Characterization of Enterococcus faecium with Macrolide Resistance and Reduced Susceptibility to Quinupristin/Dalfopristin in a Japanese Hospital: Detection of Extensive Diversity in erm (B)-Regulator Regions

Abstract

Cross-resistance to macrolide, lincosamide, and streptogramin B (MLS_B) antibiotics is mainly mediated by the erm (erythromycin ribosome methylation) genes that encode 23S rRNA methylases in enterococi, and various mechanisms are involved in the streptogramin B resistance. Prevalence of MLS_B resistance and its genetic mechanisms were analyzed for a total of 159 strains of Enterococcus faecium isolated from clinical specimens in a university hospital in Japan from 1997 to 2006. Resistance to erythromycin (EM) and clindamycin was detected in 88.1% and 89.9% of all the strains examined, respectively, and expression of resistance was totally constitutive. Although none of the strain was resistant to quinupristin/dalfopristin (Q/D), 28 strains (17.6%) showed intermediate resistance to Q/D (MIC: 2 μg/ml). The erm(B) gene was detected in 139 strains (87.4%), and msrC was found in all the strains examined, whereas no other known MLS_B resistance genes were identified. The erm(B) regulator region (RR) containing a coding region of the leader peptide was classified into 13 genetic variations (L1–L3, M, S1–S7, D, and R genotypes) in 56 strains. However, no relatedness was identified between the erm(B) RR genotype and EM resistance, or reduced susceptibility to Q/D, although most of Q/D-intermediate strains were assigned to the L1, L2, and S1 genotypes. Q/D-intermediate strains were classified into five multiple-locus variable-number tandem-repeat analysis (MLVA) types, including four types of clonal complex (CC)-C1, five sequence types (STs), including four STs of CC-17, and several resistance gene/virulence factor profiles. The present study revealed the occurrence of Q/D-intermediate E. faecium, which are composed of heterogeneous strains in Japan, and more genetic diversity in the erm(B) RRs than those reported previously.

Introduction

Enterococci, the normal commensals in the intestinal tract in humans and animals, have been recognized as one of the common pathogens of nosocomial infections.¹ Two enterococcal species, Enterococcus faecalis and Enterococcus faecium, account for most causes of enterococcal infections, including urinary-tract infections, intra-abdominal infections, bacteremia, and endocarditis. In addition to an intrinsic resistance to antibiotics such as cephalosporins, enterococci are known to acquire resistance to various antimicrobial agents, including ampicillin, tetracycline, macrolides, quinolones, and glycopeptides.²¹ Vancomycin-resistant enterococci (VRE) have emerged as an important nosocomial pathogen and spread globally in the last two decades. Particularly, multiple resistances to vancomycin, penicillin, and aminoglycoside (high-level resistance) have been reported to make enterococcal infections a serious and life-threatening disease, narrowing their therapeutic options.²⁸

Quinupristin/dalfopristin (Q/D), a mixture of semisynthetic streptogramin B/A compounds, is used as an efficient therapeutic option for infections caused by multiresistant gram-positive bacteria, including vancomycin-resistant E. faecium. However, resistance to Q/D in E. faecium has been found in clinical isolates from humans in several countries, and an intrahospital dissemination of Q/D-resistant E. faecium was also reported.^6,7,20,31,48 Although the detection rate is still low in humans, increase and spread of Q/D-resistant E. faecium are considered as concerns for successful therapy for VRE infections.

Both resistance mechanisms to streptogramin A and to streptogramin B are necessary for occurrence of Q/D resistance.⁴⁹ The resistance mechanism against streptogramin B (quinupristin) is related to that against macrolide and lincosamide. Resistance to macrolides in enterococci is generally due to methylation of 23S rRNA by a methylase encoded by the erm (erythromycin ribosome methylation) gene,²⁹ which confers cross-resistance to macrolide, lincosamide, and streptogramin B (MLS_B) antibiotics. Efflux of macrolides and streptogramin B is mediated by an ABC porter encoded by msrC in E. faecium.^33,40,46 Despite still a low frequency in E. faecium, streptogramin B resistance is also conferred by Vgb lactonase via destruction of the ring molecule, causing inactivation of this compound.^2,17 Resistance to streptogramin A in E. faecium is mediated by streptogramin acetyltransferases VatD and VatE.^34,51

MLS_B resistance mediated by erm-encoding methylase is inducible or constitutive, which has been shown to be related to sequence variation in the regulator region (RR) located upstream of the erm genes.⁸ Deletion, insertion, and point mutations in a leader peptide-coding region in the RR are implicated in constitutive expression of erm(A) and erm(C) in the staphylococcal and streptococcal species.^8,13 Similarly, a large deletion in the RR was identified in enterococci and streptococci, exhibiting constitutive resistance to MLS_B.^24,36 However, in enterococci, the relation of the genetic diversity in the RR to the expression mode of the erm gene is still ambiguous^23,26; therefore, further investigation is necessary in this regard.

In Japan, the frequency of VRE isolation from clinical specimens is still low (120 cases in 2010),¹⁵ and the Q/D-resistant enterococcus has not yet been reported. However, a total reported case of VRE infection has been gradually increasing recently, and hospital outbreaks are also documented.¹⁴ On the other hand, high resistance rates against macrolides were observed for E. faecium and E. faecalis in a cross-sectional study,⁵³ while their resistance mechanism has not been well characterized. MLS_B resistance due to erm(B)-encoding methylase is revealed to decrease the bactericidal activity of Q/D in vitro as well as in experimental endocarditis in rabbits.^4,11 Therefore, it is of significance to survey the resistance to macrolide and its resistance mechanisms to alert a reduced susceptibility to Q/D in E. faecium. In the present study, the prevalence of macrolides and Q/D resistances and genetic variations in the RR of the erm(B) genes was investigated for E. faecium strains isolated in a Japanese hospital.

Materials and Methods

Bacterial strains

A total of 159 clinical isolates of E. faecium were analyzed. All the strains were isolated from the specimens of patients with clinical symptoms of infection (single strain per patient), in the Sapporo Medical University Hospital, Sapporo, Japan, for four periods (January 1997–December 1998, 46 strains; January–June 2001, 11 strains; October 2002–September 2004, 83 strains; January–June 2006, 19 strains). E. faecium was identified in our previous study.⁴⁵ All the E. faecium isolates showed ampicillin resistance (MIC ≥16 μg/ml), but no strain was resistant to vancomycin. Individual bacterial strains had been stored at −80°C in Microbank^™ (PRO-LAB Diagnostics), and were recovered when they were analyzed.

