Protective Effects of Interferon-tau Against Lipopolysaccharide-Induced Embryo Implantation Failure in Pregnant Mice

Abstract

Interferon-tau (IFN-τ), a novel type I interferon, is produced by trophoblast cells in ruminants. Previous studies have confirmed that IFN-τ could induce immunological tolerance in humans and other species. However, there are few reports on whether IFN-τ has a protective effect on embryo implantation failure caused by excessive inflammation at the maternal–fetal interface. In our study, a mouse model of lipopolysaccharide (LPS)-induced implantation failure was successfully established, and we investigated the protective effects of IFN-τ. First, we showed that IFN-τ increased the number of implanted embryos in LPS-treated pregnant mice. Subsequently, quantitative real-time polymerase chain reaction (qPCR) and ELISA results showed that several inflammatory cytokines [IL-1β and tumor necrosis factor-alpha (TNF-α)] whose expression was upregulated by LPS were reversed by IFN-τ treatment. Furthermore, we performed Western blotting and found that IFN-τ restrained the LPS-induced phosphorylation of IκBα and NF-κB p65. Moreover, qPCR and immunohistochemistry analyses showed that IFN-τ decreased the LPS-induced expression of mouse major histocompatibility complex (MHC) class I genes (H-2K and H-2D) in LPS-treated pregnant mice. Taken together, these results suggest that IFN-τ has a protective effect in LPS-induced implantation failure by downregulating MHC class I genes expression and inhibiting the production of inflammatory cytokines.

Introduction

Embryo implantation is one of the most complicated physiological processes in mammalian reproduction; during implantation, a blastocyst adheres to and embeds in the receptive endometrium (Dekel and others 2010; Zhao 2011). Successful embryo implantation depends mostly on the embryo, the receptive maternal endometrium, and their interactions (Rashid and others 2011). However, embryo implantation failure remains a prevalent problem in the reproductive process. Pregnancy failure occurs in nearly half of all cases of human blastocyst implantation, and many cases of early pregnancy failure are believed to be associated with poor uterine receptivity (Plaks and others 2008). Uterine receptivity is a physiological property of the uterus that is tightly controlled by various factors, including hormones, cytokines, adhesion molecules, and cellular immunity (Achache and Revel 2006).

It has been generally accepted that the maternal immune response to embryo implantation shares many similarities with inflammatory responses, whereas excessive fetal–maternal inflammatory response may lead to implantation failure, spontaneous abortion, and preterm birth (Romero and others 2004b). Numerous clinical studies have shown that genital tract microbial infections are associated with an increased incidence of infertility and implantation failure (Cram and others 2002). Lipopolysaccharide (LPS), a bacterial endotoxin with various biological effects, is a major component of the outer membrane of gram-negative bacteria. Toll-like receptor 4 (TLR4) is involved in host immune responses against microbial pathogens and can recognize exogenous molecules such as LPS (Wu and others 2016c; Jiang and others 2017b). TLR4 activation by LPS leads to activation of the NF-κB pathway and eventually promotes the production of inflammatory cytokines [such as IL-1β and tumor necrosis factor-alpha (TNF-α)] in macrophages (Hernandez and others 2016; Jiang and others 2018). Previous reports have indicated that bacterial LPS suppresses blastocyst implantation in mice by increasing the production of inflammatory cytokines at the maternal–fetal interface (Deb and others 2005a, 2005b).

Interferon-tau (IFN-τ) is a novel type I interferon produced by trophoblast cells in ruminants (Pontzer and others 1997; Martal and others 1998; Zhao and others 2016a), and plays a critical role for successful implantation and establishment of pregnancy (Bazer and others 1997; Todd and others 1998). However, it has been reported that IFN-τ has a broad cross-species reactivity in humans and other animals such as mice (Alexenko and others 1999). Intriguingly, treatment of spontaneous abortion mice with recombinant IFN-τ can also reduce embryo mortality (Chaouat and others 1995). Besides, increasing evidence has demonstrated that administration with IFN-τ leads to an anti-inflammatory functional phenotype and induces immunological tolerance in inflammation-related diseases (Soos and others 1995; Bazer and others 2012). However, there are few reports on whether IFN-τ can prevent embryo implantation failure caused by excessive inflammation at the maternal–fetal interface. In this study, we investigated the effect of IFN-τ on embryo implantation using a mouse model of LPS-induced implantation failure and elucidated the possible mechanisms.

