Tongfu Lifei Decoction Attenuated Sepsis-Related Intestinal Mucosal Injury Through Regulating Th17/Treg Balance and Modulating Gut Microbiota

Abstract

Intestinal damage and secondary bacterial translocation are caused by the inflammatory response induced by sepsis. Tongfu Lifei (TLF) decoction has a protective effect on sepsis-related gastrointestinal function injury. However, the relation between gut microbiota, immune barrier, and sepsis under the treatment of TLF have not been well clarified yet. Here, rats were subjected to cecal ligation and puncture (CLP) to create a sepsis model. Subsequently, the TLF decoction was given to CLP rats by gavage, fecal microbiota transplantation (FMT), and antibiotic were used as positive control. TLF suppressed the inflammatory response and improved the pathological changes in the intestines of CLP rats. Besides, TLF promoted the balance of the percentage of the Th17 and Treg cells. Intestinal barrier function was also improved by TLF through enhancing ZO-1, and Occludin and Claudin 1 expression, preventing the secondary translocation of other gut microbiota. TLF dramatically boosted the gut microbiota's alpha- and beta-diversity in CLP rats. Moreover, it increased the relative abundance of anti-inflammatory gut microbiota and changed the progress of the glucose metabolism. In short, TLF regulated the gut microbiota to balance the ratio of Th17/Treg cells, reducing the inflammation in serum and intestinal mucosal injury in rats.

Introduction

A systemic inflammatory disease called sepsis is brought on by infection (Haak and Wiersinga, 2017; Salomão et al., 2019), and further development can lead to severe sepsis or even multiple organ dysfunction syndromes (MODS) (Caraballo and Jaimes, 2019). More than 18 million cases of severe sepsis are diagnosed worldwide each year (Shang et al., 2019). Intestinal mucosal barrier dysfunction is crucial in the development and prognosis of sepsis (Rudd et al., 2020; Ziesmann and Marshall, 2018). Patients with sepsis are prone to intestinal barrier damage, which is the driving force behind MODS and can consequently lead to its high morbidity and mortality rate (Chen and Billiar, 2020). The current Western medical intervention strategy lies only in symptomatic treatment and antagonistic therapy (Lu et al., 2017; Tan et al., 2021). Therefore, it is necessary to study and develop drugs to alleviate intestinal mucosal injury of sepsis from a gut microbiota perspective.

In recent years, the doctrine of intestinal bacterial/bacterial endotoxin lipopolysaccharide (LPS) translocation has received increasing attention in the mechanism of sepsis (Panpetch et al., 2020; Wang et al., 2019). Patients with sepsis exhibit a dysfunctional intestinal microbiota, which increases the intestinal epithelial cell barrier's permeability (Shen et al., 2014). A large number of bacteria and LPS enter the blood circulation via the portal system and the mesenteric lymphatic system, leading to the uncontrolled regulation of the inflammatory and immune response of the organism (Huang and Chen, 2016).

Regulation of the Th17/Treg cells balance may have an important role in the protection of the intestinal mucosal immune barrier (Shi et al., 2022). It has been reported that when the intestinal microecology is disturbed, the gut microbiota co-metabolizes with the host and its co-metabolite stimulation can trigger the organism to react and immune response, leading to the production of pro-inflammatory cytokines and causing a tilt of the Th17/Treg balance toward Th17 cells (Hansson, 2012). Therefore, it is very important to study the mechanism of sepsis and drug development from the intestinal mucosal immune barrier (Vancamelbeke and Vermeire, 2017).

Sepsis can be classified as a “warm disease” based on the early manifestations of sepsis characterized by exogenous fever which is consistent with modern medical research that confirms that the displacement of bacteria and toxins in the gastrointestinal tract due to intestinal failure is a major reason for severe sepsis and MODS (Kernbauer et al., 2015).

Tongfu Lifei (TLF) is a kind of traditional Chinese medicine, which exerts protective treatment of sepsis in clinical practice (Lv et al., 2018). In terms of therapeutic effects, it has been shown that high mobility group box-1 and interleukin-10 (IL-10) levels can be considerably reduced and elevated by TLF decoction colon dialysis combined with fiberoptic bronchoscopy alveolar lavage, which inhibits the release of pro-inflammatory molecules, suppressing excessive inflammatory responses (Yang, 2018). The treatment that cleaning the bowels through TLF can improve gastrointestinal dysfunction and promote the recovery of patients. The mechanism is that it can effectively protect the intestinal mucosa, decreasing intestinal permeability, and reducing inflammatory mediators. Our group found that TLF decoction can protect the intestinal barrier damage with sepsis, improve intestinal mucosal villi damage through upregulating ZO-1/occludin/claudin-1 expression (Chen et al., 2020).

Therefore, based on the above work, we hypothesized that TLF can regulate the balance of gut microbiota in sepsis, intervening in the state of intestine-bacteria immune interaction. Subsequently, it adjusts the balance of Th17/Treg immune axis, the key target of intestine-bacteria immune interaction, restoring the immune response in the intestine, and achieving the protective effect on the intestinal mucosal immune barrier protection of sepsis.

Materials and Methods

Ethics

The animal experiments of the study were permitted by the Animal Experimentation Ethics Committee of Zhejiang Eyong Pharmaceutical Research and Development Center (SYXK (Zhe) 2021-0033) and adhered to the guidelines of the China Council on Animal Care and Use.