Antimicrobial susceptibility testing

Minimum inhibitory concentrations (MICs) of erythromycin (EM) and Q/D were measured by a broth microdilution test and interpreted as sensitive or resistant based on the National Clinical and Laboratory Standards Institute (CLSI) guidelines.⁵ For the present study, Q/D (Synercid) was kindly provided by Astellas Pharma, Inc. Susceptibility to josamycin (JM) and clindamycin (CLDM) was examined by a disk-diffusion test. All the isolates were tested for inducible resistance using D-test as described previously.^26,54 The EM disk (15 microgram) and CLDM disk (2 microgram) and EM disk and JM disk (30 microgram) were placed 15 mm and 5 mm apart on an agar plate. After incubation for 18 hr at 37°C, D-zone formation, that is, blunting of the inhibition zone of JM or CLDM proximal to EM disk, was observed. MIC and susceptibility of EM and Q/D were determined also by E-test (BioMerieux). For the selected 21 strains, the MICs were determined for the representative antimicrobial agents (azithromycin, clarithromycin, JM, leucomycin, CLDM, ampicillin, cefoxitin, vancomycin, gentamycin, fosfomycin, tetracycline, and ciprofloxacin) by the broth microdilution test.

Detection of antimicrobial resistance genes and virulence factors by PCR

For all the strains, presence of bacterial genes that are associated with resistance to MLS_B antibiotics and reported for enterococcus, streptococcus, and staphylococcus was examined by PCR with the use of the primers published previously. Genes examined and literatures of primers were as follows: erm(A), erm(C),²⁵ erm(T),⁹ vatA-vatE, vgbA, vgbB,⁴¹ vgaA, vgaB, lnu(A), lnu(B), mef(A/E),⁶ msrAB,⁴⁰ and msrC.^46,50 Primers to detect erm(B) (ermBN1: CGAGTGAAAAAGTACTCAACCA, ermBN2: CGGTGAATATCCAAGGTACG) were designed in this study. For the representative strains, presence of the beta-lactamase gene, tetracycline resistance genes, and aminoglycoside resistance genes was examined by PCR as described previously.^25,30,45 Bacterial DNA was extracted with achromopeptidase as described previously.²² In each PCR tube, a reaction mixture (50 μl) containing 1 μl bacterial DNA, 5 units of Ex-Taq^™ DNA polymerase (TaKaRa), 200 μM each of dNTP, 30 pM each of primer, 10 mM Tris–HCl (pH8.3), 50 mM KCl, and 1.5 mM MgCl₂ was prepared. The reaction mixture in the tube was subjected to 30 PCR cycles of denaturation at 94°C (30 sec), annealing at 55°C or other temperature depending on the primers (30 sec), and primer extension at 72°C (2 min) in a thermal cycler. PCR products with specific sizes of individual resistance genes were detected by agarose gel electrophoresis and staining with ethidium bromide.

The presence of the virulence factors reported for E. faecium (agg, gelE, cylA, esp, efa-Afm, hyl, acm, cpd, cob, and ccf) in the representative strains was examined by PCR using the primers as described previously.^3,10

Sequence analysis of erm(B) and the RR of erm(B) and 23S rRNA

Full-length gene sequences of erm(B) were determined directly from PCR products with primers ermB-F1 (CAGATAACTAAAATTACAAACAAATCG) and ermB-R1 (TCTAATAATTTATCTCCATTCCCT). The RR of erm(B), which includes the coding region of the leader peptide, was amplified by PCR with the primer pairs, ermB-N2 and ermB-RR1 (CTTAGAAGCAAACTTAAGAG), or ermB-N2 and ermB-P1 (GTATAATAGGAATTGAAGTTA), for all the erm(B)-positive strains. Depending on the size of the PCR product with these primers, the strains were classified into some groups, from which representative strains were selected for sequence determination. Sequencing reaction was performed with fluorescent dideoxy-chain-termination chemistry using the BigDye Terminator version 3.1 cycle sequencing kit (Applied Biosystems). The DNA sequence was determined by the use of the ABI Prism 3100 genetic analyzer (Applied Biosystems). The secondary structures of the erm(B) RR were predicted by two Web-based programs, the mfold Web server (http://mfold.rna.albany.edu/?q=mfold) and GeneBee-Molecular Biology server (www.genebee.msu.su/genebee.html). The partial sequence of 23S rRNA domain V was determined to check the presence of mutation, by using the PCR product with the primers previously described for S. pneumoniae.⁴²

Genotyping

For selected strains, the genotype was determined by the multiple-locus variable-number tandem-repeat (VNTR) analysis (MLVA) and multilocus sequence typing (MLST), as described previously.^12,43 The MLVA Website (www.umcutrecht.nl/subsite/MLVA/) was used for MLVA type assignment. An allelic profile (allele number) was obtained from the MLST Website (www.mlst.net), and the sequence type (ST) was further analyzed to determine the clonal complex (CC) by eBURST version.3 software.

GenBank accession numbers

Sequences of erm(B) and its RR for representative 13 strains determined in the present study were deposited in the GenBank database under the accession numbers JN899582–JN899594.

Results

Resistance phenotypes and resistance genes

Resistance to EM, CLDM, and JM was detected in 140 (88.1%), 143 (89.9%), and 139 (87.4%) strains, respectively, of all the 159 E. faecium strains examined (Table 1). D-zone was not detected around the JM, CLDM, or EM disks in any strains exhibiting resistance to them, indicating that expression of resistance to these antibiotics was totally constitutive. Most of EM-resistant strains were also resistant to CLDM and JM, except for nine EM-resistant strains susceptible to CLDM and/or JM. Although none of the strain was resistant to Q/D, 28 strains (17.6%) showed intermediate resistance with an MIC of 2 μg/ml by a broth microdilution test, which was confirmed by E-test (1.5–3 μg/ml).

Table 1.

Susceptibility to Macrolide, Lincosamide, Streptogramin B Antimicrobial Agents and Presence of erm(B) in Enterococcus faecium Strains (n=159)

			erm(B)
Antimicrobial agents	Susceptibility	No. of strains (%)	+	−
Erythromycin	R	140 (88.1%)	139	1
	S	19 (11.9%)	0	19
Clindamycin	R	143 (89.9%)	137	6
	I	2 (1.3%)	1	1
	S	14 (8.8%)	1	13
Josamycin	R	139 (87.4%)	137	2
	S	20 (12.6%)	2	18
Quinupristin/	R	0	0	0
Dalfopristin	I	28 (17.6%)	26	2
	S	131 (82.4%)	113	18

S, susceptible; I, intermediately resistant; R, resistant.