Materials and Methods

Reagents

Recombinant ovine IFN-τ (rOvIFN-τ) (>97%, high-performance liquid chromatography purity) was purchased from Creative Bioarray (NY). LPS (Escherichia coli 055:B5) was purchased from Sigma (St. Louis, MO). NF-κB antibodies were purchased from Cell Signaling Technology (Danvers, MA). Anti-mouse H-2K/H-2D antibody was purchased from BioLegend (San Diego, CA). All other chemical reagents were of reagent grade.

Animals and treatment

Kunming mice (8 weeks old, weighing 25 ± 2 g) were obtained from Wuhan Institute of Biological Products Co., Ltd. (Wuhan, China). The mice were housed in a room maintained at 23°C with 60% humidity and had ad libitum access to food and water. All the animal experiments were carried out in strict accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health and approved by the Ethical Committee on Animal Research at Huazhong Agricultural University. The mice were caged overnight at a female:male ratio of 1:1 for mating. Successful mating was confirmed by the presence of a vaginal plug the next morning; if positive, that day was designated day 0.5 of pregnancy. The method for establishing the LPS-induced implantation failure model was described previously (Zhao 2011). In brief, gravid mice were intraperitoneally injected with 100 μL of LPS (4 μg) on day 3 of gestation. Gravid mice were randomly assigned into 4 groups (n = 10):

(1) Control group: These mice received an injection of 100 μL of phosphate-buffered saline (PBS) on day 3 of gestation.

(2) LPS group: Mouse model of implantation failure without drug treatment.

(3 and 4) IFN-τ treatment groups: 6 h after LPS injection, these mice received 3 intraperitoneal injections of 4 or 8 ng/g IFN-τ at 6-h intervals. The IFN-τ doses used in the study were established in our previous studies (Wu and others 2016a).

On day 4.5 of gestation, half of the pregnant mice in each group were euthanized with sodium pentobarbital. The samples of uterus tissue were collected as previously described (Zhang and others 2015). One side of the uterine horns was carefully cleaned of fat tissue, and removed the fetuses by washing with ice-cold PBS. Subsequently, the uterine tissue was obtained and stored at −80°C for quantitative real-time polymerase chain reaction (qPCR) and Western blot analyses. The other side was fixed in 10% formalin for immunohistochemical analysis. The remaining mice were sacrificed on day 7 of gestation, and the number of implanted embryos was calculated.

Immunohistochemical analysis

Sections (4 μm thick) from the uteri were deparaffinized in xylene, rehydrated in a graded alcohol series, and then subjected to antigen retrieval in a microwave oven. To eliminate endogenous peroxidase, the slides were incubated in 0.3% hydrogen peroxide for 5 min. Subsequently, the samples were incubated in 10% normal horse serum for 30 min, followed by incubation with anti-mouse H-2K/H-2D antibody (1:200 dilution) at 4°C overnight. Samples were then incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody at 37°C for 1 h. After staining with diaminobenzidine, images were captured using a light microscope.

Cell culture and treatment

RAW 264.7 murine macrophages were provided by the American Type Culture Collection (ATCC TIB-71™) and cultured in DMEM supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 50 U/mL penicillin, and 50 mg/mL streptomycin. The cells were pretreated with IFN-τ (20 or 40 ng/mL) for 1 h and then stimulated with LPS (0.5 μg/mL) for 24 h. Untreated cells served as controls.

RNA extraction and qPCR analysis

Total RNA was isolated from the uterus and cells with TRIzol reagent (Life Technologies) according to the manufacturer's instructions. Then, cDNA was synthesized by reverse transcription. PCR was performed using the SYBR Green Plus Reagent Kit (Roche, Basel, Switzerland) and an ABI Prism 7500 Sequence Detection System (Applied Biosystems). The primers used for target gene amplification are listed in Table 1. Relative quantification of target gene expression was normalized to GAPDH using the 2^−ΔΔCt comparative method.

Table 1.

Primers Used for Quantitative Real-Time Polymerase Chain Reaction

Name	Primer sequence (5′-3′)	GenBank accession number	Product size (bp)
H-2K	ATACCTGAAGAACGGGAACG	XM_006523680.2	131
H-2K	TGATGTCAGCAGGGTAGAAGC
H-2D	CGGCTATGTGGACAACAAG	NM_010380.3	117
H-2D	GTCTCCCGCTCCCAATAC
TNF-α	CTTCTCATTCCTGCTTGTG	NM_013693.3	198
TNF-α	ACTTGGTGGTTTGCTACG
IL-1β	CCTGGGCTGTCCTGATGAGAG	NM_008361.4	131
IL-1β	TCCACGGGAAAGACACAGGTA
IL-10	TGGGTTGCCAAGCCTTATCG	NM_010548.2	118
IL-10	TTCAGCTTCTCACCCAGGGA
GAPDH	CAATGTGTCCGTCGTGGATCT	NM_001289726.1	124
GAPDH	GTCCTCAGTGTAGCCCAAGATG

TNF-α, tumor necrosis factor alpha.

