Fecal Colonization of Enterobacteriaceae Carrying Plasmid-Mediated Quinolone Resistance Determinants in Korea

Abstract

The aims of the current study were to investigate the prevalence and molecular characteristics of plasmid-mediated quinolone resistance (PMQR) genes from colonizing fecal organisms and to compare the incidence and subtype of these genes according to bacterial species and hospital at five tertiary-care hospitals in Korea. A total of 500 nonduplicated clinical isolates of Enterobacteriaceae were obtained from fecal specimens at five tertiary-care hospitals between March and May 2008. The PMQR genes (qnrA, qnrB, qnrS, aac(6′)-Ib-cr, and qepA) were amplified by PCR and confirmed by direct sequencing of the PCR products. A total of 83 (16.6%) qnr-positive isolates were detected. The prevalence rates of qnrA, qnrB, and qnrS were 1.4%, 13.6%, and 1.6%, respectively. The species distributions of qnrB-positive isolates were Klebsiella pneumoniae (37/109; 33.9%), Citrobacter freundii (10/34; 29.4%), Citrobacter braakii (8/13; 61.5%), and Escherichia coli (8/275; 2.9%). Sixteen subtypes of qnrB were detected, including seven novel variants. The prevalences of aac(6′)-Ib-cr and qepA were 15.6% (n=78) and 0.6% (n=3), respectively. The aac(6′)-Ib-cr gene was detected in 39 (47.0%) of 83 qnr-positive isolates and 39 (9.4%) of 417 qnr-negative isolates There was one qepA variant containing a novel mutation (Ala231Val). The prevalence of PMQR genes was high in Enterobacteriaceae from stool specimens in Korea, and there was a close relation between qnr and aac(6′)-Ib-cr.

Introduction

Quinolone resistance usually results from mutations in the genes encoding DNA gyrase or topoisomerase IV or efflux pump enhancement.^6,25 The first plasmid-mediated quinolone resistance (PMQR) determinant, qnrA, was identified in a clinical isolate of Klebsiella pneumoniae in the United States,¹³ and other qnr determinants, qnrB and qnrS, were detected in many Enterobacteriaceae soon thereafter.^5,8 Two other PMQR genes, aac(6′)-Ib-cr and qepA, have been identified. The aac(6′)-Ib-cr gene encodes a new type of the common aminoglycoside acetyltransferase that modifies fluoroquinolones,²² and the qepA gene encodes a 14- transmembrane-segment efflux pump belonging to the major facilitator subfamily.³¹ These two additional genes confer reduced susceptibility to fluoroquinolones such as ciprofloxacin and norfloxacin. The PMQR genes are frequent worldwide in clinical isolates of Enterobacteriaceae, especially Enterobacter species, K. pneumoniae, and Escherichia coli.^{7,9,11,12,20,21,24,27–29}

Enterobacteriaceae are commonly isolated from clinical specimens and are an important cause of healthcare-associated infections. The intestinal tract is a natural reservoir of Enterobacteriaceae, and clinical infection is closely related to the organisms colonizing the intestinal tract.^1,18 Therefore, fecal colonization may play a critical role in the high frequency of PMQR in clinical isolates of Enterobacteriaceae. However, previous studies focused primarily on the detection of PMQR in clinical isolates, and there are only a few data on the prevalence and molecular characteristics of PMQR from fecal colonization.^14,15 The aims of this study were to investigate the prevalence and molecular characteristics of PMQR genes in fecal organisms and to compare the incidence and subtype of these genes according to bacterial species and hospital at five tertiary-care hospitals in Korea.

