Functional Characterization of Quinolone-Resistant Mechanisms in a Lab-Selected Salmonella enterica Typhimurium Mutant

Abstract

Correlation has been widely accepted between quinolone resistance and topoisomerase point mutations in quinolone resistance determination regions (QRDRs). Acquirement of point mutations in QRDRs usually increases the microbial resistance to both nalidixic acid and fluoroquinolones. The quinolone-resistant mechanisms accumulated in a lab-selected mutant were characterized through the construction of isogenic mutants using phage λ Red recombinase system and phage P22. The function of a quinolone-resistant mechanism that increased resistance to fluoroquinolones, but decreased resistance to nalidixic acid was fully characterized. A previous reported point mutation in ParC (G78D) was identified in the lab-selected mutant LT2-128. Minimal inhibitory concentrations (MICs) of isogenic mutants showed that acquirement of this point mutation in the host with topoisomerase mutations in GyrA could increase 8- to 32-fold fluoroquinolones MICs, but decrease eight-fold nalidixic acid MICs. Multiple-resistant mechanisms, such as the overexpressed effluxes, were accumulated besides the point mutations in QRDRs in LT2-128 during the mutant selection process. Through biological costs comparison among isogenic mutants, we found the biological cost in LT2-128 was not from the mutations in QRDRs, instead it was from other mutations accumulated during the mutant selection process, such as the mechanisms related to constitutively overexpressed effluxes. Mutation in ParC (G78D) was responsible for the increased resistance to fluoroquinolones, but decreased resistance to nalidixic acid. The existence of this mechanism demonstrated mutations in ParC could play different roles in nalidixic acid and ciprofloxacin resistance.

Introduction

The extensive use of fluoroquinolones in the last two decades have made fluoroquinolone-resistant Salmonella enterica isolates emerging all over the world.^7,12 Previous studies have characterized the fluoroquinolone-resistant mechanisms in both Salmonella Typhimurium clinical isolates and mutants selected in vitro.^6,13,21 Correlations have been widely accepted between topoisomerase point mutations in quinolone resistance determination regions (QRDRs) and the microbial quinolone resistance.²³ Compared to nalidixic acid, fluoroquinolones often have enlarged spectra of activity as well as better intrinsic activities. Usually, acquirement of point mutations in QRDRs will raise the resistance level of both nalidixic acid and fluoroquinolones. However, a few studies have reported a peculiar profile that is susceptible to nalidixic acid, but resistant to ciprofloxacin in different species.^18–20 Till today, there is no mechanism study that thoroughly characterizes this peculiar phenotype.

In this study, the quinolone-resistant mechanism accumulated in a lab-selected fluoroquinolone-resistant mutant was characterized through homologous recombination techniques. And a mechanism causing the phenotype that decreased resistance to nalidixic acid, but increased resistance to fluoroquinolones was identified and functionally characterized.

Materials and Methods

Bacterial strains, phages, and plasmids

Salmonella Typhimurium LT2, bacteriophage P22HT105/1 int-201, and P22H5 were obtained from the National Center for Medical Culture Collections. The phage λ Red recombinase system (plasmid pKD46 and pDK4) has been described previously.⁸ All strains identified in this study were cultured in the Mueller-Hinton medium (MH) unless noted otherwise.

Selection of ciprofloxacin-resistant Salmonella Typhimurium mutant

Ciprofloxacin-resistant Salmonella Typhimurium mutant LT2-128 was selected by exposing Salmonella Typhimurium LT2 to increasing levels of ciprofloxacin in the MH broth. Briefly, 5 ml of an overnight culture of LT2 was inoculated into a 100 ml MH broth supplemented with 0.015 μg/ml ciprofloxacin. After overnight incubation, a 5 ml culture was inoculated into the 100 ml MH broth supplemented with onefold higher concentration of ciprofloxacin (0.03 μg/ml). The process was repeated stepwise until selection of culture capable of growth in the MH broth supplemented with 64 μg/ml ciprofloxacin. Cultures were then streaked on MH agar without supplements, and single colonies were selected and transferred in the MH broth without supplements for 10 times with the interval of 18–20 hours.