ELISA analysis

The tissue samples were homogenized in PBS and then centrifuged to collect the supernatants. The cell supernatants were also harvested. The levels of TNF-α, IL-1β, and IL-10 in these supernatants were measured using ELISA kits according to the manufacturer's directions.

Western blot analysis

Total protein was extracted from uterine tissue using radioimmunoprecipitation assay (RIPA) lysis buffer (Biosharp, China). Proteins were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto a PVDF membrane. Subsequently, the membrane was incubated with specific antibodies against phosphorylated NF-κB p65 and β-actin (1:1,000 dilution).

Immunofluorescent detection of NF-κB p65 localization

Macrophages were grown on coverslips overnight and then treated with 0.5 μg/mL LPS alone or with IFN-τ (20 and 40 ng/mL). The cells were fixed in 4% paraformaldehyde for 15 min and then permeabilized with 0.2% Triton X-100 in PBS for 10 min. Nonspecific binding sites were blocked with 5% bovine serum albumin. After incubation with rabbit anti-NF-κB p65 antibody overnight at 4°C, the FITC-conjugated goat anti-rabbit IgG was applied for 30 min at room temperature. Then, the cells were stained with DAPI, and the NF-κB p65 subunit was examined under an inverted fluorescence microscope (Leica, UK).

Statistical analysis

All data are presented as the mean ± SEM. Differences between groups were analyzed by 1-way analysis of variance (ANOVA) using SPSS 15.0. A P-value of <0.05 was considered statistically significant.

Results

Effect of IFN-τ treatment on embryo implantation

The number of implanted embryos in different groups was calculated on day 7 of gestation. As shown in Fig. 1B, LPS significantly reduced the number of implanted embryos compared with the control. However, IFN-τ treatment prevented this reduction in the number of embryos.

FIG. 1.

Effect of IFN-τ on mouse embryo implantation. (A) Implanted embryos in different treatment groups. (B) Analysis of the number of implanted embryos. Data are presented as the mean ± SEM of 3 independent experiments. ^# P < 0.05 versus the control group; **P < 0.01 versus the LPS group. CG, control group; IFN-τ, interferon-tau; LPS, lipopolysaccharide; LPS, LPS-stimulated group.

Effect of IFN-τ treatment on IL-1β, TNF-α, and IL-10 expression in the uterus

The expression of IL-1β, TNF-α and IL-10 in uterine tissue was analyzed by qPCR and ELISA, which showed that IL-1β and TNF-α expression was significantly increased in the LPS group, whereas IL-10 expression was slightly decreased. In contrast, IFN-τ treatment significantly decreased IL-1β and TNF-α levels and promoted IL-10 secretion (Fig. 2).

FIG. 2.

Effect of IFN-τ on cytokine production in uterine tissue. (A) IL-1β, TNF-α, and IL-10 mRNA expression in uterine tissue was measured by qPCR. GAPDH was used as a control. (B) IL-1β, TNF-α, and IL-10 protein levels in uterine tissue were detected by ELISA. Data are presented as the mean ± SEM of 3 independent experiments. ^# P < 0.05 versus the control group; *P < 0.05 and **P < 0.01 versus the LPS group. TNF-α, tumor necrosis factor alpha; qPCR, quantitative real-time polymerase chain reaction.

Effect of IFN-τ treatment on NF-κB p65 levels in uterine tissue

The NF-κB pathway plays a critical role in the production of inflammatory cytokines (Jiang and others 2017c; Zhao and others 2017). Thus, the protein levels of NF-κB p65 and IκBα in the uterus were detected by Western blot. As expected, LPS significantly induced the phosphorylation of p65 and IκBα. However, the levels of phosphorylated p65 and IκBα were dramatically diminished by IFN-τ treatment in a dose-dependent manner (Fig. 3).

FIG. 3.