Materials and Methods

Strains

Between March and May 2008, 500 nonduplicated clinical isolates of Enterobacteriaceae were isolated from fecal specimens at five tertiary-care Korean hospitals: Gyeongsang National University Hospital (GS; n=100), Inje University Busan Paik Hospital (IJ; n=100), Keimyung University Dongsan Medical Center (KM; n=100), Ulsan University Hospital (US; n=100), and Yeungnam University Medical Center (YN; n=100). All specimens originated from feces used for stool culture performed routinely to investigate infectious diarrhea. All specimens were inoculated on MacConkey agar, and only one colony of the predominant strain showing a pinkish color was selected from each sample. To exclude nonfermentative bacilli, oxidase production was tested on the blood agar plate. All isolates were identified using routine laboratory protocols such as conventional biochemical tests and the Vitek system (BioMeriéux, Hazelwood, MO). We used 16S rRNA gene sequencing if necessary. All isolates were stored in skim milk at−70°C for later additional molecular and microbiological study.

Plasmid-mediated quinolone resistance

The qnr determinants, qnrA, qnrB, and qnrS, were screened by multiplex PCR and sequencing as described by Cattoir et al.² We found several new mutations showing similarity with qnrB subtypes. So, we designed new primer sets for sequencing to verify these variants and used them in various combinations. The primer sets were as follows: qnrB1-F, qnrB1-R, qnrB1a-F, qnrB1a-R, qnrB4-F, qnrB4-R, qnrB4a-F, and qnrB4a-R (Table 1). The PCR conditions were 5 min at 94°C and 35 cycles of amplification consisting of 30 sec at 94°C, 30 sec at 60°C, and 30 sec at 72°C with 5 min at 72°C for the final extension.

Table 1.

Primers Used in This Study

Gene	Primer name	Sequence (5′→3′)	Source or reference
qnrA	QnrAm-F	AGAGGATTTCTCACGCCAGG	2
	QnrAm-R	TGCCAGGCACAGATCTTGAC
qnrB	QnrBm-F	GGMATHGAAATTCGCCACTG	2
	QnrBm-R	TTTGCYGYYCGCCAGTCGAA
qnrS	QnrSm-F	GCAAGTTCATTGAACAGGGT	2
	QnrSm-R	TCTAAACCGTCGAGTTCGGCG
aac(6′)-Ib-cr	aac(6′)-Ib-cr-F	TTGCGATGCTCTATGAGTGGCTA	16
	aac(6′)-Ib-cr-R	CTCGAATGCCTGGCGTGTTT
qepA	QEPA-F	GCAGGTCCAGCAGCGGGTAG	30
	QEPA-R	CTTCCTGCCCGAGTATCGTG
qnrB	qnrB1-F	GGCATTGAAATTCGCCACT	This study
	qnrB1-R	TGGTCAGATCGCAATGTGTG
	qnrB1a-F	AACACCAGATTTAACGCACATTT
	qnrB1b-R	GGGCGGACACTATTGTATAAGG
	qnrB4-F	TTAGTTGGCGAAAAAATTGACAG
	qnrB4-R	GAATTGGTCAAATCACAGTGC
	qnrB4a-F	AGGCGAAATTTAATCAGAAAAA
	qnrB4a-R	CCGGTCAGGTATGGTGTTCA

A 199-bp product of qepA was amplified by PCR with primers described by Yamane et al.³⁰ A 482-bp product of aac(6′)-Ib-cr was amplified by PCR with primers by Robicsek et al.¹⁶ Reaction mixes without a DNA template served as negative controls. All PCR products were purified with the QIAquick gel extraction kit (Qiagen GmbH, Hilden, Germany) and confirmed by direct sequencing of PCR products.

Susceptibility testing and conjugation experiment

The PMQR (qnr, qepA, and aac(6′)-Ib-cr)-positive isolates were subjected to susceptibility testing against the following five antimicrobials in cation-adjusted Mueller–Hinton broth (BD, Sparks, MD): nalidixic acid, ciprofloxacin, norfloxacin, levofloxacin, and moxifloxacin by using the broth microdilution method recommended by the Clinical and Laboratory Standards Institute (CLSI).³ The minimum inhibitory concentrations (MICs) were determined after incubation at 35°C for 24 hr in ambient air. Escherichia coli ATCC 25922 was used as a control strain. The interpretive criteria were those published in the relevant CLSI documents.⁴

Twenty-six strains revealing ciprofloxacin MIC 128 μg/ml or more were selected for conjugation experiments with azide-resistant E. coli J53 Az^R as the recipient among qnr-positive Enterobacteriaceae isolates from stool.¹¹ Transconjugants were selected on trypticase soy agar plates containing ampicillin (100 μg/ml), gentamicin (10 μg/ml), or nalidixic acid (8 μg/ml) for selection of plasmid-encoded determinants. Sodium azide (300 μg/ml) was used for counterselection.

