Abstract
Multi-resistant Klebsiella pneumoniae has been considered a serious global threat. This study was initiated to investigate carbapenem resistance among K. pneumoniae isolates in Iran and to detect carbapenemases in resistant strains. From 2009 to 2012, 180 K. pneumoniae strains were collected from Tehran hospitals. Of the isolates, 42 isolates (23.3%) were resistant to meropenem, 29 isolates (16.1%) were resistant to ertapenem, and 14 isolates (7.7%) were resistant to imipenem. All of carbapenem-resistant isolates were also resistant to the third generation of cephalosporins. modified Hodge test was positive in 25 (59.5%) of carbapenem-resistant isolates showing carbapenemase production. blaNDM and blaVIM genes were identified in three and five carbapenem-resistant isolates, respectively. One isolate showed presence of blaKPC gene. Class 1 integrons were detected in 14 carbapenem-resistant isolates. The most important finding about class 1 integrons was identification of an integron containing metallo-β-lactamase gene VIM-1 that also harbored dfrA27 and arr3 genes. It is important to note that K. pneumoniae carbapenemase and New Delhi metallo-beta-lactamase-positive isolates identified in this study showed resistance to the majority of routine antimicrobial agents, including all β-lactams and other classes of antibiotics. To our knowledge, this is the first identification of blaKPC and blaVIM-1 genes among isolates of K. pneumoniae in Iran.
Introduction
K
Among class A enzymes, K. pneumoniae carbapenemase (KPC) is attracting significant attention, and several reports show rapid spread of KPC-producing K. pneumoniae isolates worldwide.2,9,40 KPC was first reported in a carbapenem-resistant K. pneumoniae isolate in 2001. 41 Until now, fourteen different variants of KPC have been reported: KPC-2 to KPC-15 (www.lahey.org). These enzymes are found most often in K. pneumoniae, but recently, the identification of KPC-producing strains among other Enterobacteriaceae and Pseudomonas aeruginosa isolates has increased.1,30 It is surprising that KPC-positive isolates show resistance to all routine antimicrobial agents, including all β-lactams and other classes of antibiotics.
Dissemination of genes encoding MBLs has led to the international spread of carbapenem resistance among clinical isolates of Gram-negative bacilli. Within MBLs, VIM enzymes have a high affinity for carbapenems. 8 In addition, New Delhi metallo-beta-lactamase (NDM)-producing superbugs represent a major challenge for the treatment of infection disease caused by carbapenem-resistant strains.22,24 The blaNDM gene was first identified from K. pneumoniae and Escherichia coli strains isolated from a Swedish patient who had traveled to India. 42 NDM-1 and its other variants (NDM-2 to NDM-10) have been recently reported from several countries.24,36,38 The NDM-positive bacteria harbor plasmids carrying blaNDM gene and a number of other resistance genes.16,23,42 Furthermore, in some cases, NDM-producing strains have been interestingly resistant to colistin and tigecycline. 16 The emergence of these multi-drug resistant isolates represents a serious challenge for public health.
This study was initiated to investigate Carbapenem resistance among K. pneumoniae isolates in Iran and to detect carbapenemases in resistant strains. To our knowledge, this is the first identification of blaKPC gene in Iran.
Materials and Methods
Clinical isolates
Between 2009 and 2012, 180 K. pneumoniae strains were collected from eight hospitals in Tehran. One isolate per patient was included in this study. These isolates were selected regard to their antimicrobial drug resistance based on disc diffusion test performed by clinical laboratories. Isolates were confirmed by using standard biochemical tests and by using API 20E (Biomerieux, Marcy-l'Etoile, France). Clinical strains were isolated from urine, feces, blood, sputum, wound, and trachea.