Effect of IFN-τ on the NF-κB pathway. (A) IκBα and p65 protein levels in the uterus were measured by Western blot. β-actin was used as a control. (B, C) Gray values of the indicated proteins were determined by IPP 6.0 software. Data are presented as the mean ± SEM of 3 independent experiments. ^# P < 0.05 versus the control group; *P < 0.05 and **P < 0.01 versus the LPS group. IPP, image-pro plus.

Effect of IFN-τ treatment on IL-1β, TNF-α, and IL-10 expression in macrophages

IL-1β, TNF-α, and IL-10 expression in macrophages was also measured by qPCR and ELISA. As shown in Fig. 4, the expression of IL-1β and TNF-α was significantly increased in the LPS group compared with the control group. However, IL-10 expression was not influenced significantly by LPS. IFN-τ treatment suppressed the production of IL-1β and TNF-α in a dose-dependent manner and simultaneously enhanced the level of IL-10.

FIG. 4.

Effect of IFN-τ on cellular cytokines levels. (A) IL-1β, TNF-α, and IL-10 mRNA expression in cells was determined by qPCR. GAPDH was used as a control. (B) IL-1β, TNF-α, and IL-10 protein levels in cells were detected by ELISA. Data are presented as the mean ± SEM of 3 independent experiments. ^# P < 0.05 versus the control group; *P < 0.05 and **P < 0.01 versus the LPS group.

Effect of IFN-τ treatment on the nuclear translocation of NF-κB p65 in macrophages

Our results showed that LPS exposure induced the translocation of NF-κB p65 from the cytosol to the nucleus. However, IFN-τ treatment significantly suppressed NF-κB p65 nuclear translocation, consistent with the above results (Fig. 5).

FIG. 5.

Effect of IFN-τ on NF-κB p65 nuclear translocation. RAW 264.7 cells were pretreated with IFN-τ (20 or 40 ng/mL) for 1 h before stimulation with LPS, and NF-κB p65 nuclear translocation was observed with an inverted fluorescence microscope. Color images available online at www.liebertpub.com/jir

Effect of IFN-τ treatment on mouse major histocompatibility complex class I genes expression in the uterus

The expression of mouse major histocompatibility complex (MHC) class I genes (H-2K and H-2D) was measured by qPCR. As shown in Fig. 6, H-2K and H-2D expression was dramatically increased in the LPS group but decreased in the IFN-τ treatment group. Furthermore, immunohistochemistry revealed more intense expression of H-2K/H-2D in the LPS group compared with the control group, and this expression was reduced by IFN-τ treatment. In addition, H-2K/H-2D mainly localized in the uterine glandular epithelium and stroma (Fig. 7).

FIG. 6.

Effect of IFN-τ on MHC class I genes expression in uterine tissue. The expression of MHC class I genes (H-2K and H-2D) was measured by qPCR. GAPDH was used as a control. (A) The expression of H-2K mRNA in uterine tissue. (B) The expression of H-2D mRNA in uterine tissue. Data are presented as the mean ± SEM of 3 independent experiments. ^# P < 0.05 versus the control group; *P < 0.05 and **P < 0.01 versus the LPS group. MHC, major histocompatibility complex.

FIG. 7.

Immunohistochemical analysis of H-2K/H-2D in the uterus. The arrows represent the positive staining for H-2K/H-2D. (A) Control group. (B) LPS-stimulated group. (C) LPS+IFN-τ (4 ng/g) group. (D) LPS+IFN-τ (8 ng/g) group. Magnification = 200 × ; scale bar = 100 μm. ge, glandular epithelium; le, luminal epithelium; s, stroma. Color images available online at www.liebertpub.com/jir

Discussion

A successful or healthy pregnancy requires complex immune regulation in the uterine endometrium, eventually resulting in tolerance of the implanted embryos (Norwitz and others 2001). It has been well established that early pregnancy failure is usually caused by uncontrolled inflammatory responses at the maternal–fetal interface (Clark and others 1998). In such cases, a series of unfavorable factors may propel the uterine immune system toward anti-fetal immune responses. Indeed, microbial infection and other inflammatory stimuli are closely associated with early pregnancy failure in humans (Romero and others 2004a). E. coli is a common pathogenic bacterium that accounts for ∼80% of genital tract infections. Moreover, E. coli has been implicated in abnormal embryo development (Rupasri and others 1995). Thus, the development of effective therapeutics against infection-related pregnancy failure is urgently needed.