Salmonella Typhimurium mutant construction

The chromosomal acrB, acrF, or tolC gene was first inactivated in strain LT2 using the phage λ Red recombinase system.⁸ Briefly, PCR products were generated using a pair of long (60-nucleotide [nt]) primers (Table 1) and a special template plasmid (pKD4) carrying a kanamycin resistance gene flanked by flippase recombination enzyme target sites. The primers included 20 nt at the 5′ end for the template plasmid and 40 nt homologous extensions at the 3′ end for targeting genes. The gel-purified PCR products were electroporated into LT2 competent cells expressing the phage λ Red recombinase (pKD46), which allowed recombination in short homologous regions. The deletion mutations were transduced to LT2-128 using bacteriophage P22HT105/1 int-201 following the standard protocol and pseudolysogens were excluded by the susceptibility testing to phage P22H5.¹⁷ All mutations were confirmed by three PCRs: the loss of PCR products by using primers (Table 2) corresponding to the deleted gene sequence, which confirmed the deletion of the target gene and two PCR amplifications using primers from the kanamycin resistance gene of pKD4 and the sequences of the insertion site recommended by the gene inactivation method, which confirmed the insertion site of the kanamycin resistance gene on chromosome.⁸

Table 1.

Primers Used to Construct Gene Deletions and Insertions by Wanner's Method

Genes	Primer names	Oligonucleotide sequences (5′-3′)
acrB	AcrB-KF	GTCGAATGACTATGCTCAATATCTTCGCTTTTACGGCTAAAGCGGTGTAGGCTGGAGCTGCTTC
	AcrB-KR	ACAGAGGGTTAACGCCTCTGGCGGTCGTTCTGATGCTCTCAGGCATGGGAATTAGCCATGGTCC
acrF	AcrF-KF	CCAGGTTTTCACTCCTGCCCTCATTCATCATATTCTCTGCTGCGGTGTAGGCTGGAGCTGCTTC
	acrF-KR	ATCGGCGTTTTACAACAACGAAGAATACCGGCACGAAGAAGATAATGGGAATTAGCCATGGTCC
tolC	TolC-KF	AGAAATTGCTCCCCATCCTTATCGGCCTGAGCCTGTCGGGGTGTAGGCTGGAGCTGCTTC
	TolC-KR	TTGCCGTTATTGCTGTTGGCGCGAGCGGCGGTCGGCTGTAATGGGAATTAGCCATGGTCC
gyrA	GyrA-IF	CGAATAAAGCATTGTCTGGCTGCATTCCGTTTACCAGTACGTGTAGGCTGGAGCTGCTTC
	GyrA-IR	CCCGGATTCAAAGGTCGCAAATTATAACACATTCGCCCACATGGGAATTAGCCATGGTCC
parC	ParC-IF	TTTGTGACTCAGACCGTGAGATAGGGTATTATCTGCGGCAGTGTAGGCTGGAGCTGCTTC
	ParC-IR	GGATCCTCAATCTGCATGCTGACCGTTCGGACGGCAATATATGGGAATTAGCCATGGTCC

The underlined sequences were from template plasmid pKD4.

Table 2.

Primers Used to Confirm Gene Deletions and Insertions

Genes	Primer name	Sequence (5′-3′)	Product size (bp)
AcrB	AcrB-F	AAGAGCACGCATCACTACAC	768
	AcrB-R	CGCTTCGGACATCACGTAAA
AcrF	AcrF-F	TGCTGGCCGGTTGTAATGAC	716
	AcrF-R	CGTGCCTTTAATCGGGTAGA
TolC	TolC-F	CCGACTACACCTACAGCAAC	234
	TolC-R	AAAGCACATCAATAGCGTTC
Kan	K1	TCATAGCCGAATAGCCTCTC
AcrB	AcrB-VForward	CAGGAGAAAATAGCCAGGAA	759
AcrF	acrF-VForward	GCGTAAAGGTGGTTGCTG	1,175
TolC	TolC-VForward	TGTCTGATTTACGCATTGTG	761
GyrA	gyrA-VForward	TTGCGAAGGCGATAGAAAAG	1,340
ParC	ParC-VForward	CACAGCTCGCCGTTTCATTT	1,314
Kan	K2	CGGTGCCCTGAATGAACTGC
AcrB	acrB-VReverse	AGCGACACAGAAAATGTCCA	1,896
AcrF	AcrF-VReverse	GATTACGTCGCTGAGTATCC	1,600
TolC	tolC-VReverse	AAACTCAGCGACGCAATCTT	1,550

