Macrolide,Lincosamide,and Streptogramin B–Constitutive-Type Resistance in Corynebacterium pseudodiphtheriticum Isolated from Upper Respiratory Tract Specimens

Abstract

Corynebacterium pseudodiphtheriticum is commonly found in normal upper respiratory tract flora in humans. In certain conditions it can cause the opportunistic infections, especially in immunocompromised patients. In certain strains of Corynebacterium sp., the macrolide, lincosamide, and streptogramin B (MLSb) resistance mechanism related to the presence of the erm(X) gene was discovered; hence, the need appeared for further investigation to confirm the existence of this gene among C. pseudodiphtheriticum. About 58 strains of C. pseudodiphtheriticum were used in this study. All strains were isolated from the nasal mucous membrane of patients with upper respiratory tract infection symptoms. Among the tested strains 52 were erythromycin resistant, and only 6 were erythromycin sensitive. The tested strains showed a very high percentage (89.7%) of the phenotype MLSb-constitutive resistance mechanism. The MLSb-inducible resistance among the tested strains was not observed. Association of the MLSb mechanism with resistance to chloramphenicol, trimethoprim/sulfamethoxazole and chloramphenicol, and trimethoprim/sulfamethoxazole was observed in 12.1%, 15.5%, and 44.8% tested strains, respectively. Among all isolates with the phenotype MLSb resistance, the presence of the erm(X) gene was confirmed by the polymerase chain reaction method. The results suggest that C. pseudodiphtheriticum with the MLSb-constitutive-type resistance can play a significant role in crossing this mechanism with other Corynebacterium sp., which colonize the nasal and throat mucous membrane.

Introduction

Opportunistic species of Corynebacterium are commonly found to colonize the mucosal membrane of upper respiratory tract in humans. In certain conditions, the species can cause infections and create very serious therapeutic problems.^8,11 This is because Corynebacterium possess several different mechanisms of drug resistance (e.g., macrolide, lincosamide, and streptogramin B [MLSb]). The MLSb resistance mechanism, present in Staphylococcus species, was discovered in certain species of Corynebacterium (C. diphtheriae, C. jeikeium, C. amycolatum, and C. striatum).^{9,15,19,21,23,28} The MLSb mechanism resistance is associated with the presence of the erythromycin resistance methylase (erm) gene classes, which encode the rRNA methylase (responsible for methylation of adenine in 23 S ribosomal RNA).¹ The erm gene, present in Corynebacterium species, was conferred by the alleles to class X.²² Despite the particularly high homology among erm(X) genes isolated from different Corynebacterium species (C. diphtheriae, C. jeikeium, and C. xerosis), the genes were localized in different parts of the bacterial genome. The erm(X) gene of C. diphtheriae was discovered within 14.5-kbp plasmid pNG2,¹⁴ whereas the same gene of C. xerosis was observed within transposon Tn5432, which itself is carried by the 50-kbp R plasmid, pTP10.²⁷ In contrast, the erm(X) gene of C. jeikeium^19,23 and C. striatum²¹ is located within the bacterial chromosome. Despite the difference between the data regarding the localization of erm(X) in C. jeikeium and C. xerosis, the presence of the gene was mainly revealed within transposon Tn5432, and this localization was observed in the tested strains of Corynebacterium species as well.

Corynebacterium pseudodiphtheriticum from Corynebacterium species is one of the most commonly found strains in human bacterial flora. The species is often isolated from the mucosal membrane of upper respiratory tract, and in certain conditions it is responsible for serious opportunistic infections. Among them are respiratory tract infections,^4,5,10 endocarditis,^2,20 and others (cutaneous, keratitis, conjunctivitis, and wound infections).^3,13,16 The common presence of C. pseudodiphtheriticum on the nasal mucosal membrane leads to transmission of this pathogen and causes endogenous infections; this results in the need to study the antibiotic resistance mechanisms among strains within this species. The aim of this study was to observe a high level of MLSb-constitutive-type resistance among C. pseudodiphtheriticum strains isolated from ambulatory patients, appointed by the physician because of the upper respiratory tract infection symptoms. The specific aim of the research was to examine the presence of the erm(X) gene among C. pseudodiphtheriticum, in which the phenotype MLSb-constitutive resistance mechanism was confirmed, and if present, to find out whether this is connected with resistance to other antibiotics.