Animals and experiments

Thirty Sprague-Dawley rats, male and female for half, weighing 250–300 g, were supplied from Zhejiang Weitong Lihua Laboratory Animal Technology Co., LTD., Animal Production License No. SCXK (Zhe) 2019-0001. They lived at 24°C–26°C and relative humidity of 45%–60%. The animal research was ratified by the Ethics Committee of the Animal Center of Zhejiang Eyong Pharmaceutical Research and Development Center. Animal use license number: SYXK (Zhe) 2021-0033. The rats were fed adaptively for 7 days before undergoing cecal ligation and puncture (CLP) surgery and were fasted for 6 h before the experiment.

Establishment of sepsis model

According to the previous study (Chen et al., 2021), rats received CLP as the sepsis model. They were anesthetized with isoflurane, afterward, a median incision was made in the abdominal wall, and the cecum was gently pulled out to protect the mesenteric blood vessels. To fill the cecal ends and divide the mesenteric surface blood vessels, the feces at the top end of the cecum were gently pressed. A sterile needle was used to puncture the cecum wall at the midpoint between the ligation site and the apex of the cecum to create perforation. A sterile No. 4 silk thread was ligated at the midpoint between the blind valve and the cecum. The cecum was gently squeezed to allow the extrusion of a little content so that the perforation was unobvious. After the extruded content was wiped out, the cecum was pushed back into the abdominal cavity, and layers of sutures were applied. After the operation, saline was used for fluid resuscitation (37°C, 5 mL/100 g) and buprenorphine (0.05 mg/kg) was used for pain relief.

Rats in sham group were treated with abdominal wall opening without CLP, and then the abdominal cavity was sutured.

TFL decoction preparation

Mirabilite, Magnolia officinalis, Forsythia, Scutellaria, Almond, Bletilla, and Panax notoginseng each for 10 g, and Rhubarb 20 g. After these medicines were immersed in water for 2 h, the water was decocted and concentrated. After disinfection, the decoction is refrigerated for later use.

Fecal filtrate preparation

The same batch of healthy rats were selected as fecal donors for the fecal microbial transplantation experiment. Under aseptic conditions, feces were collected from donor rats every day under laminar flow hood. Feces from rats in the donor group were pooled, and 100 mg feces were dissolved in 1 mL sterile normal saline. The solution was vigorously mixed using a bench swirl for 10 s, and the supernatant was collected by centrifugation and used as donor graft material for fecal microbial graft experiments.

Group administration

Each group contains 6 rats. All drugs were prepared by dissolving in distilled water. Sham group rats were given normal saline 10 mL/kg by gavage. Model group rats were given CLP, and normal saline 10 mL/kg was given intragastric administration. CLP+TLF group: 7.2 g/kg TLF decoction was given to CLP rats by gavage. CLP+fecal microbial transplantation (FMT) group: each CLP rat was given fresh diluted fecal filtrate 10 mL/kg by gavage. CLP+antibiotic group: antibiotics were given to CLP rats by gavage (4 mixtures of ampicillin, neomycin sulfate and metronidazole for 1 g/L vancomycin for 0.5 g/L), dissolved in water at this concentration, and administered through drinking water. They were all treated once a day for a week.

Sample collection

One week after gavage, the fresh feces were collected, and then the rats were anesthetized with isoflurane. Two milliliters blood from the abdominal aorta. The serum was separated after centrifugation and stored at −20°C away from light. The fecal sample was stored in a sterile centrifuge tube and about 2–3 mL of each tube was then transferred into the collection tube, followed by being stored in the refrigerator at −80°C. Ultimately, the rats were euthanized by CO₂ inhalation, and the spleens were removed. Lymphocytes were separated from the spleens and centrifuged. The single-cell suspension of the spleen was detected by flow cytometry (FCM). About 2 cm of diseased colon tissue was cut at 1.5 cm of the upper anus, and then dissected longitudinally for cleaning with sterile saline, and 0.5 cm of intestinal tissue was cut for staining.

Enzyme-linked immunosorbent assay measurement

The serum levels of tissue IL-1β (MM-0047R1), tumor necrosis factor (TNF)-α (MM-0180R1), and IL-6 (MM-0190R1) were tested with ELISA kits from Meimian (Yancheng, China) following the manufacturer's instructions.

Hematoxylin-eosin staining

The intestinal tissues were quickly removed and fixed with 4% paraformaldehyde. The intestinal tissues were dehydrated by gradient ethanol and xylene, and then immersed in wax. The tissues were cut into 5 μm slices and affixed to the antipeeling slides. The slices were baked at 60°C for 12 h, dewaxed and hydrated by xylene and gradient ethanol, and stained with hematoxylin and eosin (H&E) staining (G1005; SERVICEBIO, Wuhan, China). At last, ethanol with low to high concentrations was added to dehydrate. Following the vitrification by xylene, the slices were sealed with neutral balsam and were observed under the microscope (Nikon Eclipse E100).

Inflammatory cell infiltration scoring system was applied according to the previous study (Zhang et al., 2021), specifically no inflammation or lesion, score 0. Minimal inflammatory cell infiltration, lesion limited to the submucosa, score 1. Mild inflammatory cell infiltration, lesion extending to the muscular layer with crypt disruption, score 2. Significant inflammatory cell infiltration, lesion involving the muscular layer with evident crypt destruction, score 3. Extensive inflammatory cell infiltration, lesion reaching the serosal layer, with destruction of crypts and epithelium, score 4.

