Prevalence of Plasmid-Mediated Quinolone Resistance and Mutations in the Gyrase and Topoisomerase IV Genes in Salmonella Isolated from 12 Tertiary-Care Hospitals in Korea

Abstract

Background: The aim of this study was to investigate the prevalence of plasmid-mediated quinolone resistance (PMQR) and mutations in quinolone resistance-determining regions (QRDRs) of Salmonella and their association with fluoroquinolone susceptibility in Korea. Methods: A total of 284 nonduplicated clinical isolates of Salmonella were collected from various clinical specimens at 12 tertiary-care hospitals in Korea. The qnrA, qnrB, and qnrS genes were detected by multiplex polymerase chain reaction (PCR). The qepA and aac(6′)-Ib-cr genes were amplified by PCR. The QRDRs of gyrA, gyrB, parC, and parE were amplified by PCR from the DNA of selected nalidixic acid-resistant and qnr-positive isolates. Results: We detected six qnr-positive Salmonella (four qnrS1 and two qnrB19) and one aac(6′)-Ib-cr–positive strain. A mutation in the QRDR of gyrA only (N=46) was the most common, followed by gyrA+parC (N=9), parC (N=7), gyrA+parE (N=3), parC+parE (N=3), gyrA+gyrB (N=2), and parE (N=1). There were seven novel mutations in the QRDR regions of gyrB, parC, and parE. Six of seven PMQR-positive isolates had high-level resistance to nalidixic acid, and all six strains had reduced susceptibility to ciprofloxacin. One qnrS1-positive isolate was resistant to ciprofloxacin, norfloxacin, and nalidixic acid. The resistant rates to nalidixic acid, ciprofloxacin, norfloxacin, and levofloxacin were 49.3%, 1.1%, 0.7%, and 0.4%, respectively. Conclusion: We report the first detection of PMQR in Salmonella isolates from Korea. It is essential to continue surveillance and to watch for the spread of PMQR in Salmonella for public health control.

Introduction

Resistance to quinolones in Salmonella is caused mainly by target gene mutations or mutations affecting drug accumulation.⁵ Fluoroquinolone resistance is a result of mutations in the quinolone resistance–determining region (QRDR) of gyrA in Salmonella. Although mutations in gyrB, parC, and parE do not play an important role in quinolone resistance, they contribute to the acquisition of high-level resistance.^18,24,27 The main mutations of gyrA in Salmonella are found in codons Ser83 and Asp87, whereas mutations in the gyrB and topoisomerase IV genes parC and parE are rarely detected.^10,17,25

After the first plasmid-mediated quinolone resistance (PMQR) in qnrA was reported in a clinical isolate of Klebsiella pneumoniae from the United States in 1988,²¹ other PMQRs of the pentapeptide repeat family, qnrB and qnrS, have been detected in many Enterobacteriaceae, including K. pneumoniae and Escherichia coli from the United States and Shigella flexneri from Japan.^12,15,16 Moreover, two other PMQR genes, aac(6′)-Ib-cr and qepA, which encode a new type of the common aminoglycoside acetyltransferase and a 14-transmembrane-segment efflux pump, respectively, have been identified.^26,32 The aac(6′)-Ib-cr gene was rarely detected in Salmonella isolates from humans, and there is only a few reports concerning the qepA gene in Salmonella isolates.^8,19,29

Salmonella is one of the most important causes of gastroenteritis in humans and is still a serious threat to global public health. Fluoroquinolones are commonly given for invasive and systemic infection by Salmonella.¹³ In recent years, the number of fluoroquinolone-resistant or reduced-susceptibility Salmonella isolates has increased worldwide as a consequence of the extensive use of these drugs.

PMQR as a result of qnr genes is common in Enterobacteriaceae, and these genes have also been found in Salmonella isolates from humans in United States, United Kingdom, China, and Japan.^{8,11,14,29,30} There was a report of high rates of PMQR, qnrB variants, among ciprofloxacin-resistant E. coli and K. pneumoniae in Korea.^23,28 However, the PMQR qnr gene was not detected in Salmonella clinical isolates in Korea.⁴

In this study, we investigated the prevalence of PMQR and mutations in QRDRs of gyrA, gyrB, parC, and parE of Salmonella and their association with fluoroquinolone susceptibility in Korea.