To determine the roles of topoisomerase mutations in quinolone resistance, individual kanamycin cassette was inserted upstream of gyrA and parC in Salmonella Typhimurium LT2 chromosome using the phage λ Red recombinase system.⁸ Gene insertions were confirmed by PCR and the primer sequences and sizes of PCR products corresponding to individual gene insertions are shown in Table 2. The insertion mutations and wild-type topoisomerase genes in LT2 were transduced by phage P22HT105/1 int-201 to LT2-128. The replacements of mutations in gyrA (S83F D87N) or parC (G78D) were screened using PCR and restriction fragment length polymorphism (RFLP) analysis as previously described.¹⁰ All the topoisomerase gene replacements were further confirmed by DNA sequencing.

Construction of Salmonella Typhimurium LT2 gyrA and parC isogenic mutants

To further determine the function of GyrA and ParC mutations, isogenic topoisomerase mutants of Salmonella Typhimurium LT2 were constructed using the phage λ Red recombinase system.⁸ Briefly, part of gyrA or parC of LT2-128 was amplified by PCR using the mutation analysis primers.¹⁰ Gel-purified gyrA PCR products were electroporated into LT2 competent cells expressing the phage λ Red recombinase and nalidixic acid-resistant (50 mg/L) cells (formed by the replacement of the wild-type gyrA with the mutated gyrA) were selected. Then, gel-purified PCR products of parC were electroporated into gyrA mutated LT2 competent cells expressing the phage λ Red recombinase and mutants were selected on MH agar supplemented with 1 mg/L of ciprofloxacin (formed by the replacement of the wild-type parC with the mutated parC). To further study the function of parC mutation, the mutated gyrA was replaced back to wild-type gyrA through phage P22 transduction. All gene replacements were first screened by RFLP tests. Putative allelic replacements were further confirmed by sequence analysis of gyrA and parC.¹⁰

Biological cost analysis of chromosomal-encoded quinolone-resistant mechanisms

The biological costs of quinolone-resistant mechanisms in LT2-128 and topoisomerase isogenic mutants were determined by direct competition against their parental strain LT2 and the generation time measurement. Briefly, an equal number (10⁷ colony forming units) of log-phase LT2 and a testing strain were coinoculated in a 5 ml MH broth and incubated at 37°C for 16–18 hours. After incubation, a 10 μl culture mixture was transferred into the 5 ml fresh MH broth every day. Concentrations of each strain were determined on the seventh day by spreading serial-diluted culture mixture onto MH agar supplemented with or without ciprofloxacin (0.125 μg/ml). The experiment was repeated 10 times independently. The bacteria generation time was determined by the measurement of optical density at 600 nm of bacteria growth in the MH medium at 37°C as a function of time.

Antimicrobial susceptibility testing

The MICs of chloramphenicol, tetracycline, nalidixic acid, ciprofloxacin, gatifloxacin, and levofloxacin were measured using the agar dilution method following the Clinical and Laboratory Standards Institute (CLSI) standard protocol.⁵ Escherichia coli ATCC 25922 was included as the quality control organism in all antimicrobial susceptibility experiments.

Results

Ciprofloxacin-resistant mutant selection and characterization

Ciprofloxacin-resistant mutant LT2-128 was selected through exposing Salmonella Typhimurium LT2 to increasing concentrations of ciprofloxacin. After 10 transfers in the MH broth without a ciprofloxacin supplement, LT2-128 remained a stable MIC to ciprofloxacin of 128 μg/ml. Compared with the parental strain Salmonella Typhimurium LT2, LT2-128 also displayed increased MICs to nalidixic acid and other fluoroquinolones as well as chloramphenicol and tetracycline (Table 3). Sequencing analysis of the QRDRs of gyrA, gyrB, parC, and parE in LT2-128 revealed point mutations in both GyrA (S83F D87N) and ParC (G78D).

Table 3.