Western blot

Pure protein was extracted from the intestinal tissues, and the protein concentration was measured by the bicinchoninic acid method. After the loading buffer was added, the protein was boiled to achieve denaturation. The total protein was separated by electrophoresis, and the corresponding protein was transferred to the polyvinylidene difluoride membrane. The nonspecific antigen was blocked with 5% milk, and the protein on the membrane was incubated with the target antibody against Occludin (DF7504; Affinity, Cincinnati, OH), Claudin 1(AF0127; Affinity), ZO-1(21773-1-AP; proteintech, Wuhan, China), and β-actin (AF7018; Affinity). After incubation at 4°C overnight, it was incubated with secondary antibodies (Anti-rabbit IgG, HRP-linked Antibody, CST, 7074). Unbound antibodies were washed and captured in an enhanced chemiluminescence luminescence imager.

Quantitative real-time polymerase chain reaction

Pure inferior vena tissue RNA was obtained via the extraction using Trizol (B511311; Sangon Biotech, Shanghai, China) and transcribed into cDNA with a reverse transcription kit (CW2569; Jiangsu Cowin Biotech, Taizhou, China). Primers, DEPC, cDNA, and SYBR Green (RR820A; Takara, Shiga, Japan) were added to prepare the corresponding system for amplification products in the PCR instrument. The sequences of the primer are listed (Table 1). The fold changes of mRNA were calculated using the 2^−ΔΔCT method.

Table 1.

Primer Sequence

Gene	Forward primer	Reverse primer
Rat Tjp1	CACACGATGCTCAGAGACGAAGG	CTGTATGGTGGCTGCTCAAGGTC
Rat Cldn1	CGGTGTGTGCTGCTTTTAT	CAGACGCAACTCTCGGTAGG
Rat Ocln	GACCTTGTCCGTGGATGACTTCAG	ATCAGCAGCAGCCATGTACTCTTC
Rat Gapdh	AAGGTCGGTGTGAACGGATTT	CTTTGTCACAAGAGAAGGCAGC

Flow cytometry

The spleen and intestine tissues were mechanically separated, and then the red blood cell lysis buffer was used for lysis. Single cell suspensions were centrifuged for 5 min at 1,200 rpm after being passed through nylon membranes. For use in a FCM test, the suspension was resuspended in RPMI 1,640 containing 10% FBS. 20 μL CD3-APC (AR00305; MultiSciences Biotech, Hangzhou, China), 20 μL CD4-BV421 (743088; BD Biosciences Pharmingen, San Diego, CA), and 20 μL IL-17A-PE (AM0I1704; MultiSciences Biotech, China) was added to each tube (cell density at 10⁶), followed by the rinse in Hank's buffer and incubation in a refrigerator at 4°C for 15 min in darkness. Twenty microliters Foxp3-PE (320011; Biolegend, San Diego, CA) was then added before the FCM assay. For the FCM assay, the quantity of CD4⁺IL-17⁺ Th17 cells was identified. Anti-CD4, anti-CD3, and anti-Foxp3 antibodies were coupled with fluorescein isothiocyanate, allophycocyanin, and phycoerythrin to stain lymphocytes. Using the FCM assay, the number of CD4⁺, CD3⁺, and Foxp3⁺ Treg cells was selected.

16S rDNA sequencing and analysis

Each fecal group's whole genomic DNA was extracted, and target sequences (the 16S rDNA V3-V4 region) were amplified by PCR. To create a sequencing library, the products were then cleaned, measured, and homogenized. For building libraries, a library quality assessment was done, and qualified libraries were sequenced on Illumina HiSeq 2500 (Illumina, San Diego, CA). Base-calling analysis was used to turn the original picture data files obtained during high-throughput sequencing into sequenced reads. The results were stored in FASTQ format file for further bioinformatics analysis. The Alpha diversity level of each group was evaluated according to the distribution of Amplicon Sequence Variants/Operational Taxonomic Units in different groups. Each group's distance matrix was constructed and using a number of unsupervised sequencing and clustering techniques along with associated statistical testing techniques, the differences in beta diversity and species abundance composition between various groups were determined. Based on the results of gene sequencing, the metabolic function of the sample flora was predicted, and the species composition of the specific pathway was obtained.

Statistical analysis

The statistical analysis was carried out using SPSS software (16.0; IBM, Armonk, NY). One-way analysis of variance was used to analyze the data under normal distribution in this study. Dunnett's T3 test or independent sample t-test was used if the distribution was normal, but the variance was not uniform. If it did not conform to the normal distribution, the Kruskal–Wallis H test was used. P < 0.05 was designated as statistically significant.

Results

TLF improved the pathological changes of intestinal mucosa in CLP rats

As can be seen from Fig. 1, the intestinal tissue structure of the sham group is complete, and the hierarchy is clear. Compared with the sham group, the CLP group showed a large number of inflammatory cell infiltration, and the lesions invaded the serosa layer. CLP+TLF group and CLP+FMT group had a small amount of inflammatory cell infiltration, and few intestinal villi were destroyed. The pathological damage of intestinal tissue in rats of the CLP+antibiotic group is lighter than the CLP group. In addition, the semiquantitative H&E score in the CLP group significantly increased compared to the control group (P < 0.01). Compared to the CLP group, H&E scores in the CLP+TLF group, CLP+FMT group, and CLP+antibiotic group significantly decreased (P < 0.01). Compared to the CLP+TLF group, H&E score in the CLP+antibiotic group significantly decreased (P < 0.01), and compared to the CLP+FMT group, H&E score in the CLP+antibiotic group significantly decreased (P < 0.05).

FIG. 1.