Materials and Methods

Strains

A total of 284 nonduplicated clinical isolates of Salmonella from various clinical specimens were collected from 12 tertiary-care hospitals in Korea from Seoul in the north to Jeju in the south between January 2008 and December 2008. The specimens consisted of stool (N=214), blood (N=60), urine (N=3), pus (N=2), abscess (N=1), ascites fluid (N=1), bile (N=1), and others (N=2). These strains were identified according to each laboratory's routine protocols with conventional biochemical tests and serotyping. The hospitals were Ajou University Medical Center (AJ; N=28), Asan Medical Center (AS; N=25), Chonnam National University Hospital (CN; N=30), Ewha Womans University Medical Center (EW; N=35), Gyeongsang National University Hospital (GS; N=6), Inje University Busan Paik Hospital (IJ; N=25), Jeju National University Hospital (JJ; N=28), Pusan National University Hospital (PS; N=9), Ulsan University Hospital (US; N=25), Wonkwang University Hospital (WK; N=18), Yeungnam University Medical Center (YN; N=10), and Yonsei University Hospital (YS; N=44). For qnr-, aac(6′)-Ib-cr-, and qepA-positive strains, Salmonella serotypes were determined by slide agglutination according to the Kauffmann-White scheme using O and H antisera (DIFCO).¹ All isolates were stored in skim milk at −70°C for later molecular and microbiological study.

Susceptibility testing

All isolates were tested against four quinolones in cation-adjusted Mueller-Hinton broth: nalidixic acid, ciprofloxacin, norfloxacin, and levofloxacin using the broth microdilution method recommended by the Clinical and Laboratory Standards Institute (CLSI).⁶ The minimum inhibitory concentrations (MICs) were determined after incubation at 35°C for 20 hr in ambient air. E. coli ATCC 25922 was used as the control strain. The interpretive criteria were those published in the relevant CLSI document.⁷

Detection of PMQR: qnr, qepA, and aac(6′)-Ib-cr

The PMQR genes were tested in all 284 clinical Salmonella isolates. The qnrA, qnrB, and qnrS genes were detected by multiplex polymerase chain reaction (PCR). Colonies were suspended in 200 μl of distilled water in a microcentrifuge tube and boiled to prepare DNA templates. The extracted DNA was subjected to amplification by multiplex PCR with specific primers for qnr genes qnrA, qnrB, and qnrS, as described in a previous report (Table 1).² The amplicon sizes of qnrA, qnrB, and qnrS were 580, 264, and 428 bp, respectively. The PCR conditions were 10 min at 95°C and 35 cycles of amplification consisting of 1 min at 95°C, 1 min at 54°C, and 1 min at 72°C, with 10 min at 72°C for the final extension. A 199-bp product of qepA was amplified by PCR with primers QEPA-F (5′-GCAGGTCCAGCAGCGGGTAG-3′) and QEPA-R (5′-CTTCCTGCCCGAGTATCGTG-3′).³¹ The PCR conditions were 1 min at 96°C and 30 cycles of amplification consisting of 1 min at 96°C, 1 min at 60°C, and 1 min at 72°C, with 5 min at 72°C for the final extension. A 482-bp product of aac(6′)-Ib-cr was amplified by PCR with primers 5′-TTGCGATGCTCTATGAGTGGCTA-3′ and 5′-CTCGAATGCCTGGCGTGTTT-3′.²² The PCR conditions were 5 min at 94°C and 34 cycles of amplification consisting of 45 sec at 94°C, 45 sec at 55°C, and 45 sec at 72°C, with 5 min at 72°C for the final extension. A 10 pmol sample of each of primer was added to a template and PCR premix (Bioneer). Reaction mixes without a DNA template served as negative controls. The DNA fragments were analyzed by electrophoresis in a 2% agarose gel. All positive PCR specimens were purified with GeneAll Exgene™ PCR SV (GeneAll Biotechnology Co., Ltd.) and confirmed by direct sequencing of the products. Strands of the amplicons were sequenced with the same primers used for PCR amplification.

Table 1.

Primers Used in This Study

Gene	Primer name	Sequence (5′→3′)
qnrA	QnrAm-F	AGAGGATTTCTCACGCCAGG
	QnrAm-R	TGCCAGGCACAGATCTTGAC
qnrB	QnrBm-F	GGMATHGAAATTCGCCACTG
	QnrBm-R	TTTGCYGYYCGCCAGTCGAA
qnrS	QnrSm-F	GCAAGTTCATTGAACAGGGT
	QnrSm-R	TCTAAACCGTCGAGTTCGGCG
aac(6′)-Ib-cr	aac(6′)-Ib-cr-F	TTGCGATGCTCTATGAGTGGCTA
	aac(6′)-Ib-cr-R	CTCGAATGCCTGGCGTGTTT
qepA	QEPA-F	GCAGGTCCAGCAGCGGGTAG
	QEPA-R	CTTCCTGCCCGAGTATCGTG
gyrA	stgyrA1	CGTTGGTGACGTAATCGGTA
	stgyrA2	CCGTACCGTCATAGTTATCC
	gyrA1	CATGAACGTATTGGGCAATG
	gyrA2	AGATCGGCCATCAGTTCGTG
gyrB	stmgyrB1	GCGCTGTCCGAACTGTACCT
	stmgyrB2	TGATCAGCGTCGCCACTTCC
parC	stmparC1	CTATGCGATGTCAGAGCTGG
	stmparC2	TAACAGCAGCTCGGCGTATT
parE	stmparE1	TCTCTTCCGATGAAGTGCTG
	stmparE2	ATACGGTATAGCGGCGGTAG