Antimicrobial susceptibility testing
Susceptibility of isolates were determined by disc diffusion assay on Muller-Hinton agar (Difco, Detroit, MI) against imipenem (IMP: 10 μg), meropenem (MEM: 10 μg), ertapenem (ETP: 10 μg), ceftazidime (CAZ: 30 μg), cefepime (CPM: 30 μg), cefotaxime (CTX: 30 μg), ciprofloxacin (CIP: 5 μg), amikacin (AK: 30 μg), kanamycin (K: 30 μg), aztreonam (ATM: 30 μg), colistin (CL: 10 μg), polymixin B (PB: 300 μg), tigecycline (TGC: 15 μg), and trimethoprim-sulfamethoxazole (SXT: 15 μg) (MAST, Merseyside, United Kingdom) as described by Clinical and Laboratory Standards Institute (CLSI) guidelines and interpretive criteria. 6 Minimal inhibitory concentrations (MICs) of imipenem and meropenem were determined using broth microdilution methods. ESBL phenotypic confirmatory test was performed to detect ESBL production as described by CLSI guidelines. 7 All carbapenem and third-generation cephalosporin-resistant strains were tested for production of carbapenemases. The modified Hodge test (MHT) was used to screen the presence of carbapenemases. The E-test MBL by IPM-IPM/EDTA was performed to detect class B carbapenemases production (AB Biodisk, Solna, Sweden). To better evaluate MBL activity in Muller-Hinton agar plates, a combined disk test was done as previously described by Nordmann et al. 23 We used E. coli ATCC 25922 as a carbapenem-susceptible strain, K. pneumoniae AO 8053 (carbapenem resistant) and K. pneumoniae strain 7881 (cephalosporin resistant) for quality control.
Polymerase chain reaction amplification and DNA sequence analysis
Genomic DNA from K. pneumoniae isolates was obtained by boiling two or three colonies of each isolate in 500 μl of distilled water for 10 min and centrifugation at 10,000 rpm for 10 min. The supernatant was used as a template for polymerase chain reaction (PCR) assay. PCR was conducted using the specific primers for blaTEM, blaSHV, blaCTX-M, blaPER, and blaVEB genes as previously described. 34 The presence of blaKPC, blaOXA48, and blaGES genes and genes encoding MBLs, including blaNDM-1, blaVIM-1, blaVIM-2, blaIMP-1, blaIMP-2, blaSIM, and blaSPM, were screened using primer pairs previously reported.23,34 K. pneumoniae strain 7881 (quality control for detection of ESBLs), P. aeruginosa KOAS strain (harboring blaPER), P. aeruginosa 10.2 (harboring blaVEB), K. pneumoniae AO8053 (harboring blaKPC), P. aeruginosa PO695 (harboring blaGES), Acinetobacter baumannii AC54/97 (harboring blaIMP), P. aeruginosa PO510 (harboring blaVIM), and P. aeruginosa 16 (harboring blaSPM) were used as control strains. The nucleotide sequences were determined by direct sequencing at Macrogen, Inc. (Seoul, Korea).
Characterization of Class 1 integrons
The gene cassettes in class 1 integrons were amplified by PCR using primers in the 5′ conserved segment (5′ CS) and the 3′ conserved segment (3′ CS). We identified intI gene, sul and qacEΔ1 genes, by using specific primers previously described. 17 The structure of class 1 integrons was revealed by sequencing.
Pulsed-field gel electrophoresis
Pulsed-field gel electrophoresis (PFGE) method was used for molecular typing of carbapenem-resistant isolates. Genomic DNA was digested with XbaI (Fermentas, Sylvius, Lithuania). Electrophoresis was run in a CHEF-DR III PFGE apparatus at 14°C for 22 hr (Bio-Rad Laboratories, Hercules, CA) and a gradient of 6 V/cm at a 120° angle, with the pulse time increasing from 5 to 30 sec. Salmonella enterica serovar Braenderup strain H9812 (ATCC BAA-664) was digested with XbaI before being used as the size marker for analysis. The generated PFGE patterns were analyzed using the Gel Compare II (Applied Maths, Kortrijk, Belgium) software. The band-based dice similarity coefficient and the UPGMA dendrogram type were used for optimization and comparison. Banding patterns were interpreted using the criteria devised by Tenover et al. 37
Results
A total of 180 clinical isolates were confirmed as K. pneumoniae by identification tests. The majority of K. pneumoniae isolates were detected among urine (n=61, 33.8%), blood (n=45, 25%), and feces (n=22, 12.2%). Of the carbapenems, imipenem showed the highest activity against K. pneumoniae isolates, and 14 isolates (7.7%) were imipenem resistant. K. pneumoniae isolates showed resistance rates of 16.1% (29 isolates) to ertapenem and 23.3% (42 isolates) to meropenem. A high rate of carbapenem resistance was observed among isolates recovered from urine (66.6%). All of carbapenem-resistant isolates were multiple drug resistant. Fourteen of 42 carbapenem-resistant isolates were resistant to three carbapenems, and 13 were resistant only to meropenem. In general, the resistance rate to cephalosporins was high. Of the isolates, 135 isolates (75%), 138 isolates (76.6%), and 142 isolates (78.8%) were resistant to cefepime, ceftazidime, and cefotaxime, respectively. The percentages of resistance to other tested antimicrobial agents were as follows: ciprofloxacin, 73.3%; amikacin, 22.2%; kanamycin, 43.3%; aztreonam, 62.2%; and trimethoprim-sulfamethoxazole, 86.7%.