Materials and Methods

Bacterial strains

About 58 strains of C. pseudodiphtheriticum were isolated from nasal mucosal membranes of randomly chosen patients (in 2008 and 2009), appointed by the physician because of the upper respiratory tract infection symptoms.

The bacteria were allowed to grow on 5% Columbia sheep blood agar at 37°C for 48 h. The strains were identified by the standard microbiological method and the APICoryne system (apiweb™ program, bioMérieux, Marcy l'Etoile, France). The accepted profiles 3101004, 5101004, and 7101004 included 94.9%, 97.8%, and 99.6% identification. In this study, identification of isolated strains was performed twice in independent procedures. After isolation of the strains from the culture, they were identified for the first time; then before determination of the erm(X) gene by the polymerase chain reaction (PCR) method, the identification was performed once again. In all cases we observed concordance between two independent identifications.

Susceptibility testing

The standard disc-diffusion method was used as a preliminary and screening test for C. pseudodiphtheriticum susceptibility detection to clindamycin (CM, 2 μg; Becton Dickinson, Sparks, MD), erythromycin (EM, 15 μg, Becton Dickinson), and lincomycin (15 μg, Becton Dickinson) on the Mueller Hinton 2 agar and 5% sheep blood medium (bioMérieux) with the inoculum of 1.0 McFarland and incubation time of 24 h at 35°C. The interpretation was assessed using the criteria for detecting the MLSb type of resistance for Staphylococcus spp.⁷ The study was performed for the preliminary selection of drug-resistant strains (MLSb positive) that were used for further analysis.

In the next stage, minimum inhibitory concentration (MIC) values (μg/ml) for resistant strains were determined using E tests for the following agents: EM, CM, azithromycin (AZ), quinupristin/dalfopristin (QDA), vancomycin (VA), chloramphenicol (CL), and trimethoprim/sulfamethoxazole (TS). The bacteria were allowed to grow on the MHS medium. The inocula were adjusted to 1.0 McFarland standard. The bacteria were incubated for 24 h at 35°C. MIC values were interpreted according to the Clinical Laboratory Standards Institute recommendation for Corynebacterium spp.⁶ For AZ and CL, MIC values were interpreted according to the Clinical Laboratory Standards Institute for Staphylococcus sp.,⁷ as described by Johnson et al.¹⁵

The PCR technique

The presence of the erm(X) gene was confirmed according to the method previously described.^11,12,23 The PCR was performed in Tpersonal (Biometria, Goettingen, Germany) thermocycler. The erm coding regions were PCR amplified from DNA template using the following primers: (5′–3′): Crm1, GACACGGCCGTCACGAGCAT; Crm2, GGCGGCGAGCGACTTCC. The PCR was performed in accordance with the following program: initial denaturation was carried out at 95°C for 5 min; 35 cycles of amplification, with each cycle consisting of the denaturation step at 95°C for 1 min, annealing at 65°C for 1 min, and extension at 72°C for 2 min, were carried out; the final extension was accomplished at 72°C for 5 min. The PCR products were electrophoresed on 1.5% agarose gel (Sigma, St. Louis, MO) containing 1 μg/μl ethidium bromide. The Tris-Phosphate-EDTA Buffer (Sigma) (1×) was used for preparing the agarose gel and for electrophoresis. The results were imaged on Kodak EDAS 290 gel registration system.

Results

About 58 strains of C. pseudodiphtheriticum were isolated from the nasal mucosal membrane of randomly chosen patients with upper respiratory tract infection symptoms. Among 58 tested strains (100%) the following resistance was found: 52 strains (89.7%) to CM, EM, lincomycin, and AZ; 35 (60.3%) to TS; 33 (56.9%) to CL. All isolates, 58 (100%), were sensitive to QDA and VA. In addition, amid the tested strains of C. pseudodiphtheriticum the phenotype MLSb-constitutive resistance mechanism was discovered in 52 (89.7%). Further, there was no zone of inhibition observed in case of EM, CM, lincomycin, AZ, CL, and TS. MIC values (EM, CM, AZ, CL, TS) of the MLSb-positive strains are illustrated in Table 1. A high level of resistance was defined for EM, CM, and AZ with MIC >256 μg/ml, and for trimethoprim-sulfamethoxazole with MIC >32 μg/ml, respectively. In 48 strains (92.3%) a very high level of resistance to EM was observed. Moreover, the remaining 4 (7.7%) isolates also displayed resistance to EM (MIC range, 4–6 μg/ml).