Results

The 500 nonduplicated clinical isolates of Enterobacteriaceae included E. coli (n=275), Klebsiella species (n=144), Enterobacter species (n=22), and Citrobacter species (n=59). A total of 83 (16.6%) qnr-positive isolates were detected, with K. pneumoniae (n=39) being the most common (Table 2).

Table 2.

Prevalence of qnr Genes in Enterobacteriaceae Isolates

	No. of qnr-positive isolates (%)
Qnr variant	E. coli (n=275)	Klebsiella pneumonia (n=109)	K. ornithinolytica (n=16)	K. oxytoca (n=19)	Citrobacter braakii (n=13)	Citrobacter freundii (n=34)	Citrobacter koseri (n=12)	E. cloacae (n=8)	E. aerogenes (n=4)	Total (n=500)
qnrA	3 (1.1)	1 (0.9)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	2 (25.0)	1 (25.0)	7 (1.4)
qnrB	8 (2.9)	37 (33.9)	2 (12.5)	1 (5.3)	8 (61.5)	10 (29.4)	1 (8.3)	1 (12.5)	0 (0)	68 (13.6)
qnrS	7 (2.5)	1 (0.9)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	8 (1.6)
Total	18 (6.5)	39 (35.8)	2 (12.5)	1 (5.3)	8 (61.5)	10 (29.4)	1 (8.3)	3 (37.5)	1 (25.0)	83 (16.6)

The qnrB genes were the most prevalent (13.6%). Among these, the most common was qnrB4 (26/68; 38.2%) followed by qnrB1 (21/68; 30.9%), qnrB10 (7/68; 10.3%), and others (14/68; 20.6%) (Table 3). The species distributions of qnrB-positive isolates were K. pneumoniae (37/109; 33.9%), Citrobacter freundii (10/34; 29.4%), Citrobacter braakii (8/13; 61.5%), and E. coli (8/275; 2.9%). In this study, there were seven new qnrB variants among eight isolates. It is notable that all of these variants originated from C. freundii (n=4) or C. braakii (n=4). These new variants possessed one to six amino acid substitutions in the qnr genes. Among these, the qnr sequences of six variants of seven strains were confirmed by PCR and sequencing that used newly designed primers. We used these new primer pairs in various combinations, because no specific primer set can detect all new variants. For these six new variants, the nucleotide sequences have been submitted to the GenBank database (GenBank Accession Nos. HM439641, HM439642, HM439643, HM439649, HM439650, JN166689, and JN166690) and acquired new numbers of qnrB27 (two strains), qnrB28, qnrB29, qnrB30, qnrB40, and qnrB41 (www.lahey.org/qnrstudies/). For the remaining new variants, we found one mutation in the internal region of the qnrB gene. However, we were unable to amplify the whole sequence, so we describe it as qnrB8-like (V6I) (GenBank Accession No. JN166688). The qnr-positive rates at the five hospitals were between 12% and 20%. In three hospitals, qnrB4 was the most common; but in two hospitals, qnrB1 was the most common, and in one of these two hospitals, qnrB4 was not detected.

Table 3.