Function Characterization of Quinolone-Specific- and NonSpecific-Resistant Mechanisms in Salmonella Typhimurium

	Substitutions in QRDRs		Antimicrobial MICs (mg/L)
Strains	GyrA	ParC	CIP	NAL	GAT	LEV	CHL	TET
LT2-128	S83F D87N	G78D	128	512	16	32	64	16
ΔacrB::KAN	S83F D87N	G78D	4	16	0.5	2	1	0.5
ΔacrF::KAN	S83F D87N	G78D	128	512	16	32	64	16
ΔtolC::KAN-1	S83F D87N	G78D	4	16	0.5	2	1	0.5
ΔtolC::KAN-2	S83F D87N	—	0.06	32	0.06	0.125	1	0.5
LT2-128-C	—	G78D	0.06	16	0.25	0.25	64	16
LT2-128-A	S83F D87N	—	2	>512	4	4	64	16
LT2	—	—	0.015	4	0.03	0.06	8	1
ΔacrB::KAN	—	—	0.0038	1	≤0.015	≤0.015	0.5	0.25
ΔacrF::KAN	—	—	0.015	4	0.03	0.06	8	1
ΔtolC::KAN	—	—	0.0038	1	≤0.015	≤0.015	0.5	0.25
LT2-A	S83F D87N	—	0.5	>512	1	0.5	8	1
LT2-C	—	G78D	0.015	4	0.06	0.06	8	1
LT2-AC	S83F D87N	G78D	16	64	8	16	8	1
LT2-AC-ΔacrB	S83F D87N	G78D	4	8	0.5	2	0.5	0.25
LT2-AC-ΔtolC-1	S83F D87N	G78D	4	4	0.5	2	0.5	0.25
LT2-AC-ΔtolC-2	S83F D87N	—	0.06	8	0.06	0.125	0.5	0.25

gyrA and parC genes were replaced by wild-type genes through phage P22 transduction and kan gene was used as selective marker.

—, no mutation detected.

QRDR, quinolone resistance determination regions; MIC, minimal inhibitory concentrations; CIP, ciprofloxacin; NAL, nalidixic acid; GAT, gatifloxacin; LEV, levofloxacin; CHL, chloramphenicol; TET, tetracycline.

Functional characterization of topoisomerase mutations in LT2-128

The functions of topoisomerase point mutations observed in LT2-128 on quinolone resistance were determined through the topoisomerase gene replacement approach by phage P22HT105 transduction. Replacement of the mutated GyrA (S83F D87N) with the wild-type allele increased quinolone susceptibility by 32- to 2,048-fold. The replacement of the mutated ParC (G78D) allele with the wild-type allele increased fluoroquinolone susceptibility by fourfold to eightfold, but decreased susceptibility to nalidixic acid (MIC>512). No MIC changes were observed for chloramphenicol and tetracycline after topoisomerase gene replacement in LT2-128 (Table 3).

Functional characterization of topoisomerase mutations in Salmonella Typhimurium LT2

To further characterize topoisomerase mutation functions, point mutations identified in GyrA (S83F, D87N) and ParC (G78D) of LT2-128 were introduced into Salmonella Typhimurium LT2 by the phage λ Red recombinase system. Isogenic mutant LT2-A that acquired double-point mutations in GyrA (S83F, D87N) were 8- to 32-fold more resistant to quinolones than its parental strain Salmonella Typhimurium LT2, but the MICs were still below the fluoroquinolone breakpoints. The isogenic mutant LT2-C that acquired a single-point mutation in ParC (G78D) showed the same quinolone MICs as its parental strain, Salmonella Typhimurium LT2. However, the isogenic mutant LT2-AC (GyrA [S83F, D87N], ParC [G78D]) automatically became resistant to all tested quinolones (Table 3). However, the quinolone MICs of LT2-AC were still twofold to eightfold lower than LT2-128, which contained the same topoisomerase mutations. Interestingly, LT2-AC (GyrA [S83F, D87N], ParC [G78D]) became more susceptible to nalidixic acid (MIC=64) compared to its isogenic mutant LT2-A (GyrA [S83F, D87N]) (MIC>512). No MIC changes were observed for chloramphenicol and tetracycline after topoisomerase gene replacement in Salmonella Typhimurium LT2.