TLF decoction improved the pathological changes of intestinal mucosa in CLP rats. The histomorphology of intestinal tissue in rats was observed by H&E staining and evaluated by the H&E score (magnification × 100, 400) ^▲▲ P < 0.01 versus sham group. ^★★ P < 0.01 versus CLP group. CLP+TLF: cecal ligation and perforation rats with the treatment of TLF decoction, CLP+FMT: cecal ligation and perforation rats with the treatment of fecal microbial transplantation, CLP+Antibiotic: cecal ligation and perforation rats with the treatment of antibiotic. CLP, cecal ligation and puncture; FMT, fecal microbiota transplantation; H&E, hematoxylin and eosin; TLF, Tongfu Lifei.

TLF exerted an anti-inflammatory effect on the CLP rats

In Figure 2, ELISA kits were used to test the content of inflammatory factors. Compared with the sham group, the contents of TNF-α, IL-1β, and IL-6 in the serum of rats in the CLP group were significantly increased (P < 0.01). With the interference of TLF, FMT, and antibiotic, respectively, the levels of TNF-α, IL-1β, and IL-6 in the serum of rats were lower than CLP rats (P < 0.05 or P < 0.01).

FIG. 2.

TLF exerted anti-inflammatory effect in serum of the CLP rats. ELISA was used to test TNF-α, IL-1β, and IL-6 levels in each group, n = 6 in each group; ^▲▲ P < 0.01 versus sham group. ^★ P < 0.05, ^★★ P < 0.01 versus CLP group. CLP: cecal ligation and perforation rats, CLP+TLF: cecal ligation and perforation rats with the treatment of TLF decoction, CLP+FMT: cecal ligation and perforation rats with the treatment of fecal microbial transplantation, CLP+Antibiotic: cecal ligation and perforation rats with the treatment of antibiotic. ELISA, enzyme-linked immunosorbent assay; IL, interleukin TNF, tumor necrosis factor.

The effect of TLF on the intestinal barrier of the intestinal in CLP rats

To explore the effect of TLF on the intestinal barrier, quantitative real-time polymerase chain reaction (qRT-PCR) and western blot were used to observe the intestinal barrier-related factors. In Fig. 3A, the relative mRNA expressions of ZO-1, Claudin 1, and Occludin in CLP rats were decreased compared to the sham group. With the interference of TLF, FMT, and antibiotic, respectively, the expressions of intestinal barrier-related factors were strengthened compared to the CLP group (P < 0.01). As expected, in Fig. 3B, the results of western blot that the expression trend of ZO-1, Claudin 1, and Occludin demonstrated the same way as qRT-PCR observed (P < 0.05 or P < 0.01).

FIG. 3.

TLF enhanced the expression of ZO-1, Claudin 1 and Occludin proteins associated with intestinal mucosa in CLP rats. (A, B): Quantitative Real-time PCR and Western blot was used to test the relative expression of ZO-1, Claudin 1 and Occludin in rats, n = 6 in each group in A, n = 3 in each group in B. ^▲▲ P < 0.01 versus sham group. ^★ P < 0.05, ^★★ P < 0.01 versus CLP group. CLP: cecal ligation and perforation rats, CLP+TLF: cecal ligation and perforation rats with the treatment of TLF decoction, CLP+FMT: cecal ligation and perforation rats with the treatment of fecal microbial transplantation, CLP+Antibiotic: cecal ligation and perforation rats with the treatment of antibiotic.

TLF promotes the balance of the Th17/Treg cells in the lymphocyte of the CLP rats

To clarify whether TLF will impact the balance of immune cells in CLP rats, we used the FCM to observe the percentage of the Th17/Treg cells in spleen and intestine. In Fig. 4A, compared with the sham group, Th17 and Treg cells of the CLP group were significantly increased which were imbalanced (P < 0.01). Compared with CLP group, the number of Th17 cells in splenic cells of CLP+TLF group, CLP+FMT group, and CLP+antibiotic group was decreased (P < 0.05 or P < 0.01), while the number of Treg cells was enhanced (P < 0.05 or P < 0.01), contributing to the balance situation in Th17/Treg cells in the lymphocyte. In Fig. 4B, compared to the sham group, the number of Th17 cells in intestinal cells of the CLP group significantly increased (P < 0.01), and Treg cells significantly decreased (P < 0.01). Compared to the CLP group, the number of Th17 cells in intestinal cells of the CLP+TLF group, CLP+FMT group, and CLP+antibiotic group significantly decreased (P < 0.01), while the number of Treg cells significantly increased (P < 0.01).

FIG. 4.

TLF promote the balance of the Th17/Treg cells in the lymphocyte of the CLP rats. (A, B) FCM was used to test the percentage of Th17 and Treg cells of each group in lymphocyte in spleen and intestine tissues of the rats, n = 3 in each group, ^▲▲ P < 0.01 versus sham group. ^★ P < 0.05, ^★★ P < 0.01 versus CLP group. Note: CLP: cecal ligation and perforation rats, CLP+TLF: cecal ligation and perforation rats with the treatment of TLF decoction, CLP+FMT: cecal ligation and perforation rats with the treatment of fecal microbial transplantation, CLP+Antibiotic: cecal ligation and perforation rats with the treatment of antibiotic. FCM, flow cytometry.