Distribution of qnr Subtypes in Enterobacteriaceae Isolates

	E. coli	K. pneumoniae	K. ornithinolytica	K. oxytoca	C. braakii	C. freundii	C. koseri	E. cloacae	E. aerogenes	Total
qnrA1	3	1						2	1	7
qnrB1		19	1				1			21
qnrB2	1									1
qnrB4	6	17	1	1				1		26
qnrB6						1				1
qnrB8						1				1
qnrB9						1				1
qnrB10	1				4	2				7
qnrB13						1				1
qnrB16		1								1
qnrB8 like (V6 I)						1				1
qnrB27					2					2
qnrB28						1				1
qnrB29						1				1
qnrB30					1					1
qnrB40					1					1
qnrB41						1				1
qnrS1	7	1								8
Total	18	39	2	1	8	10	1	3	1	83

The prevalence of aac(6′)-Ib-cr was 15.6% (n=78) among 500 Enterobacteriaceae. Of the 82 aac(6′)-Ib genes detected, 95.1% (n=78) were aac(6′)-Ib-cr. The aac(6′)-Ib-cr gene was most prevalent in K. pneumoniae (33.0%; 36/109) followed by Enterobacter aerogenes (25.0%; 1/4), Klebsiella ornithinolytica (18.8%; 3/16), E. coli (12.4%; 34/275), and others (Table 4). The aac(6′)-Ib-cr was most common in E. coli at two hospitals but was most common in K. pneumoniae at two other hospitals. Interestingly, at one hospital, aac(6′)-Ib-cr was not detected.

Table 4.

Prevalence of aac(6′)-Ib-cr and Its Association with qnr Subtypes

	E. coli (n=275)	K. pneumonia (n=109)	K. ornithinolytica (n=16)	C. freundii (n=34)	C. koseri (n=12)	E. aerogenes (n=4)	E. cloacae (n=8)	Total (%)
qnrA1	3	1				1	1	6 (7.7)
qnrS1	3	1						4 (5.1)
qnrB1		17	1		1			19 (24.4)
qnrB4	4	5						9 (11.5)
qnrB8				1				1 (1.3)
qnr negative	24	12	2	1				39 (50)
Total	34	36	3	2	1	1	1	78 (15.6)

Aac(6′)-Ib-cr was detected in 39 (47.0%) of 83 qnr-positive isolates and in 39 (9.4%) of 417 qnr-negative isolates (Table 4). In the same manner, qnr genes were detected in 39 (50.0%) of 78 aac(6′)-Ib-cr-positive isolates and in 44 (10.4%) of 422 aac(6′)-Ib-cr negative isolates. The ratio of qnr genes among the aac(6′)-Ib-cr-positive isolates was higher in qnrA1 (85.7%; 6/7) and qnrB1 (90.5%; 19/21) than in the other qnr genes. One isolate carried qnrS1, aac(6′)-Ib-cr, and qepA simultaneously. The qepA gene was detected in only three isolates (0.6%), including E. coli (n=2) and Klebsiella oxytoca (n=1). We confirmed the qepA variant containing a novel mutation (Ala231Val) in one of the two E. coli by sequencing.

Qnr-positive K. pneumoniae and E. coli isolates showed high resistance rates to fluoroquinolones. However, the resistance rates of C. freundii to the five quinolones were lower by 10% to 40% than those of E. coli or K. pneumoniae, and there were no resistant strains among qnr-positive C. braakii (Table 5). Two qepA-positive isolates, including one E. coli carrying qnrS1 and aac(6′)-Ib-cr simultaneously, showed high-level resistance to the quinolones. However, one E. coli carrying a qepA-like gene was susceptible to all the drugs. The PMQR could be transferred by conjugation from only 3 of the 26 selected qnr-positive strains. Three transconjugants were carrying qnrA1, qnrB10, or qnrS1. There was an increase of 4- to 32-fold relative to the recipient, E. coli J53 Az^R, for the ciprofloxacin MICs of the transconjugants. The MICs for the three other fluoroquinolones of the transconjugants were increased 8- to 32-fold.

Table 5.