Among the 18 genes related to MLS_B resistance in gram-positive cocci, only erm(B) and msrC were detected by PCR in the E. faecium strains in the present study. The erm(B) gene was detected in 139 strains (87.4%), all of which showed resistance to EM with an MIC of ≥128 micrograms/ml. In contrast, among 20 erm(B)-negative strains, six and two strains were judged as resistant to CLDM and JM, respectively. Among the 28 Q/D-intermediate strains, 26 strains possessed erm(B). The msrC was detected in most of the strains (151 strains) by PCR with a primer pair msrC3 and msrC4 described by Werner et al.⁴⁶ However, the remaining eight negative strains were PCR-positive with another primer pair,⁵² yielding PCR products with an expected size (405 bp). When PCR products from four of the eight strains were determined, the sequences were found to be 95%–99% identical to the msrC gene reported for the E. faecium strains (e.g., DO, TX1330, TX2465, and FAIR-E349) by a BLAST analysis (data not shown). Therefore, all the E. faecium strains were regarded as msrC-positive.

On the basis of the above results, a subsequent analysis was focused on the genetic diversity of erm(B) (and its regulatory region) and the reduced susceptibility to Q/D.

Sequence analysis of erm(B) and the erm(B) RR

A total of 56 strains were randomly selected from the strains showing different sizes of the PCR products from the erm(B) RR, and from different isolation periods, and different susceptibility to Q/D (susceptible or intermediate resistant). The RR sequence located upstream of erm(B) determined for the 56 strains was classified into 13 genotypes designated as L1–L3, M, S1–S7, D, R, and the alignment of individual sequences is shown in Fig. 1. Among these RR genotypes, the difference in the nucleotide length between −10 box and the erm(B) initiation codon was detected (Table 2). In the coding region of the leader peptide, partial duplication of 12 nucleotides (CAAATGCGTTAT) of S1–S7 was found in the L1–L3 types. Compared with the S1–S7 types, type M had two additional nucleotides in this region. Compared with the coding region of the leader peptide of L2 and L3 and S1–S7 (96 and 84 bp in length, respectively), considerably shorter regions were noted in the RR genotypes L1 and M due to nucleotide substitution to cause a termination codon or frameshift alteration by nucleotide insertion, respectively (Table 2 and Fig. 1). The RR genotype D was a deleted form of the genotype S1–S7 sequences, lacking a 62–bp sequence containing an initiation codon of their leader peptide regions, and has no coding region of the leader peptide. In contrast, in the genotype R, an 81-bp sequence containing a 3′-end portion of the leader peptide region was repeated tandemly (Fig. 1).

FIG. 1.

Alignment of the erm(B) regulator region (RR) sequences between −10 box (underlined) and initiation codon of erm(B) representing 13 genotypes (S1–S7, M, L1–3, D, and R). Strain names and RR genotypes are indicated on the left. The identical nucleotide to that in the sequence on the top (genotype S2) is shown by dot. Dash denotes gap. Putative amino-acid-coding region in the leader peptide is shaded. In the genotype R, a sequence with underline (an 81-bp portion that is identical to that in the parenthesis at the bottom) is inserted just after this sequence, at the site of closed triangle, forming a tandem repeat. Direct repeat sequences detected just before the repeat region and 3′-end of the repeating sequence are boxed.

Table 2.

Diversity of the Regulatory Region of erm(B) in Enterococcus faecium Strains

	Length (nucleotides)		No. of strains
RR genotype	From −10 box to erm(B)	Coding region of leader peptide	Total	Q/D-intermediate strains
L1	277	36	10	7
L2	277	96	7	3
L3	277	96	1	0
M	267	30	9	5
S1	265	84	5	1
S2	265	84	6	1
S3	265	84	2	0
S4	265	84	2	2
S5	265	84	5	1
S6	265	84	1	0
S7	265	84	4	0
D	203	0	1	0
R	346	84	3	0

Incidence of the L (L1–L3), M, and S (S1–S7) types among the 56 strains was 18, 9, and 25 strains, respectively, and the RR genotypes L1, L2, M, S1, S2, and S5 were more frequently observed (Table 2). Most of the Q/D-intermediate strains were assigned to the L1, L2, and M genotypes, although these strains belonged to seven different RR genotypes.

Although the erm(B) RR of 13 genotypes was classified into three different secondary structures that were predicted by two programs, the SD sequence of erm(B) was predicted to be located commonly within the loop of the stem–loop structures, at the proximal side to erm(B) (Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/mdr).

The sequence of the erm(B) gene open reading frame (ORF) was determined for 17 representative strains, including those with all the 13 RR genotypes, and Q/D-susceptible and Q/D-intermediate strains. Among these strains, the nucleotide difference was detected in six sites, whereas the amino acid difference in three sites (Table 3). Based on these nucleotide variations, erm(B) was divided into seven subtypes [erm(B)₁–erm(B)₇].

Table 3.

Diversity of erm(B) Open Reading Frame in Enterococcus faecium Strains

				Susceptibility		Nucleotides at codon no. (amino acid)
Strain	MLVA type	ST	erm(B) RR genotype	EM	Q/D	14	74	75	100	118	171	erm(B) subtype
e374	384	234	L1	R	I	AGT (S)	AAT (N)	ACT (T)	AAT (N)	CAT (H)	GTC (V)	1
e484	384	234	L1	R	I	AGT (S)	AAT (N)	ACT (T)	AAT (N)	CAT (H)	GTC (V)	1
e630	7	17	L2	R	S	AGT (S)	AAT (N)	ACT (T)	AAT (N)	CAT (H)	GTC (V)	1
e241	293	204	L2	R	I	AGT (S)	AAT (N)	ACT (T)	AAT (N)	CAT (H)	GTC (V)	1
e840	1		L3	R	S	AGT (S)	AAT (N)	ACT (T)	AAT (N)	CGT (R)	GTC (V)	2
e226	293	78	M	R	S	AGT (S)	AAT (N)	ACT (T)	AAT (N)	CAT (H)	GTC (V)	1
e302	283	78	M	R	I	AGT (S)	AAT (N)	ACT (T)	AAT (N)	CAT (H)	GTC (V)	1
e700	12		S1	R	S	AGT (S)	AAT (N)	ACT (T)	AAT (N)	CGT (R)	GTC (V)	2
e823	159	203	S1	R	I	AGT (S)	AAT (N)	ACT (T)	AAT (N)	CGT (R)	GTC (V)	2
e389	263		S2	R	S	AGT (S)	AAC (N)	ACT (T)	AGT (S)	CAT (H)	GTC (V)	5
e292	1		S3	R	S	AGT (S)	AAC (N)	ATT (I)	AGT (S)	CAT (H)	GTC (V)	3
e115	385	763	S4	R	I	AGC (S)	AAC (N)	ATT (I)	AGT (S)	CAT (H)	GTC (V)	6
e194	25	78	S5	R	I	AGT (S)	AAC (N)	ATT (I)	AAT (N)	CAT (H)	GTC (V)	4
e250	25		S6	R	S	AGT (S)	AAC (N)	ATT (I)	AGT (S)	CAT (H)	GTC (V)	3
e347	386	426	S7	R	S	AGT (S)	AAC (N)	ACT (T)	AAT (N)	CAT (H)	GTG (V)	7
e57	1		D	R	S	AGT (S)	AAC (N)	ATT (I)	AGT (S)	CAT (H)	GTC (V)	3
e82	385		R	R	S	AGT (S)	AAC (N)	ATT (I)	AAT (N)	CAT (H)	GTC (V)	4