IFN-τ shares sequence similarity and functional homology with conventional members of the type I interferons family, such as IFN-α and IFN-β and particularly INF-ω (Jamwal and others 2009; Chon and Bixler 2010). Compared with IFN-α and IFN-β, IFN-τ exhibits very low cytotoxicity even at high dosages, which provides strong evidences for a clinic application of IFN-τ (Pontzer and others 1991). Although IFN-τ is generally recognized as the pregnancy recognition signal in ruminants, it has been reported to induce immunological tolerance in humans and other species. For instance, administration with recombinant IFN-τ decreases fetal resorption in spontaneous abortion mouse models by upregulating IL-10 levels, which prevents inflammatory immunity during gestation (Chaouat and others 1995). Furthermore, recent research has also revealed that IFN-τ alleviates obesity-induced adipose tissue inflammation and spontaneous autoimmune diabetes in mice, and suppresses LPS-induced pneumonia in a mouse model of acute lung injury (Soos and others 2002; Ying and others 2014; Zhao and others 2016b). Our previous studies also demonstrated that IFN-τ alleviates Staphylococcus aureus-induced endometritis (Jiang and others 2017a). However, we are not uncertain whether IFN-τ can block embryo implantation failure caused by excessive inflammation at the maternal–fetal interface. Previous evidence suggested that LPS may change the normal uterine receptivity necessary for embryo implantation and thus induce implantation failure in mice (Deb and others 2005a). Therefore, in the present study, we used LPS to induce embryo implantation failure in mice and investigated the protective effect of IFN-τ on embryo implantation. Our results found that the number of implanted embryos was decreased dramatically after LPS stimulation, but the reduction was prevented by IFN-τ treatment, indicating that IFN-τ has a protective effect on implantation failure.

The immune system balance, especially that of Th1/Th2 cytokines, at the maternal–fetal interface is necessary for successful embryo implantation (Piccinni and others 2001). An increase in the levels of Th2 cytokines (such as IL-10), accompanied by a parallel decrease in the levels of Th1 cytokines (TNF-α), is observed in successful pregnancies (Marzi and others 1996). In addition, IL-1β has also been implicated in embryo implantation, and it can induce the secretion of endometrial leukemia inhibitory factor, which is critical for implantation (Arici and others 1995). The possible mechanism of LPS-induced implantation failure might be due to the production of cytokines by activated macrophages, which enhanced the cytotoxicity of uterine natural killer cells. Priming of macrophages with LPS resulted in the release of proinflammatory cytokines, including IL-1β and TNF-α, which are involved in the delicate immune balance at the maternal–fetal interface (Kauma 2000; Zhong and others 2008). In our study, we found that endometrial IL-1β and TNF-α levels were significantly increased and IL-10 level was slightly decreased in LPS-challenged mice. Uterine macrophages represent a major subset of leukocyte during pregnancy, and its aberrant activity is linked to poor pregnancy outcome (Nagamatsu and Schust 2010). Thus, we also investigated the effect of IFN-τ on macrophages. In the in vitro experiments, IL-1β and TNF-α expression was significantly increased in LPS-stimulated macrophages, which was similar to the in vivo results. Meanwhile, IL-10 expression was not influenced by LPS. The aberrant production of IL-1β and TNF-α might be responsible for the implantation failure. IFN-τ treatment significantly reduced IL-1β and TNF-α levels and promoted IL-10 secretion, ultimately restoring the Th1/Th2 balance. NF-κB is involved in LPS-induced inflammatory responses, and its activation promotes the production of inflammatory cytokines (Wu and others 2016b). Western blot results showed that IFN-τ treatment obviously inhibited the phosphorylation of NF-κB p65. Immunofluorescence analyses demonstrated that IFN-τ treatment suppressed the nuclear translocation of NF-κB p65 in macrophages, in accordance with the Western blot results.

In addition, MHC is considered another important regulatory factor at the maternal–fetal interface, and the formation of MHC can cause immune rejection and be detrimental to pregnancy success. Several lines of evidence suggest that the regulation of MHC class I genes is essential for protecting the embryo from immunological attack (Low and others 1990; Al Naib and others 2011). Past research has also found that IFN-τ could silence the expression of MHC class I genes in the uterus of the pregnant sheep so as to repress maternal immune rejection responses to the conceptus (Choi and others 2001). Some cytokines, such as IFN-γ and IL-1β, have been reported to increase the expression of MHC class I genes (such as RT1-A) during early pregnancy in rats (Sun and others 2005; Xia and others 2006). Thus, we also examined the expression of mouse MHC class I genes (H-2K and H-2D) in the uterus. Intriguingly, our results found that H-2K and H-2D expression was increased by LPS but decreased by IFN-τ. The immunohistochemical results showed the same results. Taken together, we hypothesized that IFN-τ downregulates MHC class I genes expression, perhaps by inhibiting the production of inflammatory cytokines.