Susceptibility to Five Quinolones of qnr-Positive Enterobacteriaceae Isolates

	MIC (μg/ml)			No. (%)
	50	90	Range	S	I	R
K. pneumoniae (39)
Nalidixic acid	32	>512	8 to >512	4 (10.3)	13 (33.3)	22 (56.4)
Ciprofloxacin	4	128	<0.03 to >512	3 (7.7)	4 (10.3)	32 (82.1)
Norfloxacin	8	256	0.25 to >512	11 (28.2)	9 (23.1)	19 (48.7)
Levofloxacin	1	128	0.125 to 512	22 (56.4)	1 (2.6)	16 (41.0)
Moxifloxacin	2	128	0.5 to 512	14 (35.9)	0 (0)	25 (64.1)
Escherichia coli (18)
Nalidixic acid	>512	>512	4 to >512	1 (5.6)	1 (5.6)	16 (88.9)
Ciprofloxacin	256	>512	0.25 to >512	4 (22.2)	0 (0)	14 (77.8)
Norfloxacin	512	>512	0.5 to >512	4 (22.2)	0 (0)	14 (77.8)
Levofloxacin	32	128	0.25 to 128	4 (22.2)	0 (0)	14 (77.8)
Moxifloxacin	64	128	0.5 to 128	2 (11.1)	0 (0)	16 (88.9)
C. freundii (10)
Nalidixic acid	16	>512	4 to >512	4 (40)	2 (20)	4 (40)
Ciprofloxacin	<0.03	2	<0.03 to 32	8 (80)	1 (10)	1 (10)
Norfloxacin	0.25	4	0.06 to 64	9 (90)	0 (0)	1 (10)
Levofloxacin	0.125	2	<0.03 to 16	9 (90)	0 (0)	1 (10)
Moxifloxacin	0.5	4	0.06 to 32	7 (70)	0 (0)	3 (30)
C. braakii (8)
Nalidixic acid	8	16	4 to 16	6 (75.0)	2 (25.0)	0 (0)
Ciprofloxacin	0.06	0.06	<0.03 to 0.06	8 (100)	0 (0)	0 (0)
Norfloxacin	0.25	0.5	0.06 to 0.5	8 (100)	0 (0)	0 (0)
Levofloxacin	0.25	0.5	<0.03 to 0.5	8 (100)	0 (0)	0 (0)
Moxifloxacin	0.5	1	0.125 to 1	8 (100)	0 (0)	0 (0)

MIC, minimum inhibitory concentration; S, susceptible; I, intermediate resistant; R, resistant.

Discussion

Although the positive rates of qnr and their subtypes are different among countries and bacterial species, the prevalence of PMQR is increasing worldwide.^{7,11,20,21,23,24} Our results are similar to those of previous studies of the prevalence of qnr in Enterobacteriaceae isolated from clinical specimens in Korea.^17,26 Many qnr variants described in the previous reports were detected in this study, and the qnr subtypes and their prevalence in stool specimens were not different from those of other clinical specimens. It is necessary to evaluate the interrelations between fecal colonization by qnr-positive strains and qnr-positive strains in clinical specimens.

It is interesting that the prevalence rates of qnr genes also were high in Enterobacteriaceae other than K. pneumoniae and E. coli. The authors call attention to the high rates of qnr genes in C. braakii and C. freundii: 61.5% (8/13) and 29.4% (10/34), respectively. However, the most common qnrB variant, qnrB4, was not detected in Citrobacter, and there were no isolates containing qnrA or qnrS among Citrobacter species.

The authors identified additional characteristic findings in Citrobacter species containing qnr genes. There were 12 subtypes of qnrB variants in this species. This is striking, because only a few subtypes of qnrB were detected in other genera. In addition, 7 of 12 qnrB variants were new, having 1 to 6 novel mutations. We needed to design new primer pairs to analyze additional sequences of qnrBi, because the primer pair for qnrB screening amplifies only the internal segments. Any specific primer set cannot detect all strains showing new variants, so we designed a few primer pairs and used them in various combinations. The experiments of new primers were different for each strain. One strain was amplified only by the qnrB4a-F/qnrB4a-R primer set, whereas the other strain was amplified by four primer combinations such as qnrB1a-F/qnrB1-R, qnrB1a-F/qnrB1b-R, qnrB4-F/qnrB4a-R, and qnrB4a-F/qnrB4a-R. We could detect four and three of the seven new variants by using the qnrB1a-F/qnrB1b-R and qnrB4a-F/qnrB4aR primer pairs, respectively. Finally, we could analyze the additional qnr sequences of six variants by PCR and sequencing that used the newly designed primers,