Detection of mutations in the QRDR of gyrA, gyrB, parC, and parE

The QRDRs of gyrA, gyrB, parC, and parE were amplified by PCR from the DNA of 86 selected nalidixic acid–resistant and qnr-positive isolates (Table 1). Two pairs of PCR primers were tested for gyrA to cover the wide range of QRDR. A 251-bp product covering the QRDR of gyrA (Val70 to Thr152) was amplified with stgyrA1 (5′-CGTTGGTGACGTAATCGGTA-3′) and stgyrA2 (′CCGTACCGTCATAGTTATCC-3′).⁹ The other 255-bp product covering the QRDR of gyrA (Met52 to Leu137) was amplified with gyrA1 (5′-CATGAACGTATTGGGCAATG-3′) and gyrA2 (5′-AGATCGGCCATCAGTTCGTG-3′).¹¹ The QRDRs of gyrB, parC, and parE were also amplified as described in previous reports.^10,11 Reaction mixes without a DNA template served as negative controls. The DNA fragments were analyzed by electrophoresis in a 2% agarose gel. All amplicons were sequenced with the same primers used for amplification with ABI 3130 genetic analyzer automated DNA sequences (Applied Biosystems). The QRDR sequences of gyrA, gyrB, parC, and parE were compared with each sequence in GenBank (accession number: AE006468).

Conjugation experiment

Conjugation experiments were performed with an azide-resistant E. coli J53 Az^R as the recipient for qnr-positive strains as in previous reports.^20,28 Transconjugants were selected on TS agar plates containing sodium azide (100 μg/ml) plus ampicillin (100 μg/ml), gentamicin (10 μg/ml), or tetracycline (8 μg/ml). Transconjugants were tested against four quinolones by the broth microdilution method.

Results

Antimicrobial susceptibility results

Of the 284 Salmonella isolates, 140 (49.3%) were resistant to nalidixic acid, and the resistance rates to ciprofloxacin, norfloxacin, and levofloxacin were 1.1%, 0.7%, and 0.4%, respectively (Table 2). Among these 140 nalidixic acid-resistant isolates, 132 (94.29%) had decreased susceptibility to ciprofloxacin (MICs ≥0.25 μg/ml but <2 μg/ml). Only three isolates were resistant to ciprofloxacin; two of these isolates were Salmonella Enteritidis, and one was Salmonella Kentucky. One Salmonella Enteritidis with both gyrA and parE mutations revealed high-level resistance to four quinolones.

Table 2.

Susceptibility to Quinolones of 284 Salmonella Isolates

	MIC (μg/ml)			No. (%)
	50	90	Range	S	I	R
Nalidixic acid	16	>512	1 to >512	127 (44.7)	17 (6)	140 (49.3)
Ciprofloxacin	0.125	1	<0.03 to 64	273 (96.1)	8 (2.8)	3 (1.1)
Norfloxacin	0.5	2	<0.03 to 256	278 (97.9)	4 (1.4)	2 (0.7)
Levofloxacin	0.125	1	<0.03 to 16	282 (99.3)	1 (0.4)	1 (0.4)

MIC, minimum inhibitory concentration; S, susceptible; I, intermediate susceptibility; R, resistant.

Prevalence and characterization of PMQR genes

The qnr genes were detected in 6 (2.1%) of 284 clinical Salmonella isolates (Table 3). Of these positive isolates, four contained qnrS1, and two had qnrB19. The qnr-positive isolates had different serotypes. The serotypes of four strains having qnrS1 were Salmonella Kedougou, Salmonella Paratyphi A, Salmonella Kentucky, and Salmonella [II4, 12,[27]:i:z35]. The two strains containing qnrB19 were Salmonella Agama and Salmonella Typhimurium. These strains were recovered from stool (N=4), blood (N=1), and urine (N=1). One qnrS1-positive strain also had a QRDR mutation of parC (T57S). No gyrA mutations were detected among the qnr-positive Salmonella isolates.

Table 3.