Codons containing nucleotides that are different from those of strain e374 [erm(B) 1] are underlined and shown in boldface.

MLVA, multiple-locus variable-number tandem-repeat analysis; ST, sequence type; RR, regulator region; EM, erythromycin; Q/D, quinupristin–dalfopristin.

Analysis of 23S rRNA

The nucleotide sequence of 23S rRNA domain V was determined for 15 strains, including 10 Q/D-intermediate strains (eight erm(B)-positive and two erm(B)-negative strains) and five Q/D-susceptible strains (three erm(B)-positive and two erm(B)-negative strains). At three sites in the domain V where mutations associated with macrolide and streptogramin resistance had been reported for S. pneumoniae,⁴² all the 15 strains had identical nucleotides to those of the MLS-susceptible strains (Supplementary Fig. S2).

Genotyping, susceptibility, resistance gene, and virulence factors

Clonal heterogeneity and genetic traits of E. faecium strains were analyzed for 21 representative strains. Among them, erm(B)-positive 17 strains were selected from individual erm(B)-RR genotypes (one or two strains per genotype), and from strains with or without Q/D-intermediate resistance and of different origin of specimens. Four erm(B)-negative strains, two Q/D-intermediate strains, and the other two Q/D-susceptible strains derived from different specimens were also selected for this analysis.

Among the 17 erm(B)-positive strains, 10 MLVA types (MTs), including eight types grouped into CC-C1, were identified (Table 4 and Supplementary Table S1). While five types were found in the Q/D-intermediate strains, MT25, MT293, and MT385 were detected in both Q/D-susceptible and Q/D-intermediate strains. STs determined for nine Q/D-intermediate strains belonged to five types, among which four STs (ST78, ST203, ST204, and ST234) were classified into CC17. However, STs belonging to CC17 (ST17, ST78, and ST426) were also found in the Q/D-susceptible strains.

Table 4.

Genetic Traits and Antimicrobial Susceptibility of Representative Enterococcus faecium Strains

		Enterococcus faecium strains
Genotype, MIC, gene/factor		e374	e484	e630	e241	e840	e226	e302	e700	e823	e389	e292	e115	e194	e250	e347	e57	e82	e146	e515	e710	e256
	Specimens	Bile	Urine	Blood	Urine	Urine	Urine	Urine	Other	Urine	Urine	Bile	Urine	Urine	Urine	Other	Urine	Urine	Bile	Blood	Blood	Bile
Genotype
	MLVA type (MT)	384	384	7	293	1	293	293	12	159	263	1	385	25	25	386	1	385	n.t.	n.t.	10	387
	CC^a of MT	C1	C1	C1	C1	C1	C1	C1	C1	C1	C1	C1	n.a.	C1	C1	n.a.	C1	n.a.			C1	n.a.
	ST	234	234	17	204		78	78		203			763	78		426			94	234
	CC of ST	17	17	17	17		17	17		17			384	17		17			94	17
	erm(B)	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	−	−	−	−
	erm(B) RR genotype	L1	L1	L2	L2	L3	M	M	S1	S1	S2	S3	S4	S5	S6	S7	D	R
MIC (microgram/ml)
	Erythromycin	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	32	2	>256	4
	Clarithromycin	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	8	>256	8
	Azithromycin	>256	>256	>256	128	>256	256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	32
	Leucomycin	>256	>256	>256	128	>256	>256	>256	>256	>256	>256	>256	128	>256	>256	>256	>256	>256	>256	>256	>256	4
	Q/D	2^b	2^b	0.5	2^b	1	0.5	2^b	0.5	2^b	0.5	0.5	2^b	2^b	1	0.5	0.5	1	2^b	2^b	0.5	0.5
	Ampicillin	128	128	256	64	128	32	64	256	128	256	128	128	128	128	64	128	128	256	256	256	8
	Cefoxitin	>256	>256	>256	>256	>256	128	>256	>256	>256	256	>256	>256	>256	>256	>256	>256	>256	>256	>256	>256	128
	Vancomycin	0.5	0.5	1	0.5	1	1	0.5	1	1	0.5	0.5	0.5	0.5	0.5	1	0.5	0.5	0.5	0.5	1	0.5
	Gentamycin	32	32	8	16	1024	8	1024	32	1024	8	16	32	16	16	1024	8	16	16	32	1024	16
	Fosfomycin	256	>256	>256	32	>256	16	32	>256	>256	8	>256	32	64	128	32	128	128	64	128	>256	128
	Tetracycline	64	128	64	64	128	128	128	4	128	1	128	32	128	64	64	128	128	1	128	>256	2
	Ciprofloxacin	64	32	64	256	64	32	128	128	64	4	64	16	32	128	32	8	16	128	16	>256	32
Resistance gene^c	tet (L)	−	−	−	−	−	−	−	+	+	−	+	−	−	−	−	+	+	−	−	+	−
	tet (M)	+	+	+	+	+	+	+	−	+	+	+	+	+	+	+	+	+	−	+	+	−
	aac(6')-Ii	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+
	aac(6')-Ie-aph(2'')-Ia	−	−	−	−	−	−	−	−	+	−	−	−	-	−	−	−	−	−	−	+	−
	ant(6)-Ia	+	+	+	+	−	+	−	+	+	+	+	−	−	−	−	+	−	−	−	−	−
	aph(2'')-Id	−	−	−	−	−	−	−	−	−	−	−	−	−	−	+	−	−	−	−	−	−
	aph(3')-IIIa	+	+	+	+	−	+	−	+	+	+	+	−	−	−	−	+	+	−	−	−	−
Virulence factor^d	esp	+	+	+	+	+	+	+	+	+	+	+	−	+	−	−	+	−	−	+	−	−
	efaAfm	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+
	hyl	+	+	+	+	+	+	−	−	−	−	−	+	−	−	−	−	+	−	+	−	−
	acm	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+
	ccf	+	−	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	−	−	+	+

Clonal complex. CC of MT was assigned according to literature (43,51).