Qnr determinants were detected in 13∼20% of Enterobacteriaceae in stool from each hospital, and there was no significant difference in the qnr prevalence among the five hospitals. However, the species distribution of qnr-positive isolates was different. Also, we found a difference in the subtypes of qnrB at each hospital. That is, qnrB4 was most common in three hospitals; but qnrB1 was most common in two hospitals, and qnrB4 was not detected in one hospital. In one hospital, the type and subtype of qnr genes from fecal colonization were similar to those from clinical isolates in a previous report,²⁶ so we presumed that fecal colonization by qnr-positive strains would be related to the prevalence of qnr in clinical specimens.

In the United States, aac(6′)-Ib-cr was detected in 44 (14.1%) of 313 Enterobacteriaceae isolates, most of which were E. coli.¹⁶ In this study, the aac(6′)-Ib-cr gene was detected in 78 (15.6%) of 500 clinical isolates. However, the species distributions of these isolates were different from those in previous reports.^9,10,16 The aac(6′)-Ib-cr gene was more prevalent in K. pneumoniae (33.0%) than in E. coli (12.3%). This gene was also prevalent in K. ornithinolytica (18.8%) and E. aerogenes (25.0%), but the total number of isolates was too small to statistically estimate the prevalence of this gene. In this study, we confirmed that aac(6′)-Ib-cr was present in 47.0% of qnr-positive isolates, but in only 9.4% of qnr-negative strains. From these data, we presume that there is a close relation between the qnr and aac(6′)-Ib-cr genes. All of the qepA and qepA2 had been detected in E. coli in previous studies,^19,31 but one qepA gene in this study was found in K. oxytoca. In addition, in E. coli, the authors discovered a qepA variant having a novel mutation (Ala231Val).

The resistance rates of E. coli containing both qnr and aac(6′)-Ib-cr were higher than in qnr-only isolates, but lower than in the aac(6′)-Ib-cr-positive strains. In contrast, the resistance rates of K. pneumoniae containing both qnr and aac(6′)-Ib-cr were higher than the resistance rate of aac(6′)-Ib-cr-only isolates, but lower than that of qnr-positive strains. So, we concluded that individual qnr and aac(6′)-Ib-cr genes increase the MICs to fluoroquinolones, but they do not have a direct influence on the susceptibility of isolates. Nevertheless, we should keep watch on the emergence and spread of PMQR genes because of the growing use of fluoroquinolones and the high prevalence of these genes in pathogens.

There are a few limitations of this study. The main purpose was to evaluate fecal colonization of Enterobacteriaceae carrying PMQR determinants. Since there are too many bacterial species and strains in one fecal sample and qnr-carrying strains were mainly discovered in E. coli, Klebsiella species, and Enterobacter species from clinical isolates in previous reports, we selected only one colony of the predominant strain showing a pinkish color in this study. However, by doing this, we could not detect PMQR determinants from all lactose-negative Enterobacteriaceae, and there is the possibility that we failed to detect significant nonpredominant strains in the same specimen. Thus, the actual rates of PMQRs colonization might be higher than found in this study. In addition, the high prevalence of aac(6′)-Ib-cr among K. pneumoniae can be related to clonality. Aac(6′)-Ib-cr was detected in K. pneumoniae from four of the five hospitals, and they showed different susceptibility patterns to quinolones, so we presumed that they were not clonal, but we did not confirm this.

In conclusion, we have demonstrated that the prevalence of PMQR was high in Enterobacteriaceae from stool specimens in Korea. The qnrB4 and qnrB1 subtypes were most prevalent, and seven unknown qnrB variants were detected. It is suggested that there is a close relation between the qnr and aac(6′)-Ib-cr genes.