Characterization of Plasmid-Mediated Quinolone Resistance Gene–Positive Salmonella Isolates

							MIC (μg/ml)
Isolate	Sample	Serotype group	Serotype	qnr variant	aac(6′)-Ib-cr/qepA	QRDR mutation	NAL	CIP	NOR	LEV
YN02	Urine	G	Kedougou	qnrS1	−/−	WT	16	0.06	2	2
YN04	Blood	A	Paratyphi A	qnrS1	−/−	WT	>512	0.5	4	2
AJ07	Stool	B	Agama	qnrB19	−/−	WT	128	2	1	1
AJ08	Stool	B	Typhimurium	qnrB19	−/−	WT	128	1	2	1
US69	Stool	C	Kentucky	qnrS1	−/−	parC(T57S)	256	8	32	4
EW26	Stool	B	II4,12,[27]:i:z35	qnrS1	−/−	WT	>512	1	1	1
AS21	Stool	D	Enteritidis	—	+/−	gyrA(S83F)	>512	0.5	2	0.5

NAL, nalidixic acid; CIP, ciprofloxacin; NOR, norfloxacin; LEV, levofloxacin.

Only one isolate (0.4%) of Salmonella Enteritidis from a stool specimen carried aac(6′)-Ib-cr. No qepA-positive strains were detected. Six of seven PMQR-positive isolates had high-level resistance to nalidixic acid, and all six strains had reduced susceptibility to ciprofloxacin. One qnrS1-positive isolate was resistant to ciprofloxacin, norfloxacin, and nalidixic acid, with intermediate resistance to levofloxacin.

Mutations in the QRDR of gyrA, gyrB, parC, and parE

The mutations of QRDR were examined in 86 nalidixic acid–resistant and PMQR-positive isolates. There were 71 (82.6%) of the 86 nalidixic acid–resistant and PMQR-positive isolates containing one or more mutations encoding at least an amino acid substitution. Among these 71 isolates, 60 contained a mutation of gyrA and 2 had a QRDR mutation of gyrB. Also, 19 and 7 isolates had mutations of parC and parE, respectively. A mutation in the QRDR of gyrA only (N=46) was the most common, followed by gyrA+parC (N=9), parC (N=7), gyrA+parE (N=3), parC+parE (N=3), gyrA+gyrB (N=2), and parE (N=1). The types and prevalence of gyrA mutations were different from those previously described.¹⁰ A total of 51 isolates showed an amino acid substitution at codon Asp87 to either Gly (N=26), Tyr (N=15), or Asn (N=10). Eight and one isolate contained Ser83Phe substitutions and a Glu133Gly substitution, respectively (Table 4). The gyrA mutation was highly prevalent in Salmonella Enteritidis (34/35) and Salmonella Typhimurium (13/15) compared with other serotypes (13/36). In addition, the amino acid substitution of QRDR in gyrA was different according to serotype. Salmonella Enteritidis had a high prevalence of Asp87Gly (N=22), but Salmonella Typhimurium was more likely to have Asp87Tyr (N=9). Of the 19 isolates showing parC mutations, 17 revealed the amino acid substitution Thr57Ser. Three isolates revealed a novel mutation in parC of Gly72Cys, and one had a double mutation in parC at Thr57Ser and Gly72Cys. Also, 9 and 3 of the 19 isolates with parC mutations revealed amino acid substitution in gyrA and parE, respectively. Only 2 of the 86 isolates had gyrB point mutations with the amino acid substitutions Gly434Leu (Salmonella enterica Enteritidis) and Gly447Cys (Salmonella enterica Hillingdon), which are novel. Both of them also contained a mutation in gyrA. Of the 86 isolates, 7 showed parE mutations of Glu459Thr (N=5) or Gly468Cys (N=1), including 1 isolate showing a double mutation of Arg507Ile and Lys514Asn (N=1). All seven of the parE mutations were novel, and six of them had an amino acid substitution in gyrA or parC.

Table 4.

Quinolone Resistance–Determining Region Mutations in Salmonella Isolates

Mutation		No. of strains
gyrA (46)
	Asp87Gly	20
	Asp87Tyr	12
	Asp87Asn	9
	Ser83Phe	4
	Glu133Gly	1
parC (7)
	Thr57Ser	7
parE (1)
	Gly468Cys	1
gyrA, gyrB (2)
	Asp87Gly, Gly434Leu	1
	Asp87Gly, Gly447Cys	1
gyrA, parC (9)
	Asp87Gly, Thr57Ser	1
	Asp87Gly, Gly72Cys	1
	Asp87Asn, Gly72Cys	1
	Asp87Tyr, Thr57Ser	2
	Ser83Phe, Thr57Ser	4
gyrA, parE (3)
	Asp87Gly, Glu459Thr	2
	Asp87Tyr, Glu459Thr	1
parC, parE (3)
	Thr57Ser, Glu459Thr	1
	Thr57Ser, Arg507Ile, Lys514Asn	1
	Thr57Ser, Gly72Cys, Glu459Thr	1