In conclusion, our findings demonstrate that IFN-τ has a protective effect in LPS-induced implantation failure by promoting embryo implantation. The possible mechanisms for the protective role of IFN-τ involve inhibiting inflammatory cytokines and MHC class I genes and upregulating IL-10. However, further studies are necessary to elucidate fully the effects and mechanisms of IFN-τ in the context of the complex regulatory network during embryo implantation.

Footnotes

Acknowledgments

We thank American Journal Experts for its linguistic assistance during the preparation of this article. This study was supported by the National Natural Science Foundation of China (No. 31472254 and 31772816).

Author Disclosure Statement

No competing financial interests exist.

References

Achache

, Revel

. 2006. Endometrial receptivity markers, the journey to successful embryo implantation. Hum Reprod Update, 12(6):731–746.

Al Naib

, Mamo

, O'Gorman

, Lonergan

, Swales

, Fair

. 2011. Regulation of non-classical major histocompatability complex class I mRNA expression in bovine embryos. J Reprod Immunol, 91(1–2):31–40.

Alexenko

, Ealy

, Roberts

. 1999. The cross-species antiviral activities of different IFN-tau subtypes on bovine, murine, and human cells: contradictory evidence for therapeutic potential. J Interferon Cytokine Res, 19(12):1335–1341.

Arici

, Engin

, Attar

, Olive

. 1995. Modulation of leukemia inhibitory factor gene expression and protein biosynthesis in human endometrium. J Clin Endocrinol Metab, 80(6):1908–1915.

Bazer

, Kim

, Song

, Ka

, Tekwe

, Wu

. 2012. Select nutrients, progesterone, and interferon tau affect conceptusmetabolism and development. Ann N Y Acad Sci, 1271(1):88–96.

Bazer

, Spencer

, Ott

. 1997. Interferon tau: a novel pregnancy recognition signal. Am J Reprod Immunol, 37(6):412–420.

Chaouat

, Assal Meliani

, Martal

, Raghupathy

, Elliott

, Mosmann

, Wegmann

. 1995. IL-10 prevents naturally occurring fetal loss in the CBA x DBA/2 mating combination, and local defect in IL-10 production in this abortion-prone combination is corrected by in vivo injection of IFN-tau. J Immunol, 154(9):4261–4268.

Choi

, Johnson

, Burghardt

, Berghman

, Joyce

, Taylor

, Stewart

, Bazer

, Spencer

. 2001. Interferon regulatory factor-two restricts expression of interferon-stimulated genes to the endometrial stroma and glandular epithelium of the ovine uterus. Biol Reprod, 65(4):1038–1049.

Chon

, Bixler

. 2010. Interferon-tau: current applications and potential in antiviral therapy. J Interferon Cytokine Res, 30(7):477–485.

10.

Clark

, Chaouat

, Arck

, Mittruecker

, Levy

. 1998. Cytokine-dependent abortion in CBA x DBA/2 mice is mediated by the procoagulant fgl2 prothrombinase [correction of prothombinase]. J Immunol, 160(2):545–549.

11.

Cram

, Zapata

, Toy

, Baker

3rd . 2002. Genitourinary infections and their association with preterm labor. Am Fam Physician, 65(2):241–248.

12.

Deb

, Chaturvedi

, Jaiswal

. 2005a. Gram-negative bacterial LPS induced poor uterine receptivity and implantation failure in mouse: alterations in IL-1beta expression in the preimplantation embryo and uterine horns. Infect Dis Obstet Gynecol, 13(3):125–133.

13.

Deb

, Chaturvedi

, Jaiswal

. 2005b. Role of tumor necrosis factor-α in Gram-negative bacterial lipopolysaccharides induced implantation failure. Reprod Med Biol, 4(1):79–88.

14.

Dekel

, Gnainsky

, Granot

, Mor

. 2010. Inflammation and implantation. Am J Reprod Immunol, 63(1):17–21.

15.

Hernandez

, St Laurent

3rd , Urcuqui-Inchima

. 2016. HIV-1-exposed seronegative individuals show alteration in TLR expression and pro-inflammatory cytokine production ex vivo: an innate immune quiescence status?. Immunol Res, 64(1):280–290.

16.