Intermediate resistance to Q/D.

blaZ, ant(3'')-Ia, ant(4')-Ia, ant(9)-Ia, ant(9)-Ib, aph(2'')-Ib, aph(2'')-Ic, and aac(6')-Im were not detected in any strains.

agg, gelE, cylA, cpd, and cob were not detected in any strains.

n.t., not typed; n.a., not assigned.

The representative 17 strains with erm(B) showed high MICs (>256 micrograms/ml) to the three macrolides (clarithromycin, azithromycin, and leucomycin), and were mostly resistant to beta-lactams, tetracycline, and ciprofloxacin (Table 4). Most of the strains possessed tet(M), ant(6)-Ia, and aph(3′′)-IIIa, as well as aac(6′)-Ii. erm(B)-positive strains were discriminated into seven resistance gene profiles, among which five profiles were found in the Q/D-intermediate strains. Most of the Q/D-intermediate strains were susceptible to gentamycin and/or fosfomycin. However, a Q/D-intermediate strain e823 had tet(L), tet(M), and aac(6′)-Ie-aph(2′′)-Ia, showing resistance to all the antimicrobials tested, except for vancomycin and Q/D.

The representative 17 erm(B)-positive strains and 4 erm(B)-negative strains commonly possessed the efaAfm and acm genes (Table 4). Both esp and hyl were detected in strains with the erm(B) RR genotypes L1, L2, L3, and M (one strain). erm(B)-positive strains were discriminated into five virulence factor profiles, and all the five profiles were found in the Q/D-intermediate strains.

Discussion

Clinical isolates of E. faecium have been documented to be highly resistant to macrolides,^{31,35,38,39,53} associated with a high prevalence of erm(B).^35,37 Similarly, in the present study, a high rate of EM resistance (88.1%) was observed, and most of them were erm(B)-positive (139/140, 99.3%). Although Q/D resistance in E. faecium was not detected in the report from Europe in 1997–1998,³⁹ thereafter, 23% of clinical isolates in 1999–2002 were described to be resistant to Q/D in Belgium.⁶ Isolation of Q/D-resistant E. faecium was reported in the United States and Korea,^7,20,31 whereas a reduced susceptibility to Q/D was observed in Brazil and Greece.^19,32 On the other hand, high detection rates of resistance to streptogramins were documented for E. faecium strains from animals in the United States and European countries.^16,18,47 In Japan, although Q/D-resistant E. faecium has not yet been isolated, strains showing reduced susceptibility to Q/D were first reported in the present study, with a detection rate of 17.6%. The Q/D-intermediate strains were classified into 5 types each of the MLVA type, ST, resistance gene, and virulence factor profiles, some of which were found in the Q/D-susceptible strains. Q/D-intermediate resistance was found in the strains with the erm(B) subtypes 1, 2, 4, and 6, among which subtypes 1, 2, and 4 were also seen in Q/D-susceptible strains. These findings indicate that the Q/D-intermediate strains are composed of heterogeneous strains that are not distinguishable from Q/D-susceptible strains. Most of MLVA types identified in erm(B)-positive strains were grouped into CC-C1 in the present study. On the other hand, the Q/D-intermediate strains were mostly classified into STs belonging to CC17, and were simultaneously assigned to MLVA types of the CC-C1. The CC17 of MLST is recognized as an emerging subpopulation of E. faecium causing hospital-associated infections worldwide,⁴⁴ and a combination of MLST CC17 and MLVA CC-C1 has been reported as an epidemic, virulent, hospital-adapted lineage.⁵⁰ The present study suggested that the resistance to MLS_B antibiotics is prevalent in E. faecium strains from this lineage.

In the present study, except for erm(B) and msrC, no known gene associated with MLS_B resistance was detected in the Q/D-intermediate strains, and no mutation relevant to MLS_B resistance was identified in domain V of 23S rRNA. Similarly to our results, Karanika and coworkers reported Q/D-intermediate-resistant E. faecium (28.9% in clinical isolates) in Greece, which did not harbor known streptogramin resistance genes, except for erm(B), suggesting the presence of an undetermined mechanism responsible for a low-level Q/D resistance.¹⁹ Therefore, the causing mechanism of the Q/D-intermediate resistance in E. faecium was not evident. However, the fact that almost all the Q/D-resistant or Q/D-intermediate strains possess erm(B)^7,19 suggests the involvement of erm(B) in an altered susceptibility to Q/D. Lopez and coworkers described that the presence of erm(B) was associated with a reduced susceptibility of Q/D in E. faecium clinical isolates.²³ Although erm(B) alone does not confer resistance to Q/D, erm(B)-encoding methylase is revealed to decrease the bactericidal activity of Q/D in vitro,⁴ suggesting that excess expression of erm(B) may affect the antibacterial function of Q/D. Secondly, the chromosomal gene msrC was shown to confer a low-level reduction in susceptibility to macrolide and streptogramin B.⁴⁰ Thus, the synergistic activity of Q/D is suggested to be inhibited by the excretion of quinupristin from bacterial cells mediated by increased expression of msrC. Although it was not investigated in detail in the present study, msrC in E. faecium appears to be genetically divergent, which was supported by determination of partial sequences, and also suggested by a failure of PCR detection of this gene in some strains using a certain primer pair.⁴⁶ It is also conceivable that the functional difference in MsrC, that is, the efficacy in efflux of macrolides and streptogramin B, may be caused by such divergent nature of msrC.