The effect of TLF on the diversity of gut microbiota in CLP rats

A gut analysis was done on CLP rats to investigate the effect of CLP and TLF interactions on the gut microbiota. According to the findings in Fig. 5A, the CLP group's gut microbiota's alpha diversity was lower than that of the Sham group (P < 0.01) in terms of the alpha diversity indices (Chao1, Simpson, and Shannon). Naturally, the TLF group had higher alpha diversity indices. Antibiotic therapy worsened the loss of alpha diversity in CLP rats. We also looked at the beta diversity of the gut microbiota (variation of microbial composition in groups) in Fig. 5B, C. It's interesting to note that the CLP group's gut microbiome differed from that of the other four groups, and that of the CLP+TLF group was more like that of the sham group than the CLP group.

FIG. 5.

The effect of TLF on the diversity of gut microbiota in CLP rats. (A): 16S rDNA gene sequencing analysis showed that the alpha diversity of gut microbiota, such as Chao1, Simpson, Shannon indices, was dramatically changed in each group, n = 6 in each group. Alpha index box plot, with the uppermost ‘p’ representing the significance of multiple group comparisons (using the Kruskal-Wallis test method). An asterisk (*) indicates comparison with the median data: *p < 0.05; **p < 0.01; ***p < 0.001. (B, C) Beta diversity of gut microbiota, whose unweighted UniFrac NMDS analysis and Unweighted pair-group method with arithmetic means showed that the composition in each group n = 6 in each group. Note: CLP: cecal ligation and perforation rats, TLF: cecal ligation and perforation rats with the treatment of TLF decoction, FMT: cecal ligation and perforation rats with the treatment of fecal microbial transplantation, ANT: cecal ligation and perforation rats with the treatment of antibiotic. ANT, antibiotic.

The moderating effect of TLF on gut microbiota in CLP rats

The gut microbiota showed abundance differences in all groups in the phylum and genus level. The top 20 phyla and genera with the highest average ASV/OTU frequency in the groups were displayed, respectively (Fig. 6A, B). Importantly, TLF upregulated the relative abundance of Oscillospira, while Blautia was decreased in the TLF than the CLP group, and paraprevotella was decreased in CLP rats compared to the sham group (Fig. 6C, P < 0.05 or P < 0.01).

FIG. 6.

The beneficial effect of TLF on gut microbiota in CLP rats. (A, B): At phylum and genus levels, the number of corresponding ASV/OTUs in each region was counted. The top 20 phyla and genera with the highest average ASV/OTU frequency of the groups were displayed. n = 6 in each group. (C): The relative abundance of the Oscillospira, Blautia, and paraprevotella are calculated in each group. n = 6 in each group. ^▲ P < 0.05, versus sham group. ^★ P < 0.05, ^★★ P < 0.01 versus CLP group. Note: CLP: cecal ligation and perforation rats, TLF: cecal ligation and perforation rats with the treatment of TLF decoction, FMT: cecal ligation and perforation rats with the treatment of fecal microbial transplantation, ANT: cecal ligation and perforation rats with the treatment of antibiotic.

We further used the LEfSe to analyze the degree of influence of significantly different species in groups. In Fig. 7A, B, we can see different significant species of gut microbiota in each group. In the TLF group, the LDA scores of the Clostridia and Clostridiales Oscillospira were high. The colored solid spot showed that it influenced the variation of the gut microbiota, especially with Clostridia, Clostridiales, and Lachnospiraceae.

FIG. 7.

The variation analysis of gut microbiota after the TLF in CLP rats. (A) The bar chart shows species with a significantly different LDA score, the Biomarker with statistical difference (LDA >2 and P < 0.05). The colors of the bar chart represent the groups, and the lengths represent the LDA score, which is the degree of impact of significantly different species between groups. The longer the length, the more significant the difference in the group, and the color of the bar graph indicates the sample group corresponding to the highest abundance of the group. (B) The taxonomic branching diagram shows the taxonomic hierarchy of the main taxa from phylum to genus (inner ring to outer ring) in a sample community. The node size corresponds to the average relative abundance of the group. Hollow nodes represent group with insignificant inter-group differences, while nodes of other colors indicate that these taxa show significant inter-group differences and are more abundant in the samples represented by this color. The letters identify the names with significant differences between groups. Note: CLP: cecal ligation and perforation rats, TLF: cecal ligation and perforation rats with the treatment of TLF decoction, FMT: cecal ligation and perforation rats with the treatment of fecal microbial transplantation, ANT: cecal ligation and perforation rats with the treatment of antibiotic. LDA, linear discriminant analysis.

In Figure 8A, B, we can see that from both the glycolysis and glycogen biosynthesis process, the treatment of the TLF restored the relative abundance of the gut microbiota.

FIG. 8.

The beneficial effect of TLF on glycometabolism in CLP rats. (A, B) Species composition of differential MetaCyc metabolic pathways in both glycolysis and glycogen biosynthesis process. The horizontal coordinate refers to different sample labels, which are grouped with different colors. The sorting of samples within the group is based on the similarity of data. The ordinate is the relative abundance of metabolic pathways. The contribution values of different taxon species to this metabolic pathway at the same taxonomic level (the default is genus level) are displayed in different colors.

Discussion

Sepsis is a dangerous disease, which can lead to organ dysfunction. The gastrointestinal system has been shown to have a significant role in the pathophysiology of sepsis (Wang et al., 2019). In an infectious and inflammatory situation, it is possible that with high permeability of intestinal bacteria, endotoxin and a variety of metabolites from the intestinal transfer to the location of the previous sterile, aggravating inflammation and immune response leading to serious sepsis (Cavaillon, 2018; Hu et al., 2019). It has been reported that an intact intestinal barrier can reduce inflammation and immune response caused by sepsis (Adelman et al., 2020; Ma et al., 2020). Meanwhile, through previous studies, TLF can play a role in reducing sepsis. As a result, in this study, we further explored whether TLF decoction attenuates sepsis-related intestinal mucosal injury by regulating Th17/Treg balance in modulating the gut microbiota of rats.