Conjugation experiment of PMQR positive isolates

Transconjugants were selected with a few antimicrobial agents. The PMQR could be transferred by conjugation from two of the six qnr-positive strains (Table 5). Both of the transconjugants were carrying the qnrB19 subtype. The MIC of ciprofloxacin for the transconjugants was 0.06 μg/ml, representing an increase of 7.5-fold relative to the recipient, E. coli J53 Az^R. The MICs of other antimicrobial agents either showed no difference or demonstrated an increase of twofold relative to the recipient.

Table 5.

Quinolone Susceptibility of qnr-Positive Isolates and Transconjugants Among Salmonella Isolates

			MIC (μg/ml)
	Isolate	qnr variant	NAL	CIP	NOR	LEV
Escherichia coli J53 Az^R			2	0.008	0.06	0.015
Clinical strain
Agama	AJ7	qnrB19	128	1	1	1
Typhimurium	AJ8	qnrB19	128	1	2	1
Transconjugant
Agama	AJ7-T	qnrB19	4	0.06	0.06	0.015
Typhimurium	AJ8-T	qnrB19	2	0.06	0.125	0.015

Discussion

Fluoroquinolones are important in treating serious infections caused by Salmonella. In recent years, resistance to nalidixic acid increased significantly in this organism, but high-level resistance to fluoroquinolones is rare even now.³ However, the CLSI Guidelines⁷ indicate that fluoroquinolone-susceptible, but nalidixic acid–resistant, Salmonella may cause clinical failure or delayed response in extraintestinal salmonellosis treated with a fluoroquinolone, so the rate of resistance to nalidixic acid as well as to other fluoroquinolones should be monitored. The resistance rates to ciprofloxacin, levofloxacin, and norfloxacin were 1.1%, 0.4%, and 0.7%, respectively, in our study, and this means that resistance is still uncommon. This result is similar to that in previous reports.^11,30 However, the resistance rate to nalidixic acid in Salmonella was 49.3%, a surprising result. In a previous report from Korea,⁴ the resistance rates to nalidixic acid rose from 1.8% (1/55) between 1995 and 1996 to 21.8% (45/206) between 2000 and 2002. The Salmonella tested in this study were isolated in 2008, so we can assume that resistance to nalidixic acid is increasing in Korea rapidly.

There were considerable differences in the prevalence of qnr in Salmonella according to country or geographic region. The prevalence of qnr in France was low, with only 0.2% of isolates (1/516) being positive for qnrA.³ On the other hand, qnrS-positive strains were detected at a high rate (5%) without qnrA and qnrB in the United Kingdom. However, in the United States, qnr-positive Salmonella were detected in 10 (0.08%) of 12,253 isolates from 1996 to 2003; this figure increased to 0.3% in the isolates submitted in 2004–2006.^11,29 Gay et al.¹¹ reported only qnrB- or qnrS-positive isolates without qnrA-positive isolates and variant types of qnr that were qnrB2 (Salmonella Mbandaka), qnrB5 (Salmonella Berta), qnrS1 (Salmonella Bovismorbificans), and qnrS2 (Salmonella Anatum). All 10 isolates were resistant to nalidixic acid and had decreased ciprofloxacin susceptibility. In the second study, performed in 2004–2006 by Sjolund-Karlsson et al.,²⁹ qnrS1 was the most common (N=11), although other qnr genes such as qnrB5 (N=4), qnrB2 (N=1), and one qnrA1 were detected. In Korea, Choi et al.⁴ could find the qnr gene in none of 261 clinical isolates of Salmonella. However, we detected six qnr-positive clinical isolates among 284 samples (2.1%). This is the first report of the prevalence of qnr in Salmonella from Korea. In addition, we prospectively collected Salmonella isolates from 12 university hospitals nationwide, and thus, we believe that our results reveal the actual prevalence of qnr genes in Korea. Moreover, we could verify that qnr genes are not uncommon in clinical isolates of Salmonella in Korea. We have already reported qnr-positive isolates from E. coli and K. pneumoniae.²⁸ Of the 41 qnr-positive Enterobacteriaceae strains, 37, 3, and 1 had qnrB4, qnrB2, and qnrB6, respectively. However, the variant types of qnr from Salmonella consisted of four qnrS1 and two qnrB19, indicating that qnr subtypes in Salmonella differ from those of other Enterobacteriaceae, because Salmonella are acquired in the community. Although aac(6′)-Ib-cr–containing isolates were common among Enterobacteriaceae, the prevalence of aac(6′)-Ib-cr was low in Salmonella.²⁹ The aac(6′)-Ib-cr was detected in only one Salmonella isolate from Korea, the first such report, and no isolate carried the qepA gene.