Jamwal

, Modi

, George

, Chauhan

. 2009. Molecular interactions between Bos taurus interferon-tau1c and human type I interferon receptor. Bioinformation, 4(4):155–157.

17.

Jiang

, Chen

, Zhao

, Wu

, Mi

, Qiu

, Peng

, Deng

. 2017a. IFN-tau plays an anti-inflammatory role in Staphylococcus aureus-induced endometritis in mice through the suppression of NF-kappaB pathway and MMP9 expression. J Interferon Cytokine Res, 37(2):81–89.

18.

Jiang

, Guo

, Zhang

, Yang

, Zhao

, Shaukat

, Wu

, Deng

. 2018. Downregulation of TLR4 by miR-181a provides negative feedback regulation to lipopolysaccharide-induced inflammation. Front Pharmacol, 9:142.

19.

Jiang

, Ma

, Guo

, Zhang

, Zhao

, Wu

, Wang

, Deng

. 2017b. Anti-inflammatory effects of rosmarinic acid in lipopolysaccharide-induced mastitis in mice. Inflammation [Epub ahead of print]; DOI: 10.1007/s10753-017-0700-8.

20.

Jiang

, Zhao

, Deng

, Wu

, Yin

, Chen

, Qiu

, Peng

. 2017c. Polydatin ameliorates Staphylococcus aureus-induced mastitis in mice via inhibiting TLR2-mediated activation of the p38 MAPK/NF-kappaB pathway. Acta Pharmacol Sin, 38(2):211–222.

21.

Kauma

. 2000. Cytokines in implantation. J Reprod Fertil Suppl, 55:31–42.

22.

Low

, Hansen

, Drost

, Gogolin-Ewens

. 1990. Expression of major histocompatibility complex antigens on the bovine placenta. J Reprod Fertil, 90(1):235–243.

23.

Martal

, Chene

, Huynh

, L'Haridon

, Reinaud

, Guillomot

, Charlier

, Charpigny

. 1998. IFN-tau: a novel subtype I IFN1. Structural characteristics, non-ubiquitous expression, structure-function relationships, a pregnancy hormonal embryonic signal and cross-species therapeutic potentialities. Biochimie, 80(8–9):755–777.

24.

Marzi

, Vigano

, Trabattoni

, Villa

, Salvaggio

, Clerici

. 1996. Characterization of type 1 and type 2 cytokine production profile in physiologic and pathologic human pregnancy. Clin Exp Immunol, 106(1):127–133.

25.

Nagamatsu

, Schust

. 2010. The immunomodulatory roles of macrophages at the maternal-fetal interface. Reprod Sci, 17(3):209.

26.

Norwitz

, Schust

, Fisher

. 2001. Implantation and the survival of early pregnancy. N Engl J Med, 345(19):1400–1408.

27.

Piccinni

, Scaletti

, Vultaggio

, Maggi

, Romagnani

. 2001. Defective production of LIF, M-CSF and Th2-type cytokines by T cells at fetomaternal interface is associated with pregnancy loss. J Reprod Immunol, 52(1–2):35–43.

28.

Plaks

, Birnberg

, Berkutzki

, Sela

, BenYashar

, Kalchenko

, Mor

, Keshet

, Dekel

, Neeman

, Jung

. 2008. Uterine DCs are crucial for decidua formation during embryo implantation in mice. J Clin Invest, 118(12):3954–3965.

29.

Pontzer

, Bazer

, Johnson

. 1991. Antiproliferative activity of a pregnancy recognition hormone, ovine trophoblast protein-1. Cancer Res, 51(19):5304–5307.

30.

Pontzer

, Yamamoto

, Bazer

, Ott

, Johnson

. 1997. Potent anti-feline immunodeficiency virus and anti-human immunodeficiency virus effect of IFN-tau. J Immunol, 158(9):4351–4357.

31.

Rashid

, Lalitkumar

, Gemzell-Danielsson

. 2011. Endometrial receptivity and human embryo implantation. Am J Reprod Immunol, 66 Suppl 1:23–30.

32.

Romero

, Chaiworapongsa

, Kuivaniemi

, Tromp

. 2004a. Bacterial vaginosis, the inflammatory response and the risk of preterm birth: a role for genetic epidemiology in the prevention of preterm birth. Am J Obstet Gynecol, 190(6):1509–1519.

33.

Romero

, Espinoza

, Mazor

. 2004b. Can endometrial infection/inflammation explain implantation failure, spontaneous abortion, and preterm birth after in vitro fertilization?. Fertil Steril, 82(4):799.