Table 1.

Comparison of Minimum Inhibitory Concentration Ranges of Resistance to Erythromycin, Clindamycin, Azithromycin, Chloramphenicol, and Trimethoprim Sulfamethoxazole Among Macrolide, Lincosamide, and Streptogramin B–Positive Corynebacterium pseudodiphtheriticum Isolates (n = 52 and n = 100%)

	MLS b -positive isolates resistant to
	EM	CM	AZ	CL	TS
Number	48^hr:4^r	52^hr	52^hr	33^r	35^hr
Percentage (%)	92.3:7.7	100	100	63.5	67.3

MIC ranges (μg/ml)
	>256^hr:(4^r–16^r)	>256^hr	>256^hr	16^r–64^r	>32^hr

EM, erythromycin; CM, clindamycin; AZ, azithromycin; CL, chloramphenicol; TS, trimethoprim-sulfamethoxazole; ^hr, highly resistant; ^r, resistant; MIC, minimum inhibitory concentration; MLSb, macrolide, lincosamide, and streptogramin B.

A high-grade resistance was also observed to CM and AZ among all tested MLSb-positive isolates of C. pseudodiphtheriticum. Simultaneously, 33 (63.5%) strains displayed resistance to CL (MIC range, 16–64 μg/ml) and 35 (67.3%) showed a high level of resistance to TS (Table 1). All isolates were sensitive to VA (MIC range, 0.25–0.75 μg/ml) and QDA (MIC 0.25–1.0 μg/ml).

Among the tested MLSb-positive isolates of C. pseudodiphtheriticum, 7 (12.1%) displayed resistance only to CL, 9 (15.5%) were resistant only to TS, and 26 (44.8%) from 58 strains showed simultaneous resistance to both antibiotics. The MLSb mechanism was observed only in 10 (17.3%) isolates of C. pseudodiphtheriticum (Table 2).

Table 2.

The Number of Macrolide, Lincosamide, and Streptogramin B–Positive Corynebacterium pseudodiphtheriticum Isolates with Resistance to Chloramphenicol and Trimethoprim/Sulfamethoxazole

	Total
C. pseudodiphtheriticum	(n = 58)	(n = 100%)
MLSb negative	6	10.3
MLSb positive	52	89.7
MLSb positive (only)	10	17.3
MLSb positive with simultaneous resistance to CL	7	12.1
MLSb positive with simultaneous resistance to TS	9	15.5
MLSb positive with simultaneous resistance to CL and TS	26	44.8

Discussion

On the basis of our research, C. pseudodiphtheriticum isolates have a high level of resistance to macrolide, lincosamide, and streptogramin B, indicating the MLSb-constitutive type of resistance mechanism. To confirm the phenotype observation, detection of the erm(X) gene responsible for this type of resistance was performed by the PCR method.

The genetic tests confirmed the presence of the erm(X) gene in all strains in which the phenotype MLSb resistance was observed. In relation to this, the constitutive MLSb resistance mechanism in C. pseudodiphtheriticum is strictly related to the presence of the erm(X) gene.

Occurrence of the erm(X) gene was previously described in reference to C. diphtheriae,⁹ C. jeikeium,^17,23 C. xerosis,²⁶ C. striatum,²¹ and C. amycolatum²⁸ strains. However, such a high percentage (as in this work) of C. pseudodiphtheriticum isolates with the MLSb resistance mechanism has never been reported.

Transfer of the erm(X) genes within the bacterial genome among Corynebacterium species differs. The erm(X) genes showed plasmid pNG2,¹⁴ and plasmid pTP10²⁶ association and integration within the chromosome^21,23 or localization within transposon Tn5432.¹⁹ However, in other tested strains, in which the MLSb resistance mechanism was not associated with the presence of erm(X) genes within transposon Tn5432, the components of Tn5432 were discovered within the bacterial chromosome.²⁶ It suggests the possible process of rearrangement of Tn5432.¹² Further, the IS1249 mobile insertion sequence, in which the presence of the erm(X) genes was confirmed, can create a much larger composite of extrachromosomal DNA. Newly created transposon can carry other drug-resistant genes. This process appears to be very alarming because the transposase of IS1249 is known to have the ability to insert Tn5432 sequence into the genomes of unrelated bacteria.²³

The genetic diversity in localization of the erm(X) genes suggests that highly resistant strains of Corynebacterium acquire genes from commonly found bacteria colonizing the mucosal membrane and the skin. However, the source of the genes remains unknown.