Functional characterization of AcrAB, AcrEF, and TolC in quinolone resistance

Genes encoding efflux pump AcrB, AcrF, and the outer membrane protein TolC were individually inactivated in Salmonella Typhimurium LT2, LT2-128, and LT2-AC. Compared to the individual parental strains, the inactivation of tolC or acrB resulted in an increase in the susceptibility to both quinonlones and nonquinolone antimicrobials (Table 3), but no changes were observed after the deletion of acrF in all three Salmonella Typhimurium strains. In Salmonella Typhimurium LT2 and LT2-AC, the deletion of acrB caused a 4- to 16-fold increase in susceptibility to quinolones, chloramphenicol, and tetracycline. However, the deletion of acrB in the ciprofloxacin-selected mutant LT2-128 caused a 16- to 64-fold increase in susceptibility to quinolones, chloramphenicol, and tetracycline. Different from Salmonella Typhimurium LT2 tolC deletion mutant, tolC deletion mutants derived from LT2-128 or LT2-AC showed two groups of quinolone MICs (Table 3). The first group of tolC deletion mutants showed the same fold susceptibility increase to all antimicrobials as acrB deletion mutants. And the second group showed a higher (32- to 2,056-fold) susceptibility increase on quinolones than acrB deletion mutants. Both groups showed the same fold MIC reduction to chloramphenicol and tetracycline.

Biological costs of quinolone-resistant mechanisms

A longer generation time was observed for Salmonella Typhimurium LT2-128 (32.0±2.5 minutes, n=10) than its parental strain Salmonella Typhimurium LT2 (27.2±2.3 minutes, n=10). However, the isogenic mutant Salmonella Typhimurium LT2-A (26.9±2.1 minutes, n=10), LT2-C (27.5±2.8 minutes, n=10), and LT2-AC (27.6±2.6 minutes, n=10) demonstrated similar generation time as their parental strain Salmonella Typhimurium LT2. After a 7-day competitive test, the ratios of the parental strain LT2 and its isogenic mutant LT2-A (GyrA [S83F, D87N]), LT2-C (ParC [G78D]), or LT2-AC (GyrA [S83F, D87N], ParC [G78D]) were 0.98±0.13, 1.03±0.15, and 0.94±0.16 (n=10), respectively. However, LT2-128 was totally out-competed by its parental strain Salmonella Typhimurium LT2 at the end of the 7-day competitive test.

Discussion

Usually, increased ciprofloxacin resistance in Salmonella is also accompanied by the corresponding nalidixic acid resistance, but our study reported a resistant mechanism in a lab-selected mutant with increased ciprofloxacin resistance, but decreased nalidixic acid resistance. The functions of related quinolone-resistant mechanisms in this mutant were fully characterized through DNA recombination techniques. Previous studies have also reported isolates susceptible to nalidixic acid, but resistant to ciprofloxacin in different species,^18–20 but no specific mutations in QRDRs of topoisomerases were ever reported to be responsible for this phenotype. However, in the lab-selected mutant LT2-128, a previous reported point mutation in ParC (G78D)¹¹ was identified and the quinolone MICs of isogenic mutants constructed through homologous recombination techniques showed that acquirement of this point mutation in isolates with topoisomerase mutations in GyrA could increase the fluoroquinolone resistance, but decrease nalidixic acid resistance (Table 3). To the best of our knowledge, this is the first time characterizing a mechanism in topoisomerases increasing ciprofloxacin resistance, but decreasing nalidixic acid resistance through homologous recombination techniques. The existence of this mechanism further indicated both nalidixic acid resistance and ciprofloxacin resistance should be used in conjuction as indicators of fluoroquinolone-resistant mechanisms, instead of nalidixic acid alone as recommended in the CLSI document M100-S22.⁵ The functional characterization of this new resistant mechanism might provide a new perspective to fight fluoroquinolone- resistant isolates in antimicrobial development.