Footnotes

Acknowledgment

This work was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science, and Technology (MEST) (KRF-2007-331-E00208).

Disclosure Statement

No competing financial interests exist.

References

Brumfitt

1991. The Garrod lecture. Progress in understanding urinary infections. J. Antimicrob. Chemother., 27:9–22.

Cattoir

, Poirel

, Rotimi

, Soussy

C.J.

, Nordmann

2007. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J. Antimicrob. Chemother., 60:394–397.

Clinical, Laboratory Standards Institute. 2006. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; approved standard-seventh edition. Clinical and Laboratory Standards Institute: Wayne. PA.

Clinical, Laboratory Standards Institute. 2009. Performance standards for antimicrobial susceptibility testing; nineteenth informational supplement. Clinical and Laboratory Standards Institute: Wayne. PA.

Hata

, Suzuki

, Matsumoto

, Takahashi

, Sato

, Ibe

, Sakae

2005. Cloning of a novel gene for quinolone resistance from a transferable plasmid in Shigella flexneri 2b. Antimicrob. Agents Chemother., 49:801–803.

Jacoby

G.A.

2005. Mechanisms of resistance to quinolones. Clin. Infect. Dis., 41,Suppl 2:S120–S126.

Jacoby

G.A.

, Chow

, Waites

K.B.

2003. Prevalence of plasmid-mediated quinolone resistance. Antimicrob. Agents. Chemother., 47:559–562.

Jacoby

G.A.

, Walsh

K.E.

, Mills

D.M.

, Walker

V.J.

, Oh

, Robicsek

, Hooper

D.C.

2006. qnrB, another plasmid-mediated gene for quinolone resistance. Antimicrob. Agents Chemother., 50:1178–1182.

Karah

, Poirel

, Bengtsson

, Sundqvist

, Kahlmeter

, Nordmann

, Sundsfjord

, Samuelsen

2010. Plasmid-mediated quinolone resistance determinants qnr and aac(6′)-Ib-cr in Escherichia coli and Klebsiella spp. from Norway and Sweden. Diagn. Microbiol. Infect. Dis., 66:425–431.

10.

Kim

H.B.

, Park

C.H.

, Kim

C.J.

, Kim

E.C.

, Jacoby

G.A.

, Hooper

D.C.

2009. Prevalence of plasmid-mediated quinolone resistance determinants over a 9-year period. Antimicrob. Agents Chemother., 53:639–645.

11.

Mammeri

, Van De Loo

, Poirel

, Martinez-Martinez

, Nordmann

2005. Emergence of plasmid-mediated quinolone resistance in Escherichia coli in Europe. Antimicrob. Agents Chemother., 49:71–76.

12.

Martinez-Martinez

, Eliecer Cano

, Manuel Rodriguez-Martinez

, Calvo

, Pascual

2008. Plasmid-mediated quinolone resistance. Expert Rev. Antiinfect. Ther., 6:685–711.

13.

Martinez-Martinez

, Pascual

, Jacoby

G.A.

1998. Quinolone resistance from a transferable plasmid. Lancet, 351:797–799.

14.

Pallecchi

, Riccobono

, Mantella

, Bartalesi

, Sennati

, Gamboa

, Gotuzzo

, Bartoloni

, Rossolini

G.M.

2009. High prevalence of qnr genes in commensal enterobacteria from healthy children in Peru and Bolivia. Antimicrob. Agents Chemother., 53:2632–2635.

15.

Paniagua

, Valverde

, Coque

T.M.

, Baquero

, Canton

2010. Assessment of prevalence and changing epidemiology of extended-spectrum beta-lactamase-producing Enterobacteriaceae fecal carriers using a chromogenic medium. Diagn. Microbiol. Infect. Dis., 67:376–379.

16.

Park

C.H.

, Robicsek

, Jacoby

G.A.

, Sahm

, Hooper

D.C.