Among the C. diphtheriae strains, the erm gene is plasmid pNG2 associated. The pNG2 plasmid is similar to other plasmids isolated from Corynebacterium sp., which are commonly found on human skin.²⁵ However, this plasmid appears to be less likely the source of the erm genes for Corynebacterium species. In this case, more probable is the chromosome-integrated mobile Tn5432 transposon.²⁶

The Tn5432 transposon element was also confirmed among Propionibacterium acnes, Propionibacterium avidum, and Propionibacterium granulosum commonly found on human skin. It suggests that multidrug-resistant Corynebacterium strains might be the natural reservoir of resistant genes in horizontal gene transfer process.²⁴

The presence of the erm(X) gene was also discovered among Corynebacterium sp. strains that were isolated from pasteurized milk. The strains were also highly resistant to EM and/or spiramycin.¹⁸ It suggests the possibility for gene transfer from/to species found in animal flora.

The high percentage (89.7%) of C. pseudodiphtheriticum isolates with the confirmed MLSb resistance mechanism reported in this work suggests that this mechanism is very common within this species. This discovery suggests the need to consider the MLSb resistance mechanism while selecting drugs for medical treatment. Further, such a high percentage of MLSb-positive isolates among C. pseudodiphtheriticum suggests that the species can play a significant role as an environmental reservoir of the resistance mechanism in the process of distribution among other organisms colonizing skin, throat, or mucosa.

References

Arthur

, Nolinas

, Mabilat

, Courvalin

1990. Detection of erythromycin resistance by the polymerase chain reaction using primers in conserved region of erm rRNA methylase genes. Antimicrob. Agents Chemother., 10:2024–2026.

Belmares

, Detterline

, Pak

J.B.

, Parada

J.P.

2007. Corynebacterium endocarditis species-specific risk factors and outcomes. BMC Infect. Dis., 7:4.

Cantarelli

V.V.

, Brodt

T.C.

, Secchi

, Inamine

, de S Pereira

2008. Cutaneous infection caused by Corynebacterium pseudodiphtheriticum: a microbiological report. Rev. Inst. Med. Trop. Sao Paulo, 50:51–52.

Chiner

, Arriero

J.M.

, Signes-Costa

, Marco

, Corral

, Gomez-Esparrago

, Ortiz de la Tabla

, Martin

1999. Corynebacterium pseudodiphtheriticum pneumonia in an immunocompetent patient. Monaldi Arch. Chest Dis., 54:325–327.

Chudnicka

, Szmygin-Milanowska

, Kieszko

, Milanowski

, Kozioł-Montewka

2003. The role of opportunistic species of Corynebacterium pseudodiphteriticum in the pathogenesis of CAP (Community Acquired Pneumonia) Ann. Univ. Mariae Curie Skłodowska, 58:142–148.

Clinical, Laboratory Standards Institute. 2009. Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria; Approved Guideline. M45-A. 26,19 Clinical and Laboratory Standards Institute: Wayne, PA, 18–19.

Clinical, Laboratory Standards Institute. 2009. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically; Approved Standard—Eighth Edition. M07-A8. 29,2 Clinical and Laboratory Standards Institute: Wayne, PA, 22–26.

Coyle

M.B.

, Lipsky

B.A.

1990. Coryneform bacteria in infectious diseases: clinical and laboratory aspects. Clin. Microbiol. Rev., 3:227–246.

Coyle

M.B.

, Minshew

B.H.

, Bland

J.A.

, Hsu

P.C.

1979. Erythromycin and clindamycin resistance in Corynebacterium diphtheriae from skin lesion. Antimicrob. Agents Chemother., 16:525–527.

10.

Freeman

J.D.

, Smith

H.L.

, Haines

H.G.

, Hellyar

A.G.

1994. Seven patients with respiratory infection due to Corynebacterium pseudodiphtheriticum. Pathology, 26:311–314.

11.

Funke

, von Graevenitz

, Clarridge

J.E.

III , Bernard

K.A.

1997. Clinical microbiology of coryneform bacteria. Clin. Microbiol. Rev., 10:125–159.

12.

Hall

R.M.

, Collis

C.M.

, Kim

M.J.

, Partridge

S.R.

, Recchia

G.D.