Twenty-five of the 42 carbapenem-resistant isolates (59.5%) showed positive results in MHT. Ertapenem was the most appropriate indicator carbapenem for detecting carbapenemase production. Antimicrobial susceptibility patterns and characteristics of 42 carbapenem-resistant K. pneumoniae isolates are listed in Table 1.
Antimicrobial resistant pattern was performed by disc diffusion method.
CPM, cefepime; CTX, cefotaxime; CAZ, ceftazidime; IMI, imipenem; MEM, meropenem; ERT, ertapenem; CIP, ciprofloxacin; AN, amikacin; K, kanamycin; ATM, aztreonam; TS, trimethoprim-sulfamethoxazole; MHT, modified Hodge test; E-test MBL, E-test metallo-β-lactamase strips; KPC, K. pneumoniae carbapenemase; NDM, New Delhi metallo-beta-lactamase; MIC, minimal inhibitory concentration; PFGE, pulsed-field gel electrophoresis.
ESBL phenotypic confirmatory test was positive for all 42 carbapenem-resistant isolates. The blaCTX-M, blaSHV, blaTEM, and blaPER genes were detected in 69%, 59.5%, 35.7%, and 16.6% of carbapenem-resistant isolates, respectively. We did not detect blaVEB, blaOXA48, and blaGES genes among the isolates. NDM-1 was identified in three K. pneumoniae strains by PCR (K246, K685, and K729). K685 and K729 were derived from a urine sample, and K246 was isolated from the blood. Sequencing analysis confirmed similarity to blaNDM-1 gene in these isolates, and nucleotide sequences were submitted to the GenBank nucleotide sequence databases under accession numbers KC252998, KC894390, and JN664262. The patients had no history of travel to the Indian subcontinent, but one of them traveled to Iraq at 2 months before hospitalization. The patients were hospitalized in three distinct hospitals in Tehran, Iran. NDM-producing isolates were resistant to all tested antibiotics except colistin, tigecycline, and polymyxin B (Table 1) and showed positive results in an ESBL phenotypic confirmatory test. MHT showed weak positive results for NDM-positive isolates. However, the E-test MBL and the combined disk test positive results showed MBL production.
Among carbapenem-resistant strains, five (11.9%) strains harbored blaVIM-1 gene (GenBank accession numbers KC491207, KC776112, KC776113, KC776114, and KC776115). Sequencing analysis confirmed similarity to blaVIM-1 gene in these isolates. All VIM-1-carrying isolates showed positive results in MHT, combined disk test, and E-test MBL. These isolates were recovered from urine (four isolates) and blood (one isolate) from patients at the same hospital in Tehran. VIM-producing isolates expressed high-level resistance to meropenem, ertapenem, and cephalosporins and were also resistant to other antibiotics except colistin, tigecycline, and polymyxin B. Four isolates were resistant to imipenem, whereas one isolate was intermediate susceptible (MIC 2 μg/ml).
In July 2012, blaKPC gene was detected in a K. pneumoniae strain isolated from the urine sample of a woman hospitalized in ICU. Antimicrobial susceptibility testing showed a multidrug-resistant phenotype (Table 1). The isolate was also resistant to colistin, but was susceptible to tigecycline and polymyxin B. E-test MBL and combined disk test were also positive. However, no MBL (blaNDM-1, blaVIM-1, blaVIM-2, blaIMP-1, blaIMP-2, blaSIM, and blaSPM) genes were detected in this isolate. The presence of blaCTX-M, blaTEM, and blaSHV genes in the KPC-bearing isolate was confirmed by PCR. The patient had no history of travel or hospitalization outside Iran. In order to detect the blaKPC gene variant, a new set of primers were used (F: ATGTCACTGTATCGCCGTCT, R: TTTTCAGAGCCTTACTGCCC). Sequence analysis of blaKPC gene demonstrated that the coding region was 100% identical to the other blaKPC genes existing in the GenBank database. After sequencing of the amplified fragment, KPC-2 was identified. The nucleotide sequence of the blaKPC gene was assigned GenBank accession number JX966417.