The RR of erm genes is considered to be associated with its inducible expression, and constitutive expression of erm(C) in staphylococcal plasmid pE194 was attributed to a large deletion in this region.^8,13 In erm(B) RR from several streptococcal strains and an E. faecalis strain, point mutations in the control peptide, large deletion, or DNA duplication was identified and implicated in change to constitutive expression of macrolide resistance.³⁶ Two studies^23,26 reported the sequence diversity of the erm(B) RR in many clinical isolates of enterocooci. Min and coworkers detected four sequence variations [erm(Bv), erm(Bv1), erm(Bv2), and erm(Bv3)] among 36 isolates exhibiting inducible macrolide resistance,²⁶ while two genetic variations (A and B) were found in 19 E. faecium strains with various susceptibilities to Q/D by López et al.²³ In the present study, more genetic variations in erm(B) (13 RR genotypes), including those reported previously, were identified. The RR genotype S6 was identical to that in Tn917 in E. faecalis, and S3 was almost identical to that in Tn1545 in Streptococcus pneumoniae (with one nucleotide difference). Sequence A and B reported by López et al.²² were identical to the present RR genotypes S4 and S3, respectively, and erm(Bv) and erm(Bv3), and erm(Bv1) and erm(Bv2), described by Min et al.,²⁶ were genetically close to the RR genotypes S6 and L1, respectively. All the RR genotypes, except for S3, S4, and S6, were newly identified in the present study, and especially M, D, and R were novel types of erm(B)-RR sequences, indicating that the erm(B) RR is genetically highly diverse. In a study analyzing MLS_B-resistant enterococcal clones selected in vitro, deletion and tandem duplication were found in erm(A), whereas only point mutation in erm(B), which was described as probable characteristics of the mutation pattern in these genes.²⁷ However, our present study revealed that a deletion or duplication could occur in the erm(B) RR, indicating that the mutation modes in erm(A) and erm(B) are similar.

As evident from the RR sequence alignment of different genotypes, L1, L2, and L3 contain a 12-nucleotide duplication in the leader peptide region of the S1–S7 sequences, and the previously reported RR sequences in enterococci and streptococci are genetically close to the S1–S7 sequences.^23,26 Therefore, it is suggested that the original form of the RR may be the genotype S1–S7 sequence, from which other divergent sequences might be generated.

Despite the extensive diversity in the erm(B) RR, the resistance of E. faecium strains to macrolides was totally constitutive in the present study, and specific RR genotypes were not related to Q/D susceptibility. In the study by López et al.,²³ no relation was observed between the erm(B) RR sequence and susceptibility to Q/D, though inducible resistance to macrolides was not examined. However, in our present study, it was noted that most of the Q/D-intermediate strains were assigned into the L1, L2, and M genotypes, which contain duplication of short sequences, while few Q/D-intermediate strains had a presumptive original form of the erm(B) RR sequence (S1–S7), and those with deletion or duplication of long sequence (D and R). It is possible that such a longer leader peptide may be related to the efficacy of erm(B) expression, by an unknown mechanism. It was unexpected that the SD sequence is predicted to be located in the loop just in the upstream of erm(B), irrespective of the RR genotypes. Because in case of erm(B), the distance between erm(B) ORF and the leader peptide region (124 bp in length) is considerably longer than that of erm(C) (59 bp in length), and it may be natural that mutations within and around the leader peptide region may not affect the secondary structure near the initiation codon of erm(B). Probably, expression of erm(B) may be controlled by RRs via a different mechanism from that described for erm(C).

In the present study, a high prevalence of EM resistance associated with erm(B) and the presence at a low rate of Q/D-intermediate resistance were revealed for E. faecium clinical isolates in a Japanese hospital. To ensure the effective use of Q/D against VRE infections, which may increase in the near future, a continuous epidemiological study of MLS_B resistance in E. faecium and its responsible genetic mechanisms are indispensable.

Footnotes

Acknowledgment

This study was supported in part by a grant-in-aid for Scientific Research (No. 23590746) from the Ministry of Education, Culture, Sports, Science, and Technology, Japan.

Disclosure Statement

The authors of this article have no commercial associations that might create a conflict of interest in connection with the submitted manuscript.

References

Arias

C.A.

, Murray

B.E.

2012. The rise of the Enterococcus: beyond vancomycin resistance. Nat. Rev. Microbiol., 10:266–278.

Bozdogan

, Leclercq

, Lozniewski

, Weber

1999. Plasmid-mediated coresistance to streptogramins and vancomycin in Enterococcus faecium HM1032. Antimicrob. Agents Chemother., 43:2097–2098.

Camargo

I.L.

, Gilmore

M.S.

, Darini

A.L.

2006. Multilocus sequence typing and analysis of putative virulence factors in vancomycin-resistant and vancomycin-sensitive Enterococcus faecium isolates from Brazil. Clin. Microbiol. Infect., 12:1123–1130.

Caron

, Gold

H.S.

, Wennersten

C.B.

, Farris

M.G.

, Moellering

R.C.

Jr. , Eliopoulos

G.M.

1997. Influence of erythromycin resistance, inoculum growth phase, and incubation time on assessment of the bactericidal activity of RP 59500 (quinupristin-dalfopristin) against vancomycin-resistant Enterococcus faecium. Antimicrob. Agents Chemother., 41:2749–2753.

[CLSI] Clinical and Laboratory Standards Institute. 2009. Methods for dilution susceptibility tests for bacteria that grow aerobically; approved standard. M7-A88th. Clinical and Laboratory Standards Institute: Wayne, PA.

De Graef

E.M.

, Decostere

, De Leener

, Goossens

, Baele

, Haesebrouck

2007. Prevalence and mechanism of resistance against macrolides, lincosamides, and streptogramins among Enterococcus faecium isolates from food-producing animals and hospital patients in Belgium. Microb. Drug Resist., 13:135–141.

Donabedian

S.M.

, Perri

M.B.

, Vager

, Hershberger

, Malani

, Simjee

, Chow J

, Vergis

E.N.

, Muder

R.R.

, Gay

, Angulo

F.J.

, Bartlett

, Zervos

M.J.

2006. Quinupristin-dalfopristin resistance in Enterococcus faecium isolates from humans, farm animals, and grocery store meat in the United States. J. Clin. Microbiol., 44:3361–3365.

Depardieu

, Podglajen

, Leclercq

, Collatz

, Courvalin

2007. Modes and modulations of antibiotic resistance gene expression. Clin. Microbiol. Rev., 20:79–114.

Dipersio

L.P.

, Dipersio

J.R.

2007. Identification of an erm(T) gene in strains of inducibly clindamycin-resistant group B Streptococcus. Diagn. Microbiol. Infect. Dis., 57:189–193.

10.

Eaton

T.J.

, Gasson

M.J.

2001. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl. Environ. Microbiol., 67:1628–1635.