, Stokes

H.W.

1999. Mobile gene cassettes and integrons in evolution. Ann. N.Y. Acad. Sci., 870:68–80.

13.

Hemsley

, Abraham

, Rowland-Jones

1999. Corynebacterium pseudodiphtheriticum—a skin pathogen. Clin. Infect. Dis., 29:938–939.

14.

Hodgson

A.L.

, Krywult

, Radford

A.J.

1990. Nucleotide sequence of the erythromycin resistance gene from the Corynebacterium plasmid pNG2. Nucleic Acids Res., 18:1891.

15.

Johnson

A.P.

, Mushtaq

, Warner

, Livermore

D.M.

2004. Activity of daptomycin against multi-resistant Gram-positive bacteria including enterococci and Staphylococcus aureus resistant to linezolid. Int. J. Antimicrob. Agents, 24:315–319.

16.

, Lal

2000. Corynebacterium pseudodiphtheriticum keratitis and conjunctivitis: a cas report. Clin. Exp. Ophthalmol., 28:60–61.

17.

Martaresche

, Fournier

P.E.

, Jacomo

, Gainnier

, Boussuge

, Drancourt

1999. A case of Corynebacterium pseudodiphtheriticum nosocomial pneumonia. Emerg. Infect. Dis., 5:722–723.

18.

Perrin-Guyomard

, Soumet

, Leclercq

, Doucet-Populair

, Sanders

2005. Antibiotic susceptibility of bacteria isolated from pasteurized milk and characterization of macrolide-lincosamide-streptogramin resistance genes. J. Food Prot., 2:347–352.

19.

Pitcher

, Johnson

, Allerberger

, Woodford

, George

1990. An investigation of nosocomial infection with Corynebacterium jeikeium in surgical patients using a ribosomal RNA gene probe. Eur. J. Clin. Microbiol. Infect. Dis., 9:643–648.

20.

Rivero

, Quereda

, Martin-Davila

, Moya

J.L.

, Navas

, Moreno

2003. Endocarditis due to Corynebacterium pseudodiphtheriticum. Enferm. Infect. Microbiol. Clin., 21:117–119.

21.

Roberts

M.C.

, Leonard

R.B.

, Briselden

, Schoenknecht

F.D.

, Coyle

M.B.

1992. Characterization of antibiotic-resistant Corynebacterium striatum strains. J. Antimicrob. Chemother., 30:463–474.

22.

Roberts

M.C.

, Sutcliffe

, Courvalin

, Jensen

L.B.

, Rood

, Seppala

1999. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resitance determinants. Antimicrob. Agents Chemother., 43:2823–2830.

23.

Rosato

A.E.

, Lee

B.S.

, Nash

K.A.

2001. Inducible macrolide resistance in Corynebacterium jeikeium. Antimicrob. Agents Chemother., 7:1982–1989.

24.

Ross

J.I.

, Eady

A.A.

, Carnegle

, Cove

J.H.

2002. Detection of transposon Tn5432- mediated macrolide-lincosamide-streptogramin B (MLSB) resistance in cutaneus propionibacterie from six European cities. J. Antimicrob. Chemother., 49:165–168.

25.

Serwold-Davis

T.M.

, Groman

N.B.

1986. Mapping and cloning of Corynebacterium diphtheriae plasmid pNG2 and characterization of ist relatedness to plasmids from skin coryneforms. Antimicrob. Agents Chemother., 30:69–72.

26.

Tauch

, Kassing

, Kalinowski

, Pühler

1995. The erythromycin resistance gene of the Corynebacterium xerosis R-plasmid pTP10 also carrying chloramphenicol, kanamycin and tetracycline resistance is capable of transposition in Corynebacterium glutamicum. Plasmid, 33:168–179.

27.

Utach

, Kassing

, Kalinowski

, Puhler

1995. The Corynebacterium xerosis composite transposon Tn5432 consists of two identical insertion sequences, designated IS1249, flanking the erythromycin resistance gene ermcx. Plasmid, 34:119–131.

28.

Yague Guirao

, Mora Peris

, Martinez-Toldos

M.C.

, Rodriguez Gonzalez

, Valero Guillen

P.L.

, Segovia Hernandez

2005. Implication of ermX genes in macrolide- and telithromycin-resistance in Corynebacterium jeikeium and Corynebacterium amycolatum. Rev. Esp. Quimioter., 3:136–242.