The relationship between sepsis, dysregulated potassium levels (hypokalemia or hyperkalemia), and gut microbiota is multifaceted (Suri et al., 1997). Sepsis can disrupt potassium balance, leading to either hypokalemia or hyperkalemia (Shih et al., 2012). Factors contributing to hypokalemia in sepsis include diuretic use, increased renal potassium loss, and hormonal shifts causing potassium to move into cells. Hyperkalemia in sepsis may result from tissue breakdown, metabolic acidosis, and impaired renal function. While gut microbiota influences the body's metabolism and electrolyte balance, its direct impact on potassium levels in sepsis is less clear and requires further research. The complex interplay of immune responses, hormonal changes, and renal function in sepsis affects both potassium balance and gut microbiota composition. It is commonly acknowledged that TNF-α, IL-1β, and IL-6 are the major inflammatory biomarkers in sepsis (Deng et al., 2022). With less inflammatory cell infiltration, fewer TNF-α, IL-1β, and IL-6 content in serum and less intestinal tissue destruction under the treatment of the TLF in our study, we concluded that TLF exerted a powerful protective effect on the sepsis-induced inflammation and tissue injury. In addition, TLF decoction has been researched in sepsis with the protection of the intestinal barrier. According to previous studies (Chen et al., 2021; Chen et al., 2020), it was observed that TLF protected the intestinal barrier of sepsis in rats through regulating ZO-1/Occludin/claudin-1, and TLF, to some extent, engaging in the immune response to alleviate the intestinal barrier injury caused by the sepsis.

It is believed that the balance of the Th17/Treg is critical to the immune system in sepsis disease. Sepsis patients had significantly higher Treg cells and lower Th17 cells in comparison to nonsepsis (Gupta et al., 2016). On the contrary, the results we concluded that the ratio of Th17/Treg in CLP model was higher than sham group, and after the treatment of TLF, FMT, antibiotic, respectively, the ratio of Th17/Treg was reduced than CLP model which was the same as Cheng's study (Cheng et al., 2022). The apparent inconsistency can be explained through time-dependent changes, differences in local versus systemic immune response, and impact of experimental conditions factors. TLF contributed to the upregulation of the expression of ZO-1/Occludin/Claudin-1 which maintained the integrity of the intestinal barrier and suppressed the leaky gut. The balance percentage of the Th17/Treg and the less inflammatory factors produced indicate that TLF may prevent the process of sepsis that less gut microbiota transferred to the sterile places, causing the less inflammatory and immune response.

A study confirmed that in patients intestinal dysbiosis and sepsis are related (Liu et al., 2019). Ye (Ye et al., 2021) in their research found that gut microbiota changes are brought on by chlorogenic acid enhanced metabolic endotoxemia. It is believed that TLF affects sepsis by modulating the microbiome at least in part. Our study showed that TLF dramatically boosted the alpha- and beta-diversity of gut microbiota in CLP rats based on 16s rDNA gene sequencing. A study (Jiao et al., 2018) showed that Oscillospira, which turns polysaccharides into short-chain fatty acids (SCFAs) and promotes insulin resistance and systemic inflammation, was found in greater abundance in obese rodents. Liang (Liang et al., 2022) in their study mentioned and revealed that metformin treatment enhanced the relative abundance of bacteria that offer intestinal cells energy, maintain the gut barrier, and keep LPS from crossing the intestinal wall, including Bifidobacterium, Muribaculaceae, Parabacteroides-distasonis, and Alloprevitella.

Consistent with their study, in our study, we observed that the treatment of the TLF increased the relative abundance of Oscillospira which exerted an anti-inflammatory effect on sepsis. Besides, the relative abundance of Bifidobacterium was strengthened compared with the CLP group. These bacteria produce SCFA, which provides energy to intestinal cells and maintains the gut barrier. Blautia prevents pathogens colonization by producing bacteriocins that exhibit anti-inflammatory properties and maintain glucose homeostasis via upregulating the production of Treg cells and SCFA (Liu et al., 2021; Palmieri et al., 2021). However, in our study, Blautia had a great decrease after the treatment of the TLF that may be related to the balance of Th17/Treg cells.

To further explore whether the gut microbiota species participate in the metabolic process, we specifically focus on glycometabolism. Since studies confirmed that abnormal glucose metabolism during sepsis is related to metabolic hormones and inflammatory cytokines. A large number of cytokines IL-6 and TNF-a can affect glucose metabolism by stimulating the secretion of hyperglycemia, cortisol, and other hormones in the body (Owolabi et al., 2021); on the other hand, they can also affect glucose metabolism through direct effects. In Masataka Nakamura's study (Nakamura et al., 2012), they revealed that high blood IL-6 level was correlated with hyperglycemia in septic patients. In our research, we found that from both glycolysis and glycogen biosynthesis processes, the treatment of the TLF restored the relative abundance of the gut microbiota and ameliorated the inflammation.

In this study, we found that TLF reduced the expression of serum inflammatory factors, restored the impaired intestinal tissues and intestinal barrier, increased the diversity of gut microbiota, and balanced the ratio of Th17/Treg cells, thus exerting an ameliorating effect on the sepsis rats. However, deeper studies are needed to explore the related bacteria in alleviating the sepsis disease, and the study results need to be confirmed by other similar studies.