11.

Fantin

, Leclercq

, Garry

, Carbon

1997. Influence of inducible cross-resistance to macrolides, lincosamides, and streptogramin B-type antibiotics in Enterococcus faecium on activity of quinupristin-dalfopristin in vitro and in rabbits with experimental endocarditis. Antimicrob. Agents Chemother., 41:931–935.

12.

Homan

W.L.

, Tribe

, Poznanski

, Li

, Hogg

, Spalburg

, Van Embden

J.D.

, Willems

R.J.

2002. Multilocus sequence typing scheme for Enterococcus faecium. J. Clin. Microbiol., 40:1963–1971.

13.

Horinouchi

, Weisblum

1980. Posttranscriptional modification of mRNA conformation: mechanism that regulates erythromycin-induced resistance. Proc. Natl. Acad. Sci. U S A., 77:7079–7083.

14.

Hoshuyama

, Moriguchi

, Muratani

, Matsumoto

2008. Vancomycin-resistant enterococci (VRE) outbreak at a university hospital in Kitakyushu, Japan: case-control studies. J. Infect. Chemother., 14:354–360.

15.

IDWR. Surveillance data table, category V (notifiable disease). Infectious Disease Surveillance Center, National Institute of Infectious Disease. www.nih.go.jp/niid/ja/idwr/2085-ydata/1615-report-ja.html. (In Japanese) (Online.)

16.

Jackson

C.R.

, Fedorka-Cray

P.J.

, Barrett

J.B.

, Hiott

L.M.

, Woodley

T.A.

2007. Prevalence of streptogramin resistance in enterococci from animals: identification of vatD from animal sources in the USA. Int. J. Antimicrob. Agents., 30:60–66.

17.

Jensen

L.B.

, Hammerum

A.M.

, Aerestrup

F.M.

, van den Bogaard

A.E.

, Stobberingh

E.E.

1998. Occurrence of satA and vgb genes in streptogramin-resistant Enterococcus faecium isolates of animal and human origins in the Netherlands. Antimicrob. Agents Chemother., 42:3330–3331.

18.

Jensen

L.B.

, Hammerum

A.M.

, Bager

, Aarestrup

F.M.

2002. Streptogramin resistance among Enterococcus faecium isolated from production animals in Denmark in 1997. Microb. Drug Resist., 8:369–374.

19.

Karanika

, Prati

, Kiritsi

, Spiliopoulou

, Neonakis

, Anifantaki

, Petinaki

2008. Reduced susceptibility to quinupristin/dalfopristin in Enterococcus faecium in Greece without prior exposure to the agent. Int. J. Antimicrob. Agents., 31:55–57.

20.

Kieke

A.L.

, Borchardt

M.A.

, Kieke

B.A.

, Spencer

S.K.

, Vandermause

M.F.

, Smith

K.E.

, Jawahir

S.L.

, Belongia

E.A.

Marshfield Enterococcal Study Group. 2006. Use of streptogramin growth promoters in poultry and isolation of streptogramin-resistant Enterococcus faecium from humans. J. Infect. Dis., 194:1200–1208.

21.

Klare

, Werner

, Witte

2001. Enterococci. Habitats, infections, virulence factors, resistances to antibiotics, transfer of resistance determinants. Muhldorfer

, Schafer

K.P.

Emerging Bacterial Pathogens: Karger, Basel, 108–122.

22.

Kobayashi

, Wu

, Kojima

, Taniguchi

, Urasawa

, Uehara

, Omizu

, Kishi

, Yagihashi

, Kurokawa

1994. Detection of mecA, femA, and femB genes in clinical strains of staphylococci using polymerase chain reaction. Epidemiol. Infect., 113:259–266.

23.

López

, Culebras

, Betriú

, Rodríguez-Avial

, Gómez

, Picazo

J.J.

2010. Antimicrobial susceptibility and macrolide resistance genes in Enterococcus faecium with reduced susceptibility to quinupristin-dalfopristin: level of quinupristin-dalfopristin resistance is not dependent on erm(B) attenuator region sequence. Diagn. Microbiol. Infect. Dis., 66:73–77.

24.

Martin

, Alloing

, Méjean

, Claverys

J.P.

1987. Constitutive expression of erythromycin resistance mediated by the ermAM determinant of plasmid pAM beta 1 results from deletion of 5′ leader peptide sequences. Plasmid, 18:250–253.

25.

Martineau

, Picard

F.J.

, Lansac

, Ménard

, Roy

P.H.

, Ouellette

, Bergeron

M.G.

2000. Correlation between the resistance genotype determined by multiplex PCR assays and the antibiotic susceptibility patterns of Staphylococcus aureus and Staphylococcus epidermidis. Antimicrob. Agents Chemother., 44:231–238.

26.

Min

Y-H.

, Jeong

J-H.

, Choi

Y-J.

, Yun

H-J.

, Lee

, Shim

M-J.

, Kwak

J-H.

, Choi

E-C.

2003. Heterogeneity of macrolide-lincosamide-streptogramin B resistance phenotypes in enterococci. Antimicrob. Agents Chemother., 47:3415–3420.

27.

Min

Y-H.

, Kwon

A-R.

, Yoon

J-M.

, Yoon

E-J.

, Shim

M-J.

, Choi

E-C.

2008. Molecular analysis of constitutive mutations in ermB and ermA selected in vitro from inducibly MLS_B-resistant enterococci. Arch. Pharm. Res., 31:377–380.

28.

Murray

B.E.

1998. Diversity among multidrug-resistant enterococci. Emerg. Infect. Dis., 4:37–47.

29.

Nakajima

1999. Mechanisms of bacterial resistance to macrolide antibiotics. J. Infect. Chemother., 5:61–74.

30.

Nishimoto

, Kobayashi

, Alam

M.M.

, Ishino

, Uehara

, Watanabe

2005. Analysis of the prevalence of tetracycline resistance genes in clinical isolates of Enterococcus faecalis and Enterococcus faecium in a Japanese hospital. Microb. Drug Resist., 11:146–153.

31.

W.-S.

, Ko

K.-S.

, Song

J.-H.

, Lee

M.-Y.

, Park

, Peck

K.-R.

, Lee

N.-Y.

, Kim

C.-K.

, Lee

, Kim

S.-W.

, Chang

H.-H.

, Kim

Y.-S.

, Jung

S.-I.

, Son

J.-S.

, Yeom

J.-S.

, Ki

H.-K.

, Woo

G.-J.