Since spontaneous triple mutations in both gyrA and parC are rare genetic events (occurring at a frequency of 10⁻¹⁴–10⁻¹⁶) in a wild-type strain,²⁶ the in vitro selected fluoroquinolone-resistant mutants had to accumulate multiple other mutations through multistep selections in the medium of gradually increased fluoroquinolone concentrations as the selection process of LT2-128, in this study. Previous studies have shown that the in vitro fluoroquinolone-resistant mutant selection process could result in overexpression of effluxes mediated by the mutations in ramR or soxR.^2,3 Similar resistant mechanisms have also been reported in clinical isolates.^4,15 Our data demonstrated multiple-resistant mechanisms, such as the overexpressed effluxes, were accumulated besides the point mutations in QRDRs of topoisomerases in LT2-128 during the selection process, since LT2-128 also showed increased resistance to other categories of antimicrobials (Table 3). And twofold to eightfold MIC differences of quinolones were observed for LT2-128 and LT2-AC that have the same topoisomerase mutations (GyrA [S83F, D87N], ParC [G78D]), but similar quinolone MIC values were observed for LT2-128-ΔacrB and LT2-AC-ΔacrB (Table 3) mutants, which further indicted the involvement of AcrB overexpression in LT2-128. In this study, a one-step selection from Salmonella Typhimurium LT2 for ciprofloxacin-resistant mutants resembling LT2-128 was unsuccessful; therefore, the selection of ciprofloxacin-resistant mutants relied on the accumulation of other mutations besides mutations in QRDRs of topoisomerases. However, the interaction mechanisms of these mutations during the mutant emergence process are not clear. It might be interesting to conduct a gene array study for a serial of quinolone selected mutants.

Our data further demonstrated the dominant role of GyrA mutations in quinolone resistance as reported in previous studies.^14,16 In LT2-128 or LT2-AC, replacement of the mutated GyrA (S83F D87N) with the wild-type allele increased quinolone susceptibility by 32- to 2,048-fold (Table 3). And the replacement of the mutated ParC (G78D) allele with the wild-type allele only increased fluoroquinolone susceptibility by fourfold to eightfold, but decreased susceptibility for nalidixic acid (Table 3). However, superimposed effect of GyrA [S83F, D87N] and either ParC (G78D) or AcrAB overexpression could bring the fluoroquinolone MICs up to the resistant level, but the specific synergistic principles of these three mechanisms were still not clear. These data further confirmed that ParC was the secondary target of quinolones as shown in E. coli.¹¹

Our study showed a biological cost of quinolone-resistant mechanisms existed in mutant LT2-128. Through biological costs comparison in isogenic mutants, we found the biological cost in LT2-128 was not from the topoisomerase mutations, instead it was from other mutations accumulated during the mutant selection process, such as mechanisms related to the overexpressed effluxes. Since topoisomerase mutations could be transferred to other isolates by phage with a low biological cost as in this study, our data offered a reasonable explanation to the wide dissemination of fluoroquinolone-resistant isolates. These data were consistent with the clinical data that fluoroquinolone-resistant isolates from patients usually accumulated multiple mutations in both gyrA and parC, instead of heavily relying on active efflux as previous reported.⁷ The traditional understanding of quinolone resistance as a stepwise mutational phenomenon has not provided a fully satisfying explanation of the multiple mutations in both gyrA and parC, our data demonstrated phage transduction might be a way that Salmonella Typhimurium to acquire more topoisomerase mutations and become fluoroquinolone resistant with a low fitness cost, especially under the selective pressure of fluoroquinolones.⁹ It should be interesting to conduct a gene array study on wild-type LT2 and isogenic mutant LT2-AC with or without quinolones.

The deletion of acrB or tolC resulted in the same folds of MIC changes to all antimicrobials in most tested strains. These data were consistent with the report that AcrB and TolC worked as a complex.²⁵ A previously reported phenomenon related to quinolone resistance was also observed when the tolC mutation was mobilized between Salmonella Typhimurium isolates through phage P22 transduction.¹ Phage P22 may mobilize more than 40 kb of DNA fragment during general transduction.²² In Salmonella Typhimurium LT2 chromosome (GenBank accession number: NC_0003197), the distance between tolC and parC was 11.6 kb. This distance was smaller than the phage P22 packing range. During phage P22 transduction, tolC deletion mutants might also have their parC replaced as observed in this study. This hypothesis was confirmed by the RFLP approach and sequencing of the QRDR of parC in several selected mutants.