Conclusion

To sum up, TLF regulated the gut microbiota to balance the ratio of Th17/Treg cells, reducing the inflammation response and intestinal mucosal injury in sepsis rats. This study provided the basis for further clinical and experimental research on TLF's treatment of sepsis.

Footnotes

Authors' Contributions

Conceptualization: H.C.; Funding acquisition: H.C.; Data curation: H.C., Z.Y., Z.Q., X.H., J.G.; Roles/Writing—original draft: H.C., J.G.; Writing—review and editing: J.G.; Final approval of the version to be published: All authors. Agreement to be accountable for all aspects of the work to ensure questions related to the accuracy and integrity of the work are appropriately investigated and resolved: H.C., Z.Y., Z.Q., X.H., J.G.

Data Availability Statement

Data will be made available on request.

Author Disclosure Statement

No competing financial interests exist.

Funding Information

This work was supported by the “Hangzhou Science and Technology Development Plan Project” (grant numbers 20201203B181).

References

Adelman

, Woodworth

, Langelier

, et al. The gut microbiome's role in the development, maintenance, and outcomes of sepsis. Crit Care, 2020; 24(1):278; doi: 10.1186/s13054-020-02989-1

Caraballo

, Jaimes

. Organ dysfunction in sepsis: An ominous trajectory from infection to death. Yale J Biol Med, 2019; 92(4):629–640.

Cavaillon

. Exotoxins and endotoxins: Inducers of inflammatory cytokines. Toxicon, 2018; 149:45–53; doi: 10.1016/j.toxicon.2017.10.016

Chen

, Li

, Han

, et al. Tong-fu-li-fei decoction exerts a protective effect on intestinal barrier of sepsis in rats through upregulating ZO-1/occludin/claudin-1 expression. J Pharmacol Sci, 2020; 143(2):89–96; doi: 10.1016/j.jphs.2020.02.009

Chen

, Li

, Zou

, et al. Tong‑fu‑li‑fei decoction attenuates immunosuppression to protect the intestinal‑mucosal barrier in sepsis by inhibiting the PD‑1/PD‑L1 signaling pathway. Molecular medicine reports, 2021; 24(6):840; doi: 10.3892/mmr.2021.12480

Chen

, Billiar

. Gut microbiota and multiple organ dysfunction syndrome (MODS). Adv Exp Med Biol, 2020; 1238:195–202; doi: 10.1007/978-981-15-2385-4_11

Cheng

, Hu

, Li

, et al. Qing-Chang-Hua-Shi granule ameliorates DSS-induced colitis by activating NLRP6 signaling and regulating Th17/Treg balance. Phytomedicine, 2022; 107:154452; doi: 10.1016/j.phymed.2022.154452

Deng

, Tang

, Li

, et al. Diagnostic value of combined detection of IL-1β, IL-6, and TNF-α for sepsis-induced cardiomyopathy. Med Clin (Barc), 2022; 158(9):413–417; doi: 10.1016/j.medcli.2021.04.025

Gupta

, Bhoi

, Mohan

, et al. Coexistence of Th1/Th2 and Th17/Treg imbalances in patients with post traumatic sepsis. Cytokine, 2016; 88:214–221; doi: 10.1016/j.cyto.2016.09.010

10.

Haak

, Wiersinga

. The role of the gut microbiota in sepsis. Lancet Gastroenterol Hepatol, 2017; 2(2):135–143; doi: 10.1016/s2468-1253(16)30119-4

11.

Hansson

. Role of mucus layers in gut infection and inflammation. Curr Opin Microbiol, 2012; 15(1):57–62; doi: 10.1016/j.mib.2011.11.002

12.

, Ren

, Li

, et al. STING-mediated intestinal barrier dysfunction contributes to lethal sepsis. EBioMedicine, 2019; 41:497–508; doi: 10.1016/j.ebiom.2019.02.055

13.

Huang

, Chen

. Inflammatory bowel disease related innate immunity and adaptive immunity. Am J Transl Res, 2016; 8(6):2490–2497.

14.

Jiao

, Baker

, Nugent

, et al. Gut microbiome may contribute to insulin resistance and systemic inflammation in obese rodents: A meta-analysis. Physiol Genomics, 2018; 50(4):244–254; doi: 10.1152/physiolgenomics.00114.2017

15.

Kernbauer

, Maurer

, Torres

, et al. Gastrointestinal dissemination and transmission of Staphylococcus aureus following bacteremia. Infect Immun, 2015; 83(1):372–378; doi: 10.1128/iai.02272-14

16.

Liang

, Song

, Zhang

, et al. Metformin attenuated sepsis-related liver injury by modulating gut microbiota. Emerg Microbes Infect, 2022; 11(1):815–828; doi: 10.1080/22221751.2022.2045876

17.

Liu

, Cheng

, Guo

, et al. Magnesium-L-threonate alleviate colonic inflammation and memory impairment in chronic-plus-binge alcohol feeding mice. Brain Res Bull, 2021; 174:184–193; doi: 10.1016/j.brainresbull.2021.06.009

18.

Liu

, Li

, Fang

, et al. Enteric dysbiosis is associated with sepsis in patients. FASEB J, 2019; 33(11):12299–12310; doi: 10.1096/fj.201900398RR

19.

, Yang

, He

, et al. Esmolol reduces apoptosis and inflammation in early sepsis rats with abdominal infection. Am J Emerg Med, 2017; 35(10):1480–1484; doi: 10.1016/j.ajem.2017.04.056

20.