Fourteen (33.3%) isolates of the carbapenem-resistant isolates contained class 1 integrons. The presence of intI1, qacΔE, and sul1genes were confirmed in all of these strains. Variable regions of class 1 integrons were 1.0, 1.5, 1.8, 2.0, and 2.5 kb in size. Different variants of aadA (aadA1 and aadA2) and dfr (dfrA1, dfrA12, and dfrA27) genes were observed after sequence analyzing of gene cassettes. Strain K360 (producer of VIM-1) harbored a 2.5 kb fragment of the gene cassette that carried dfrA27 and arr3 genes. Amplification and sequencing of the region between blaVIM-1 and intI1 genes using primers VIM-1-F (AGTGGTGAGTATCCGACA) and int-1-R (GATGCCTGCTTGTTCTACGG) revealed that this gene cassette also contained blaVIM-1 at the 5′ end of the class 1 integron (Fig. 1).

Schematic structure of the blaVIM-1 carrying the class 1 integron from the Klebsiella pneumoniae K360 isolate.
The PFGE of DNA restricted with XbaI revealed 16 different PFGE types among 42 carbapenem-resistant isolates of K. pneumoniae (Fig. 2). Type N was the most common type, and six subtypes of it were detected. NDM-producing isolates were clonally unrelated and considered genetically distinct. Among the five isolates with blaVIM-1 gene, four (K344, K371, K552, and K725) produced an identical genotype (type N), whereas the remaining one isolate (K360) showed a different PFGE type (type G). Interestingly, the KPC-positive isolate belonged to type B, which contained only this single isolate.

Dendrogram to show relatedness of PFGE patterns of the 42 carbapenem-resistant isolates of K. pneumoniae PFGE, pulsed-field gel electrophoresis.
Discussion
ESBLs have been widely reported in K. pneumoniae from several hospitals in Iran.20,32,35 Carbapenems currently represent the drugs of choice for the treatment of infectious diseases caused by ESBL-producing strains. 10 Although carbapenems have good activity against Gram-negative bacilli and are mostly used as a last resort, resistance to carbapenems has been reported in Enterobacteriaceae and Gram-negative nonfermenters.22,24,34
In the present study, 42 carbapenem-resistant isolates of K. pneumoniae were recovered. Interestingly, between October 2009 and December 2011, 22 (20.9%) isolates of the 105 collected K. pneumoniae isolates were resistant to carbapenems. However, over the last year, carbapenem resistance among clinical isolates of K. pneumoniae substantially increased to 26.6%. Similar to these results, reports of carbapenem resistance among Enterobacteriaceae have risen in different countries11,38, suggesting intercontinental spread of carbapenem-resistant strains. Among all tested antimicrobial agents, imipenem showed an excellent activity against K. pneumoniae isolates. K. pneumoniae isolates were considerably resistant to cephalosporins as has been reported from other parts of the world. 21 Similar to our findings, cefepime is the most active cephalosporin against K. pneumoniae isolates in Europe and North America. 21 It should be noted that all of carbapenem-resistant isolates were multiple-drug resistant. In addition, colistin was the most effective antimicrobial agent; just 1 carbapenem-resistant isolate was colistin resistant. Other studies have confirmed the high susceptibility rate of K. pneumoniae to colistin.9,42
Although CLSI recommend that the cephalosporin-resistant isolates should be checked for carbapenemase production by MHT, 6 MHT was negative in all of cephalosporin-resistant strains which were susceptible to carbapenems. In accordance with previous studies,5,34 MHT for the NDM-producing strains was weakly positive, indicating leak specificity of MHT in the detection of MBL activity, especially NDM. As expected, MHT for the KPC-producing isolate showed a strong positive result. Furthermore, MHT was positive in VIM-1 producing isolates. Interestingly, 16 of 25 isolates showed negative results for all carbapenemases that were tested for. It may be due to false-positive results of MHT in AmpC hyper-producers and CTX-M-producing isolates as reported by Carvalhaes et al. 4 and Pasteran et al. 25 Therefore, it is important to note that in the present study, these isolates carried the blaCTX-M gene. It should be noted that the combined disk test was positive for all of the MBL producers that we tested, indicating that this method is reliable for the detection of MBL producers as has been routinely recommended. 23
Recently, NDM has started being considered the most common carbapenemase in the world. Recent published data predict that this MBL could emulate CTX-M in global distribution.11,24 Although the majority of NDM cases in the world were associated with travelling to India or Pakistan, all of the three NDM-producing strains isolated from Iran in this study and the previous study 34 were obtained from patients with no travel background to the Indian subcontinent. In the first report of NDM-1 in Iran, a patient had travelled to Iraq and Syria before hospitalization. 34 Poirel et al. 29 identified NDM-positive strains in patients from Iraq and Oman who had not travelled to the Indian subcontinent. Considering that previous reports have indicated the international transfer of NDM producers from Iraq to Turkey 27 and France, 28 our findings demonstrate that this region, including Iran, Iraq, and other countries in the Middle East, might be the third reservoir for NDM producers after the Indian subcontinent and Balkan countries. The occurrence of blaNDM-1 in different PFGE types in this study implied an important role for the horizontal spread of NDM in Iran. Resistance to carbapenems in Enterobacteriaceae has become an increasingly great problem in this region, so further molecular investigations are needed to clarify this possibility. Since Turkey is considered a major source of OXA-48 26 and taking into account that the traveling rate between Iran and Turkey is high, it could be expected that OXA-48 might be detected among clinical strains in Iran. However, in this study, no isolates harbored this β-lactamase.