In summary, mutation in ParC (G78D) was responsible for the strange nalidixic acid and fluoroquinolone-resistant phenotype in LT2-128. Our data further confirmed that mutations in topoisomerases were the dominant quinolone-resistant mechanisms. Since the acquirement of mutations in both gyrA and parC accompanied with a nondetectable biological cost, the topoisomerase-mutated Salmonella might be gradually accumulated in the environment following the extensive use of fluoroquinolones, which provided a reasonable explanation why quinolone-resistant Salmonella Typhimurium isolates became more and more popular worldwide.²⁴

Footnotes

Acknowledgments

We thank the Ministry of Science and Technology of the People's Republic of China and the National Science Foundation for supporting this study. This research was supported by a grant (2009BADB9B00) from the Ministry of Science and Technology of the People's Republic of China (http://most.gov.cn/) and a grant (30972487) from the National Natural Science Foundation of China (). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Disclosure Statement

None to declare.

References

Baucheron

, Chaslus-Dancla

, Cloeckaert

2004. Role of TolC and ParC mutation in high-level fluoroquinolone resistance in Salmonella enterica serotype Typhimurium DT204. J. Antimicrob. Chemother., 53:657–659.

Bialek-Davenet

, Marcon

, Leflon-Guibout

, Lavigne

J.P.

, Bert

, Moreau

, Nicolas-Chanoine

M.H.

2011. In vitro selection of ramR and soxR mutants overexpressing efflux systems by fluoroquinolones as well as cefoxitin in Klebsiella pneumoniae. Antimicrob. Agents Chemother., 55:2795–2802.

Chen

, Cui

, McDermott

P.F.

, Zhao

, White

D.G.

, Paulsen

, Meng

2007. Contribution of target gene mutations and efflux to decreased susceptibility of Salmonella enterica serovar Typhimurium to fluoroquinolones and other antimicrobials. Antimicrob. Agents Chemother., 51:535–542.

Chu

, Su

L.H.

, Chu

C.H.

, Baucheron

, Cloeckaert

, Chiu

C.H.

2005. Resistance to fluoroquinolones linked to gyrA and parC mutations and overexpression of acrAB efflux pump in Salmonella enterica serotype Choleraesuis. Microb. Drug Resist., 11:248–253.

Clinical, Laboratory Standards Institute. 2012. Performance Standards for Antimicrobial Susceptibility Testing: Seventeenth Informational Supplement M100-S22. CLSI: Wayne, Pennsylvania.

Cui

, Li

, Sun

, Hu

, Jin

, Guo

, Ran

, Ma

2008. Ciprofloxacin-resistant Salmonella enterica serotype Typhimurium, China. Emerg. Infect. Dis., 14:493–495.

Cui

, Li

, Sun

, Hu

, Jin

, Li

, Guo

, Ran

, Ma

2008. Characterization of Salmonella enterica isolates from infants and toddlers in Wuhan, China. J. Antimicrob. Chemother., 63:87–94.

Datsenko

K.A.

, Wanner

B.L.

2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U S A, 97:6640–6645.

Edgar

, Friedman

, Molshanski-Mor

, Qimron

2012. Reversing bacterial resistance to antibiotics by phage-mediated delivery of dominant sensitive genes. Appl. Environ. Microbiol., 78:744–751.

10.

Giraud

, Brisabois

, Martel

J.L.

, Chaslus-Dancla

1999. Comparative studies of mutations in animal isolates and experimental in vitro- and in vivo-selected mutants of Salmonella spp. suggest a counterselection of highly fluoroquinolone-resistant strains in the field. Antimicrob. Agents Chemother., 43:2131–2137.

11.

Heisig

1996. Genetic evidence for a role of parC mutations in development of high-level fluoroquinolone resistance in Escherichia coli. Antimicrob. Agents Chemother., 40:879–885.

12.

Hopkins

K.L.

, Davies

R.H.

, Threlfall

E.J.

2005. Mechanisms of quinolone resistance in Escherichia coli and Salmonella: recent developments. Int. J. Antimicrob. Agents., 25:358–373.

13.

Hsueh

P.R.

, Teng

L.J.

, Tseng

S.P.

, Chang

C.F.

, Wan

J.H.

, Yan

J.J.

, Lee

C.M.

, Chuang

Y.C.

, Huang

W.K.