2006. Prevalence in the United States of aac(6′)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob. Agents Chemother., 50:3953–3955.

17.

Park

Y.J.

, Yu

J.K.

, Lee

, Oh

E.J.

, Woo

G.J.

2007. Prevalence and diversity of qnr alleles in AmpC-producing Enterobacter cloacae, Enterobacter aerogenes, Citrobacter freundii and Serratia marcescens: a multicentre study from Korea. J. Antimicrob. Chemother., 60:868–871.

18.

Pena

, Pujol

, Ardanuy

, Ricart

, Pallares

, Linares

, Ariza

, Gudiol

1998. Epidemiology and successful control of a large outbreak due to Klebsiella pneumoniae producing extended-spectrum beta-lactamases. Antimicrob. Agents Chemother., 42:53–58.

19.

Perichon

, Courvalin

, Galimand

2007. Transferable resistance to aminoglycosides by methylation of G1405 in 16S rRNA and to hydrophilic fluoroquinolones by QepA-mediated efflux in Escherichia coli. Antimicrob. Agents Chemother., 51:2464–2469.

20.

Robicsek

, Jacoby

G.A.

, Hooper

D.C.

2006. The worldwide emergence of plasmid-mediated quinolone resistance. Lancet Infect. Dis., 6:629–640.

21.

Robicsek

, Sahm

D.F.

, Strahilevitz

, Jacoby

G.A.

, Hooper

D.C.

2005. Broader distribution of plasmid-mediated quinolone resistance in the United States. Antimicrob. Agents Chemother., 49:3001–3003.

22.

Robicsek

, Strahilevitz

, Jacoby

G.A.

, Macielag

, Abbanat

, Park

C.H.

, Bush

, Hooper

D.C.

2006. Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase. Nat. Med., 12:83–88.

23.

Robicsek

, Strahilevitz

, Sahm

D.F.

, Jacoby

G.A.

, Hooper

D.C.

2006. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother., 50:2872–2874.

24.

Rodriguez-Martinez

J.M.

, Poirel

, Pascual

, Nordmann

2006. Plasmid-mediated quinolone resistance in Australia. Microb. Drug Resist., 12:99–102.

25.

Ruiz

2003. Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection. J. Antimicrob. Chemother., 51:1109–1117.

26.

Shin

J.H.

, Jung

H.J.

, Lee

J.Y.

, Kim

H.R.

, Lee

J.N.

, Chang

C.L.

2008. High rates of plasmid-mediated quinolone resistance QnrB variants among ciprofloxacin-resistant Escherichia coli and Klebsiella pneumoniae from urinary tract infections in Korea. Microb. Drug Resist., 14:221–226.

27.

Shin

S.Y.

, Kwon

K.C.

, Park

J.W.

, Song

J.H.

, Ko

Y.H.

, Sung

J.Y.

, Shin

H.W.

, Koo

S.H.

2009. Characteristics of aac(6′)-Ib-cr gene in extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolated from Chungnam area. Korean J. Lab. Med., 29:541–550.

28.

Strahilevitz

, Jacoby

G.A.

, Hooper

D.C.

, Robicsek

2009. Plasmid-mediated quinolone resistance: a multifaceted threat. Clin. Microbiol. Rev., 22:664–689.

29.

Wang

, Tran

J.H.

, Jacoby

G.A.

, Zhang

, Wang

, Hooper

D.C.

2003. Plasmid-mediated quinolone resistance in clinical isolates of Escherichia coli from Shanghai, China. Antimicrob. Agents Chemother., 47:2242–2248.

30.

Yamane

, Wachino

, Suzuki

, Arakawa

2008. Plasmid-mediated qepA gene among Escherichia coli clinical isolates from Japan. Antimicrob. Agents Chemother., 52:1564–1566.

31.

Yamane

, Wachino

, Suzuki

, Kimura

, Shibata

, Kato

, Shibayama

, Konda

, Arakawa

2007. New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob. Agents Chemother., 51:3354–3360.