After the first detection of KPC, this carbapenemase has been identified in other parts of the world.1,2,9,12,30,40 In this study, we described the first identification of blaKPC gene in Iran. Although earlier studies have reported the carbapenem resistance in P. aeruginosa and A. baumannii with positive results in MHT,15,33 these isolates did not show the presence of blaKPC gene. In the present study, KPC-producing isolates demonstrated resistance to all tested antimicrobial agents but the isolate remained susceptible to polymyxin B and tigecycline. Similar to our findings, other KPC-carrying isolates indicate resistance to the majority of antimicrobial agents.1,9 KPC-producing isolates did not show the presence of MBL-encoding genes. This isolate is under further investigation. In addition, KPC-containing isolates also harbored blaTEM, blaSHV, and blaCTX_M genes showing a complex β-lactamase background that was consistent with previously published data.9,13 Moland et al. 19 identified a K. pneumoniae producing eight different β-lactamases in addition to blaKPC. In other studies, however, KPC-positive strains possessed a limited number of β-lactamases.9,39 In contrast with a low prevalence of CTX-M among K. pneumoniae in the United States, 3 this β-lactamase was detected in KPC-producing isolates and in a wide range of carbapenem-resistant strains (69% of carbapenem-resistant strains harbored blaCTX-M). It is also interesting to note that limited studies have reported the blaCTX-M gene among KPC-positive isolates.2,9 This complex β-lactamase background could impair accurate identification of KPC producers by clinicians.
To the best of our knowledge, this is the first time that VIM-1 has been found in K. pneumoniae in Iran. These strains had the highest rates of MICs for imipenem and meropenem when compared with other carbapenem-resistant K. pneumoniae isolates, confirming the high affinity of the VIM enzyme for carbapenems. 8 In our surveys, the most important finding about class 1 integrons was the identification of an integron containing MBL gene blaVIM-1 that also harbored dfrA27 and arr3 genes. Using PFGE, we found that four of the VIM-producing K. pneumoniae isolates had PFGE type N and clustered to subtypes N5 (K371 and K552) and N6 (K344 and K725), suggesting a major role for clonal spread. Interestingly, isolate K360 that carried blaVIM-1 on class 1 integron had a different type (type G).
This study showed that class 1 integron in carbapenem-resistant K. pneumoniae is prevalent. The aadA gene cassette alone or associated with dfr gene cassette is usual in integrons detected among Enterobacteriaceae strains.17,31 The aadA and dfr genes confer resistance to streptomycin and trimethoprim, respectively. 14 Moreover, arr3 gene is responsible for rifampicin resistance. Therefore, the presence of these gene cassettes represents high distribution of resistant determinants in carbapenem-resistant K. pneumoniae.
This study illustrated that the carbapenems should be carefully prescribed for the therapy of infectious diseases with ESBL-producing K. pneumoniae. The rapid global spread of carbapenem-resistant isolates of K. pneumoniae is an alarming crisis that compromises the successful treatment of nosocomial infections. Therefore, there is an urgent need for the implementation of strategies to control the international dissemination of superbugs.
Footnotes
Acknowledgments
This work was funded by a grant from the Pasteur Institute of Iran and the Iranian Ministry of Health and Medical Education. The authors wish to thank Christian G. Giske and Patrice Nordmann for providing standard strains.
Disclosure Statement
No competing financial interests exist.