34.

Rupasri

, Shivakumar

, Sreenath

, Seshagiri

. 1995. Assessment of developmental retardation and abnormality of in vivo produced preimplantation embryos in rat. Indian J Exp Biol, 33(12):911–916.

35.

Soos

, Stüve

, Youssef

, Bravo

, Johnson

, Weiner

, Zamvil

. 2002. Cutting edge: oral type I IFN-tau promotes a Th2 bias and enhances suppression of autoimmune encephalomyelitis by oral glatiramer acetate. J Immunol, 169(5):2231–2235.

36.

Soos

, Subramaniam

, Hobeika

, Schiffenbauer

, Johnson

. 1995. The IFN pregnancy recognition hormone IFN-tau blocks both development and superantigen reactivation of experimental allergic encephalomyelitis without associated toxicity. J Immunol, 155(5):2747–2753.

37.

Sun

, Peng

, Xia

, Yang

, Liu

. 2005. Effect on expression of RT1-A and RT1-DM molecules of treatment with interferon-gamma at the maternal—fetal interface of pregnant rats. Hum Reprod, 20(9):2639–2647.

38.

Todd

, McElveen

, Lamming

. 1998. Ovine trophoblast interferon enhances MHC class I expression by sheep endometrial cells. J Reprod Immunol, 37(2):117–123.

39.

, Zhao

, Jiang

, Chen

, Rui

, Qiu

, Guo

, Deng

. 2016a. IFN-tau alleviates lipopolysaccharide-induced inflammation by suppressing NF-kappaB and MAPKs pathway activation in mice. Inflammation, 39(3):1141–1150.

40.

, Zhao

, Jiang

, Chen

, Zhu

, Qiu

, Li

, Deng

. 2016b. Plantamajoside ameliorates lipopolysaccharide-induced acute lung injury via suppressing NF-kappaB and MAPK activation. Int Immunopharmacol, 35:315–322.

41.

, Zhao

, Jiang

, Li

, Qiu

, Deng

. 2016c. Engeletin alleviates lipopolysaccharide-induced endometritis in mice by inhibiting TLR4-mediated NF-kappaB activation. J Agric Food Chem, 64(31):6171–6178.

42.

Xia

, Peng

, Sun

, Yang

, Liu

. 2006. Effects of IL-1 beta on RT1-A/RT1-DM at the maternal-fetal interface during pregnancy in rats. Front Biosci, 11:2868–2875.

43.

Ying

, Kanameni

, Chang

, Nair

, Safe

, Bazer

, Zhou

. 2014. Interferon tau alleviates obesity-induced adipose tissue inflammation and insulin resistance by regulating macrophage polarization. PLoS One, 9(6):e98835.

44.

Zhang

, Zhang

, Bulbul

, Shan

, Wang

, Yan

. 2015. Baicalin promotes embryo adhesion and implantation by upregulating fucosyltransferase IV (FUT4) via Wnt/beta‐catenin signaling pathway. FEBS Lett, 589(11):1225.

45.

Zhao

, Jiang

, Wu

, Qiu

, Deng

, Peng

. 2017. Polydatin reduces Staphylococcus aureus lipoteichoic acid-induced injury by attenuating reactive oxygen species generation and TLR2-NFkappaB signalling. J Cell Mol Med, 21(11):2796–2808.

46.

Zhao

, Wu

, Jiang

, Chen

, Wang

, Qiu

, Guo

, Deng

. 2016a. The anti-inflammatory effects of interferon tau by suppressing NF-κB/MMP9 in macrophages stimulated with Staphylococcus aureus . J Interferon Cytokine Res, 36(8):516–524.

47.

Zhao

, Wu

, Jiang

, Rui

, Zhu

, Qiu

, Guo

, Deng

. 2016b. IFN-τ inhibits S. aureus-induced inflammation by suppressing the activation of NF-κB and MAPKs in RAW 264.7 cells and mice with pneumonia. Int Immunopharmacol, 35:332–340.

48.

Zhao

. 2011. Protective effects of baicalin on lipopolysaccharide (LPS)-induced implantation failure and the uterine endometrium in mice. Afr J Pharm Pharmacol, 5(14):1661–1668.

49.

Zhong

, Shi

, Ma

, Gong

, Zhai

, Zhang

, Wang

. 2008. Effects of Radix scutellariae and Rhizoma atractylodis on LPS-induced abortion and the uterine IL-10 contents in mice. Am J Chin Med, 36(1):141–148.