunodeficiency virus type 1-based vectors is cell cycle dependent. J Virol, 1999; 73:3649–3660.

55.

Waehler

, Russell

, Curiel

. Engineering targeted viral vectors for gene therapy. Nat Rev Genet, 2007; 8:573–587.

56.

Guibinga

, Hall

, Gordon

, et al. Ligand-modified vesicular stomatitis virus glycoprotein displays a temperature-sensitive intracellular trafficking and virus assembly phenotype. Mol Ther, 2004; 9:76–84.

57.

Kameyama

, Kawabe

, Ito

, et al. Antibody-dependent gene transduction using gammaretroviral and lentiviral vectors pseudotyped with chimeric vesicular stomatitis virus glycoprotein. J Virol Methods, 2008; 153:49–54.

58.

Ailles

, Schmidt

, Santoni de Sio

, et al. Molecular evidence of lentiviral vector-mediated gene transfer into human self-renewing, multi-potent, long-term NOD/SCID repopulating hematopoietic cells. Mol Ther, 2002; 6:615–626.

59.

Mazurier

, Gan

, McKenzie

, et al. Lentivector-mediated clonal tracking reveals intrinsic heterogeneity in the human hematopoietic stem cell compartment and culture-induced stem cell impairment. Blood, 2004; 103:545–552.

60.

Wang

, Sather

, Wang

, et al. Rapamycin relieves lentiviral vector transduction resistance in human and mouse hematopoietic stem cells. Blood, 2014; 124:913–923.

61.

Petrillo

, Thorne

, Unali

, et al. Cyclosporine H overcomes innate immune restrictions to improve lentiviral transduction and gene editing in human hematopoietic stem cells. Cell Stem Cell, 2018; 23:820–832.e9.

62.

Petrillo

, Cesana

, Piras

, et al. Cyclosporin a and rapamycin relieve distinct lentiviral restriction blocks in hematopoietic stem and progenitor cells. Mol Ther, 2015; 23:352–362.

63.

Tada

, Zhang

, Koyama

, et al. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins. Nat Med, 2015; 21:1502–1507.

64.

Ishido

, Wang

, Lee

, et al. Downregulation of major histocompatibility complex class I molecules by Kaposi's sarcoma-associated herpesvirus K3 and K5 proteins. J Virol, 2000; 74:5300–5309.

65.

Coscoy

, Sanchez

, Ganem

. A novel class of herpesvirus-encoded membrane-bound E3 ubiquitin ligases regulates endocytosis of proteins involved in immune recognition. J Cell Biol, 2001; 155:1265–1273.

66.

Bartee

, Mansouri

, Nerenberg

BTH

, et al. Downregulation of major histocompatibility complex class I by human ubiquitin ligases related to viral immune evasion proteins. J Virol, 2004; 78:1109–1120.

67.

Bauer

, Bakke

, Morth

. Overview of the membrane-associated RING-CH (MARCH) E3 ligase family. New Biotechnol, 2017; 38:7–15.

68.

Cho

, Walseng

, Ishido

, et al. Ubiquitination by March-I prevents MHC class II recycling and promotes MHC class II turnover in antigen-presenting cells. Proc Natl Acad Sci U S A, 2015; 112:10449–10454.

69.

De Gassart

, Camosseto

, Thibodeau

, et al. MHC class II stabilization at the surface of human dendritic cells is the result of maturation-dependent MARCH I down-regulation. Proc Natl Acad Sci U S A, 2008; 105:3491–3496.

70.

Walseng

, Furuta

, Bosch

, et al. Ubiquitination regulates MHC class II-peptide complex retention and degradation in dendritic cells. Proc Natl Acad Sci U S A, 2010; 107:20465–20470.

71.

Eyster

, Cole

, Petersen

, et al. MARCH ubiquitin ligases alter the itinerary of clathrin-independent cargo from recycling to degradation. Mol Biol Cell, 2011; 22:3218–3230.

72.

Liu

, Jain

, Guan

, et al. Ubiquitin ligase MARCH 8 cooperates with CD83 to control surface MHC II expression in thymic epithelium and CD4 T cell selection. J Exp Med, 2016; 213:1695–1703.

73.

von Rohrscheidt

, Petrozziello

, Nedjic

, et al. Thymic CD4 T cell selection requires attenuation of March8-mediated MHCII turnover in cortical epithelial cells through CD83. J Exp Med, 2016; 213:1685–1694.

74.

Zhang

, Tada

, Ozono

, et al. MARCH8 inhibits viral infection by two different mechanisms. Elife, 2020; 9:e57763.

75.

, Liu

, Lei

, et al. Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun, 2020; 11:1620.

76.

, Xu

, Hu

, et al. Characterization of the interactions between SIVrcm Vpx and red-capped mangabey SAMHD1. Biochem J, 2015; 468:303–313.

77.

Ingrao

, Majdoul

, Seye

, et al. Concurrent measures of fusion and transduction efficiency of primary CD34+cells with human immunodeficiency virus 1-based lentiviral vectors reveal different effects of transduction enhancers. Hum Gene Ther Methods, 2014; 25:48–56.

78.

Tscherne

, Manicassamy

, Garcia-Sastre

. An enzymatic virus-like particle assay for sensitive detection of virus entry. J Virol Methods, 2010; 163:336–343.

79.

Wurm

, Schambach

, Lindemann

, et al. The influence of semen-derived enhancer of virus infection on the efficiency of retroviral gene transfer. J Gene Med, 2010; 12:137–146.

80.

Anastasov

, Klier

, Koch

, et al. Efficient shRNA delivery into B and T lymphoma cells using lentiviral vector-mediated transfer. J Hematopathol, 2009; 2:9–19.

81.

Castro

, Weiss

, Wiviott

, et al. Optimal conditions for recovery of the human immunodeficiency virus from peripheral-blood mononuclear-cells. J Clin Microbiol, 1988; 26:2371–2376.

82.

Hesse

, Ebbesen

, Kristensen

. Correlation between polyion effect on cell susceptibility to in vitro infection with murine C-type viruses and polyion effect on some membrane-related functions. Intervirology, 1978; 9:173–183.

83.

Hofig

, Barth

, Salomon

, et al. Systematic improvement of lentivirus transduction protocols by antibody fragments fused to VSV-G as envelope glycoprotein. Biomaterials, 2014; 35:4204–4212.

84.

Padmashali

, Andreadis

. Engineering fibrinogen-binding VSV-G envelope for spatially- and cell-controlled lentivirus delivery through fibrin hydrogels. Biomaterials, 2011; 32:3330–3339.

85.

Wang

, Mani

, Sarkar

, et al. Ex vivo gene transfer into hepatocytes. In: Dhawan

, Hughes

, eds. Hepatocyte Transplantation: Methods and Protocols. Totowa, NJ: Humana Press, 2009:117–139.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.88 MB