Five gyrA mutations were detected in three codons: Ser83, Asp87, and Glu133, all of which have been described in previous reports.¹⁰ However, the authors discovered some differences in the incidence of gyrA mutations from earlier studies. Mutation of gyrA was more prevalent at Ser83 (57%) than Asp87 (39%) in the study by Eaves et al.,¹⁰ whereas a mutation at Asp87 was the most common, accounting for about 85% of the mutations. On the other hand, the gyrA mutation at Ser83 accounted for only 13.3% in this study. Also, one gyrA mutation was detected at Glu133.

For QRDR mutations in gyrB and parE, Ling et al.¹⁸ presented no example of gyrB and only one isolate with a mutation in parE. Eaves et al.¹⁰ also showed lower rates of gyrB (5/182) and parE (14/182) mutations. In our study, 2 and 7 of 86 isolates showed a mutation in gyrB and parE, respectively. These are similar to data in previous reports and revealed that mutations in gyrB and parE are still less common than gyrA and parC mutations. For parC mutations, a report from Hong Kong by Ling et al.¹⁸ found that all parC mutations at Thr57 involved conversion to Ser. The results of Eaves et al.¹⁰ from the United Kingdom were similar to those in the report of Ling et al., with most mutations involving conversion to Ser at Thr57. The mutations in parC in 17 of 19 isolates in this study were Thr57Ser, with 1 isolate having a double mutation of Thr57Ser and Gly72Cys. These data are similar to those in the previous two reports. Nine and 3 of the 19 isolates with parC mutations revealed amino acid substitution in gyrA and parE, respectively. However, this study's samples were different from those in the United Kingdom: in this study, strains were collected from human sources, whereas most of those in the United Kingdom were collected from animals.

We discovered seven novel mutations in QRDR of gyrB, parC, and parE among the 12 isolates, which is worthy of notice. Only 2 of 86 isolates revealed gyrB point mutations, with amino acid substitutions of Gly434Leu (Salmonella enterica Enteritidis) and Gly447Cys (Salmonella enterica Hillingdon). Both of them are novel mutations and were associated with a mutation in gyrA. A novel mutation in parC of Gly72Cys was revealed in three isolates, and one of them exhibited a double mutation in parC at Thr57Ser and Gly72Cys. Of the 86 isolates, 7 showed parE mutations at Glu459Thr (N=5) and Gly468Cys (N=1), with 1 having a double mutation of Arg507Ile and Lys514Asn. All of these are previously unreported. Six of seven isolates with parE mutations also had an amino acid substitution in gyrA or parC.

Cattoir et al.³ from France detected only one qnrA-positive strain without qnrB or qnrS, and this isolate was not related to mutation of the QRDRs in gyrA, gyrB, parC, or parE. In the report of Gay et al.,¹¹ gyrB and parC mutations were common in qnr-positive isolates, and no gyrA mutations were detected among the qnr-positive Salmonella isolates. Those investigators also reported that none of the gyrB and parC mutations was linked to quinolone resistance. In the present study, gyrA and gyrB were not detected among qnr-positive strains, and we detected only one parC mutation among six qnr-positive isolates and one gyrA mutation of one aac(6′)-Ib-cr–positive isolate. This study also indicated that the qnr-positive isolates were not related to mutation of QRDRs. However, one isolate harboring qnrS1 and a parC mutation at Thr57Ser was resistant to all four quinolones without mutation of QRDR in gyrA. It is known that neither qnrS1 nor mutation in parC is related to high-level fluoroquinolone resistance. We could not confirm the resistance mechanism of this isolate, because we could not conjugate the strain. However, it can be assumed that both qnrS1 and the mutation in parC or the novel mutation in parC are associated with fluoroquinolone resistance, although more precise investigation is necessary to confirm their role. We also found one isolate expressing not only aac(6′)-Ib-cr but also a gyrA mutation, but these had no effect on the MICs of fluoroquinolones.

The mutations of QRDR were examined in 86 selected nalidixic acid–resistant and PMQR-positive strains in this study. They include 69 of 124 strain showing nalidixic acid MICs ≥256 μg/ml and all of 16 strains showing nalidixic acid MICs between 32 and 128 μg/ml. Six of seven PMQR-positive strains were included in the above groups, and the remaining one strain was qnrS1 positive, but nalidixic susceptible. We did not examine all nalidixic acid–resistant strains and this is a limitation of this study. In addition, 14 of 85 nalidixic acid–resistant strains did not have any mutations in gyrA, gyrB, parC, or parE, and we could find similar results in previous reports.^4,30 Although we did not figure out the reasons, it is possible that a decrease in the permeability of the outer membrane protein loss or other unknown resistance mechanisms contribute to the resistance to nalidixic acid and this needs further evaluation.