, Yang

, Shyr

J.M.

, Yu

K.W.

, Wang

L.S.

, Lu

J.J.

, Ko

W.C.

, Wu

J.J.

, Chang

F.Y.

, Yang

Y.C.

, Lau

Y.J.

, Liu

Y.C.

, Liu

C.Y.

, Ho

S.W.

, Luh

K.T.

2004. Ciprofloxacin-resistant Salmonella enterica Typhimurium and Choleraesuis from pigs to humans, Taiwan. Emerg. Infect. Dis., 10:60–68.

14.

Khodursky

A.B.

, Zechiedrich

E.L.

, Cozzarelli

N.R.

1995. Topoisomerase IV is a target of quinolones in Escherichia coli. Proc. Natl. Acad. Sci. U S A, 92:11801–11805.

15.

Kim

J.Y.

, Kim

S.H.

, Jeon

S.M.

, Park

M.S.

, Rhie

H.G.

, Lee

B.K.

2008. Resistance to fluoroquinolones by the combination of target site mutations and enhanced expression of genes for efflux pumps in Shigella flexneri and Shigella sonnei strains isolated in Korea. Clin. Microbiol. Infect., 14:760–765.

16.

Luo

, Li

, Meng

, Ma

, Hu

, Jin

, Zhang

, Ding

, Cui

2011. Joint effects of topoisomerase alterations and plasmid-mediated quinolone-resistant determinants in Salmonella enterica Typhimurium. Microb. Drug Resist., 17:1–5.

17.

Maloy

S.R.

, Stewart

V.J.

, Taylor

R.K.

1996. Genetic Analysis of Pathogenic Bacteria, A Laboratory Manual. Cold Spring Harbor Laboratory Press: New York, 473–475.

18.

Moniot-Ville

, Guibert

, Moreau

, Acar

J.F.

, Collatz

, Gutmann

1991. Mechanisms of quinolone resistance in a clinical isolate of Escherichia coli highly resistant to fluoroquinolones but susceptible to nalidixic acid. Antimicrob. Agents Chemother., 35:519–523.

19.

Piddock

L.J.

, Jin

Y.F.

, Webber

M.A.

, Everett

M.J.

2002. Novel ciprofloxacin-resistant, nalidixic acid-susceptible mutant of Staphylococcus aureus. Antimicrob. Agents Chemother., 46:2276–2278.

20.

Ragunathan

P.L.

, Ison

, Livermore

D.M.

2005. Nalidixic acid-susceptible, ciprofloxacin-resistant Neisseria gonorrhoeae strain in the UK. J. Antimicrob. Chemother., 56:437.

21.

Ricci

, Tzakas

, Buckley

, Piddock

L.J.

2006. Ciprofloxacin-resistant Salmonella enterica serovar Typhimurium strains are difficult to select in the absence of AcrB and TolC. Antimicrob. Agents Chemother., 50:38–42.

22.

Snyder

, Champness

1997. Molecular Genetics of Bacteria. ASM Press, Washington, D.C., pp., 179.

23.

Strahilevitz

, Jacoby

G.A.

, Hooper

D.C.

, Robicsek

2009. Plasmid-mediated quinolone resistance: a multifaceted threat. Clin. Microbiol. Rev., 22:664–689.

24.

Streit

J.M.

, Jones

R.N.

, Toleman

M.A.

, Stratchounski

L.S.

, Fritsche

T.R.

2006. Prevalence and antimicrobial susceptibility patterns among gastroenteritis-causing pathogens recovered in Europe and Latin America and Salmonella isolates recovered from bloodstream infections in North America and Latin America: report from the SENTRY Antimicrobial Surveillance Program (2003) Int. J. Antimicrob. Agents, 27:367–375.

25.

Tamura

, Murakami

, Oyama

, Ishiguro

, Yamaguchi

2005. Direct interaction of multidrug efflux transporter AcrB and outer membrane channel TolC detected via site-directed disulfide cross-linking. Biochemistry, 44:11115–11121.

26.

Zhao

, Xu

, Domagala

, Drlica

1997. DNA topoisomerase targets of the fluoroquinolones: a strategy for avoiding bacterial resistance. Proc. Natl. Acad. Sci. U S A, 94:13991–13996.