2005. High rate of resistance to quinupristin-dalfopristin in Enterococcus faecium clinical isolates from Korea. Antimicrob. Agents Chemother., 49:5176–5178.

32.

Pereira

G.H.

, Müller

P.R.

, Zanella

R.C.

, de Jesus Castro Lima

, Torchio

D.S.

, Levin

A.S.

Outbreak of vancomycin-resistant enterococci in a tertiary hospital: the lack of effect of measures directed mainly by surveillance cultures and differences in response between Enterococcus faecium and Enterococcus faecalis. Am. J. Infect. Control., 38:406–409.

33.

Portillo

, Ruiz-Larrea

, Zarazaga

, Alonso

, Martinez

J.L.

, Torres

2000. Macrolide resistance genes in Enterococcus spp. Antimicrob. Agents Chemother., 44:967–971.

34.

Rende-Fournier

, Leclercq

, Galimand

, Duval

, Courvalin

1993. Identification of the satA gene encoding a streptogramin A acetyltransferase in Enterococcus faecium BM4145. Antimicrob. Agents Chemother., 37:2119–2125.

35.

Reyes

, Hidalgo

, Díaz

, Rincón

, Moreno

, Vanegas

, Castañeda

, Arias

C.A.

2007. Characterization of macrolide resistance in Gram-positive cocci from Colombian hospitals: a countrywide surveillance. Int. J. Infect. Dis., 11:329–336.

36.

Rosato

, Vicarini

, Leclercq

1999. Inducible or constitutive expression of resistance in clinical isolates of streptococci and enterococci cross-resistant to erythromycin and lincomycin. J. Antimicrob. Chemother., 43:559–562.

37.

Schmitz

F.J.

, Sadurski

, Kray

, Boos

, Geisel

, Köhrer

, Verhoef

, Fluit

A.C.

2000. Prevalence of macrolide-resistance genes in Staphylococcus aureus and Enterococcus faecium isolates from 24 European university hospitals. J. Antimicrob. Chemother., 45:891–894.

38.

Schmitz

F.J.

, Verhoef

, Fluit

A.C.

and Sentry Participants Group. 1999. Prevalence of resistance to MLS antibiotics in 20 European university hospitals participating in the European SENTRY surveillance programme. J. Antimicrob. Chemother., 43:783–792.

39.

Schouten

M.A.

, Voss

, Hoogkamp-Korstanje

J.A.

and the European VRE Study Group. 1999. Antimicrobial susceptibility patterns of enterococci causing infections in Europe. Antimicrob. Agents Chemother., 43:2542–2546.

40.

Singh

K.V.

, Malathum

, Murray

B.E.

2001. Disruption of an Enterococcus faecium species-specific gene, a homologue of acquired macrolide resistance genes of staphylococci, is associated with an increase in macrolide susceptibility. Antimicrob. Agents Chemother., 45:263–266.

41.

Soltani

, Beighton

, Philpott-Howard

, Woodford

2000. Mechanisms of resistance to quinupristin-dalfopristin among isolates of Enterococcus faecium from animals, raw meat, and hospital patients in Western Europe. Antimicrob. Agents Chemother., 44:433–436.

42.

Tait-Kamradt

, Davies

, Cronan

, Jacobs

M.R.

, Appelbaum

P.C.

, Sutcliffe

2000. Mutations in 23S rRNA and ribosomal protein L4 account for resistance in pneumococcal strains selected in vitro by macrolide passage. Antimicrob. Agents Chemother., 44:2118–2125.

43.

Top

, Schouls

L.M.

, Bonten

M.J.

, Willems

R.J.

2004. Multiple-locus variable-number tandem repeat analysis, a novel typing scheme to the genetic relatedness and epidemiology of Enterococcus faecium isolates. J. Clin. Microbiol., 42:4503–4511.

44.

Top

, Willems

, Bonten

2008. Emergence of CC17 Enterococcus faecium: from commensal to hospital-adapted pathogen. FEMS. Immunol. Med. Microbiol., 52:297–308.

45.

Watanabe

, Kobayashi

, Quiñones

, Nagashima

, Uehara

, Watanabe

2009. Genetic diversity of enterococci harboring the high-level gentamicin resistance gene aac(6')-Ie-aph(2'')-Ia or aph(2'')-Ie in a Japanese hospital. Microb. Drug Resist., 15:185–194.

46.

Werner

, Hildebrandt

, Witte

2001. The newly described msrC gene is not equally distributed among all isolates of Enterococcus faecium. Antimicrob. Agents Chemother., 45:3672–3673.

47.

Werner

, Klare

, Heier

, Hinz

K.H.

, Böhme

, Wendt

, Witte

2000. Quinupristin/dalfopristin-resistant enterococci of the satA (vatD) and satG (vatE) genotypes from different ecological origins in Germany. Microb. Drug Resist., 6:37–47.

48.

Werner

, Klare

, Spencker

F.B.

, Witte

2003. Intra-hospital dissemination of quinupristin/dalfopristin- and vancomycin-resistant Enterococcus faecium in a paediatric ward of a German hospital. J. Antimicrob. Chemother., 52:113–115.

49.

Werner

, Klare

, Witte

2002. Molecular analysis of streptogramin resistance in enterococci. Int. J. Med. Microbiol., 292:81–94.

50.

Werner

, Klare

, Witte

2007. The current MLVA typing scheme for Enterococcus faecium is less discriminatory than MLST and PFGE for epidemic-virulent, hospital-adapted clonal types. BMC Microbiol., 7:28.

51.

Werner

, Witte

1999. Characterization of a new enterococcal gene, satG, encoding a putative acetyltransferase conferring resistance to Streptogramin A compounds. Antimicrob. Agents Chemother., 43:1813–1814.

52.

Wondrack

, Massa

, Yang

B.V.

, Sutcliffe

1996. Clinical strain of Staphylococcus aureus inactivates and causes efflux of macrolides. Antimicrob. Agents Chemother., 40:992–998.

53.

Yamaguchi

, Ohno

, Ishii

, Tateda

, Iwata

and levofloxacin-surveillance group. 2009. In vitro susceptibilities to levofloxacin and various antibacterial agents of 12,919 clinical isolates obtained from 72 centers in 2007. Jpn. J. Antibiot., 62:346–370.

54.

Yilmaz

, Aydin

, Iskender

, Caylan

, Koksal

2007. Detection and prevalence of inducible clindamycin resistance in staphylococci. J. Med. Microbiol., 56:342–345.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.05 MB

0.08 MB

0.03 MB