In conclusion, we report the first detection of PMQR in Salmonella isolates from Korea. We detected six qnr-positive Salmonella (four qnrS1 and two qnrB19) and one aac(6′)-Ib-cr–positive strain. There were seven types of a novel mutation in the QRDR regions of gyrB, parC, and parE. It is essential to continue surveillance and to monitor for spread of PMQR in Salmonella for public health control.

Footnotes

Acknowledgment

This work was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science, and Technology (MEST; KRF-2007-331-E00208).

Disclosure Statement

No competing financial interests exist.

References

Brenner

F.M.

1998. Identification and Serotyping of Salmonella. National Salmonella Reference Laboratory: Centers for Disease Control and Prevention, Atlanta, GA.

Cattoir

, Poirel

, Rotimi

, Soussy

C.J.

, Nordmann

2007. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J. Antimicrob. Chemother., 60:394–397.

Cattoir

, Weill

F.X.

, Poirel

, Fabre

, Soussy

C.J.

, Nordmann

2007. Prevalence of qnr genes in Salmonella in France. J. Antimicrob. Chemother., 59:751–754.

Choi

S.H.

, Woo

J.H.

, Lee

J.E.

, Park

S.J.

, Choo

E.J.

, Kwak

Y.G.

, Kim

M.N.

, Choi

M.S.

, Lee

N.Y.

, Lee

B.K.

, Kim

N.J.

, Jeong

J.Y.

, Ryu

, Kim

Y.S.

2005. Increasing incidence of quinolone resistance in human non-typhoid Salmonella enterica isolates in Korea and mechanisms involved in quinolone resistance. J. Antimicrob. Chemother., 56:1111–1114.

Cloeckaert

, Chaslus-Dancla

2001. Mechanisms of quinolone resistance in Salmonella. Vet. Res., 32:291–300.

Clinical, Laboratory Standards Institute. 2006. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard-Seventh Edition. Clinical and Laboratory Standards Institute: Wayne, PA.

Clinical, Laboratory Standards Institute. 2009. Performance Standards for Antimicrobial Susceptibility Testing; Nineteenth Informational Suplement. Clinical and Laboratory Standards Institute: Wayne, PA.

Cui

, Li

, Sun

, Hu

, Jin

, Li

, Guo

, Ran

, Ma

2009. Characterization of Salmonella enterica isolates from infants and toddlers in Wuhan, China. J. Antimicrob. Chemother., 63:87–94.

Eaves

D.J.

, Liebana

, Woodward

M.J.

, Piddock

L.J.

2002. Detection of gyrA mutations in quinolone-resistant Salmonella enterica by denaturing high-performance liquid chromatography. J. Clin. Microbiol., 40:4121–4125.

10.

Eaves

D.J.

, Randall

, Gray

D.T.

, Buckley

, Woodward

M.J.

, White

A.P.

, Piddock

L.J.

2004. Prevalence of mutations within the quinolone resistance-determining region of gyrA, gyrB, parC, and parE and association with antibiotic resistance in quinolone-resistant Salmonella enterica. Antimicrob. Agents Chemother., 48:4012–4015.

11.

Gay

, Robicsek

, Strahilevitz

, Park

C.H.

, Jacoby

, Barrett

T.J.

, Medalla

, Chiller

T.M.

, Hooper

D.C.

2006. Plasmid-mediated quinolone resistance in non-Typhi serotypes of Salmonella enterica. Clin. Infect. Dis., 43:297–304.

12.

Hata

, Suzuki

, Matsumoto

, Takahashi

, Sato

, Ibe

, Sakae

2005. Cloning of a novel gene for quinolone resistance from a transferable plasmid in Shigella flexneri 2b. Antimicrob. Agents Chemother., 49:801–803.

13.

Hohmann

E.L.

2001. Nontyphoidal salmonellosis. Clin. Infect. Dis., 32:263–269.

14.

Hopkins

K.L.

, Wootton

, Day

M.R.

, Threlfall

E.J.

2007. Plasmid-mediated quinolone resistance determinant qnrS1 found in Salmonella enterica strains isolated in the UK. J. Antimicrob. Chemother., 59:1071–1075.

15.

Jacoby

G.A.

, Chow

, Waites

K.B.