, Chen

, Li

Lea

. Effects of colon dialysis with Tongfu Lifei decoction combined with alveolus lavage on TNF-a and IL-6. J Traditional Chin Med, 2018; 46(01):83–87; doi: 10.19664/j.cnki.1002-2392.180020

21.

, Ni

, Wang

, et al. Spermidine improves gut barrier integrity and gut microbiota function in diet-induced obese mice. Gut Microbes, 2020; 12(1):1–19; doi: 10.1080/19490976.2020.1832857

22.

Nakamura

, Oda

, Sadahiro

, et al. Correlation between high blood IL-6 level, hyperglycemia, and glucose control in septic patients. Crit Care, 2012; 16(2):R58; doi: 10.1186/cc11301

23.

Owolabi

, Kolawole

, Ikem

, et al. Hyperglycaemic emergencies are associated with increased pro-inflammatory cytokine (Interleukin-6) and cortisol. West Afr J Med, 2021; 38(10):936–943

24.

Palmieri

, Castellana

, Biscaglia

, et al. Microbiome analysis of mucosal ileoanal pouch in ulcerative colitis patients revealed impairment of the pouches immunometabolites. Cells, 2021; 10(11):3243; doi: 10.3390/cells10113243

25.

Panpetch

, Hiengrach

, Nilgate

, et al. Additional Candida albicans administration enhances the severity of dextran sulfate solution induced colitis mouse model through leaky gut-enhanced systemic inflammation and gut-dysbiosis but attenuated by Lactobacillus rhamnosus L34. Gut Microbes, 2020; 11(3):465–480; doi: 10.1080/19490976.2019.1662712

26.

Rudd

, Johnson

, Agesa

, et al. Global, regional, and national sepsis incidence and mortality, 1990–2017: Analysis for the Global Burden of Disease Study. Lancet, 2020; 395(10219):200–211; doi: 10.1016/s0140-6736(19)32989-7

27.

Salomão

, Ferreira

, Salomão

, et al. Sepsis: Evolving concepts and challenges. Braz J Med Biol Res, 2019; 52(4):e8595; doi: 10.1590/1414-431x20198595

28.

Shang

, Lin

, Yu

, et al. Resveratrol protects the myocardium in sepsis by activating the phosphatidylinositol 3-Kinases (PI3K)/AKT/Mammalian target of rapamycin (mTOR) pathway and inhibiting the nuclear factor-κB (NF-κB) signaling pathway. Med Sci Monit, 2019; 25:9290–9298; doi: 10.12659/msm.918369

29.

Shen

, Zuo

, Mao

. Effect of probiotics on inducing remission and maintaining therapy in ulcerative colitis, Crohn's disease, and pouchitis: Meta-analysis of randomized controlled trials. Inflamm Bowel Dis, 2014; 20(1):21–35; doi: 10.1097/01.MIB.0000437495.30052.be

30.

Shi

, Zhou

, Li

, et al. Intestinal microbiota metabolizing Houttuynia cordata polysaccharides in H1N1 induced pneumonia mice contributed to Th17/Treg rebalance in gut-lung axis. Int J Biol Macromol, 2022; 221:288–302; doi: 10.1016/j.ijbiomac.2022.09.015

31.

Shih

, Tsai

, Chen

, et al. Effects of small-volume hypertonic saline on acid-base and electrolytes balance in rats with peritonitis-induced sepsis. Shock (Augusta, Ga), 2012; 38(6):649–655; doi: 10.1097/SHK.0b013e31826fef13

32.

Suri

, Kumar

, Kaur

, et al. Electrolyte disturbances due to ouabain sensitive sodium potassium pump in erythrocytes of children with sepsis. The Indian journal of medical research, 1997; 105:67–71.

33.

Tan

, Zhou

, Zhang

, et al. Beta-1 blocker reduces inflammation and preserves intestinal barrier function after open abdominal surgery. Surgery, 2021; 169(4):885–893; doi: 10.1016/j.surg.2020.11.004

34.

Vancamelbeke

, Vermeire

. The intestinal barrier: A fundamental role in health and disease. Expert Rev Gastroenterol Hepatol, 2017; 11(9):821–834; doi: 10.1080/17474124.2017.1343143

35.

Wang

, Li

, Ren

. Microbiota-immune interaction in the pathogenesis of gut-derived infection. Front Immunol, 2019; 10:1873; doi: 10.3389/fimmu.2019.01873

36.

Yang

. Effects of colon dialysis combined with bronchoscopic alveolar lavage on HMGB-1 and IL-10 levels in patients with pneumonia and sepsis. Feet Health Care, 2018; 27(03):172–174; doi: 10.19589/j.cnki.issn1004-6569.2018.03.172

37.

, Liu

, Hu

, et al. Chlorogenic acid-induced gut microbiota improves metabolic endotoxemia. Front Endocrinol (Lausanne), 2021; 12:762691; doi: 10.3389/fendo.2021.762691

38.

Zhang

, Ju

, Wu

, et al. Tripterygium wilfordii polyglycoside ameliorated TNBS-induced colitis in rats via regulating Th17/Treg balance in intestinal mucosa. J Inflam Res, 2021; 14:1243–1255; doi: 10.2147/jir.S293961

39.

Ziesmann

, Marshall

. Multiple organ dysfunction: The defining syndrome of sepsis. Surg Infect (Larchmt), 2018; 19(2):184–190; doi: 10.1089/sur.2017.298