2003. Prevalence of plasmid-mediated quinolone resistance. Antimicrob. Agents Chemother., 47:559–562.

16.

Jacoby

G.A.

, Walsh

K.E.

, Mills

D.M.

, Walker

V.J.

, Oh

, Robicsek

, Hooper

D.C.

2006. qnrB, another plasmid-mediated gene for quinolone resistance. Antimicrob. Agents Chemother., 50:1178–1182.

17.

Lindstedt

B.A.

, Aas

, Kapperud

2004. Geographically dependent distribution of gyrA gene mutations at codons 83 and 87 in Salmonella Hadar, and a novel codon 81 Gly to His mutation in Salmonella Enteritidis. APMIS, 112:165–171.

18.

Ling

J.M.

, Chan

E.W.

, Lam

A.W.

, Cheng

A.F.

2003. Mutations in topoisomerase genes of fluoroquinolone-resistant salmonellae in Hong Kong. Antimicrob. Agents Chemother., 47:3567–3573.

19.

Lunn

A.D.

, Fabrega

, Sanchez-Cespedes

, Vila

2010. Prevalence of mechanisms decreasing quinolone-susceptibility among Salmonella spp. clinical isolates. Int. Microbiol., 13:15–20.

20.

Mammeri

, Van De Loo

, Poirel

, Martinez-Martinez

, Nordmann

2005. Emergence of plasmid-mediated quinolone resistance in Escherichia coli in Europe. Antimicrob. Agents Chemother., 49:71–76.

21.

Martinez-Martinez

, Pascual

, Jacoby

G.A.

1998. Quinolone resistance from a transferable plasmid. Lancet, 351:797–799.

22.

Park

C.H.

, Robicsek

, Jacoby

G.A.

, Sahm

, Hooper

D.C.

2006. Prevalence in the United States of aac(6′)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob. Agents Chemother., 50:3953–3955.

23.

Park

, Kang

H.K.

, Bae

I.K.

, Kim

J.S.

, Uh

, Jeong

S.H.

, Lee

2009. Prevalence of the extended-spectrum beta-lactamase and qnr genes in clinical isolates of Escherichia coli. Korean J. Lab Med., 29:218–223.

24.

Piddock

L.J.

, Ricci

, McLaren

, Griggs

D.J.

1998. Role of mutation in the gyrA and parC genes of nalidixic-acid-resistant salmonella serotypes isolated from animals in the United Kingdom. J. Antimicrob. Chemother., 41:635–641.

25.

Reyna

, Huesca

, Gonzalez

, Fuchs

L.Y.

1995. Salmonella typhimurium gyrA mutations associated with fluoroquinolone resistance. Antimicrob. Agents Chemother., 39:1621–1623.

26.

Robicsek

, Strahilevitz

, Jacoby

G.A.

, Macielag

, Abbanat

, Park

C.H.

, Bush

, Hooper

D.C.

2006. Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase. Nat. Med., 12:83–88.

27.

Ruiz

, Castro

, Goni

, Santamaria

J.A.

, Borrego

J.J.

, Vila

1997. Analysis of the mechanism of quinolone resistance in nalidixic acid-resistant clinical isolates of Salmonella serotype Typhimurium. J. Med. Microbiol., 46:623–628.

28.

Shin

J.H.

, Jung

H.J.

, Lee

J.Y.

, Kim

H.R.

, Lee

J.N.

, Chang

C.L.

2008. High rates of plasmid-mediated quinolone resistance QnrB variants among ciprofloxacin-resistant Escherichia coli and Klebsiella pneumoniae from urinary tract infections in Korea. Microb. Drug Resist., 14:221–226.

29.

Sjolund-Karlsson

, Folster

J.P.

, Pecic

, Joyce

, Medalla

, Rickert

, Whichard

J.M.

2009. Emergence of plasmid-mediated quinolone resistance among non-Typhi Salmonella enterica isolates from humans in the United States. Antimicrob. Agents Chemother., 53:2142–2144.

30.

Taguchi

, Kawahara

, Seto

, Inoue

, Hayashi

, Yamagata

, Kamakura

, Kashiwagi

2009. Plasmid-mediated quinolone resistance in Salmonella isolated from patients with overseas travelers' diarrhea in Japan. Jpn. J. Infect. Dis., 62:312–314.

31.

Yamane

, Wachino

, Suzuki

, Arakawa

2008. Plasmid-mediated qepA gene among Escherichia coli clinical isolates from Japan. Antimicrob. Agents Chemother., 52:1564–1566.

32.

Yamane

, Wachino

, Suzuki

, Kimura

, Shibata

, Kato

, Shibayama

, Konda

, Arakawa

2007. New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob. Agents Chemother., 51:3354–3360.