Prevalence and Characterization of Plasmid-Mediated Quinolone Resistance Genes in Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae in a Tunisian Hospital

Abstract

The objective of the study was to assess the prevalence of plasmid-mediated quinolone resistance (PMQR) genes (qnrA, qnrB, qnrC, qnrD, qnrS, aac(6′)-Ib-cr, qepA, and oqxAB) in a collection of 120 extended-spectrum β-lactamases (ESBLs)-producing enterobacteria and to characterize them. Overall, PMQR determinants were detected in 72 (60%) isolates (20 Escherichia coli, 32 Klebsiella pneumoniae, and 20 Enterobacter cloacae). PMQR frequencies were as follows: qnr genes (25.8%), oqxAB (21.6%), and aac(6′)-Ib-cr variant (19.2%). Four qnr alleles were identified as qnrB1 (83.8%), qnrB4 (6.4%), qnrB2 (3.2%), and qnrS1 (6.4%). qnr genes were mainly detected in E. cloacae (50%), aac(6′)-Ib-cr in E. coli (47.5%), and oqxAB in K. pneumoniae (65%). Overall, blaCTX-M-15 (90.3%) was the most prevalent blaESBL type followed by bla_SHV-12 (6.4%) and bla_SHV-27 (2.7%). Rates of mutations in gyrA and parC genes were 75% for E. coli, 72.8% for K. pneumoniae, and 50% for E. cloacae. Isolates with mutations in their quinolone resistance-determining regions exhibited high fluoroquinolones resistance levels compared to those with wild ones. Genetic study of PMQR-harboring isolates revealed a great genomic diversity among each Enterobacteriaceae species. Our findings indicate the high prevalence of PMQR determinants among ESBL-producing Enterobacteriaceae isolates from our hospital and their diffusion in various unrelated CTX-M-15-producing clones.

Introduction

Since the introduction of fluoroquinolones (FQ) for clinical use, bacterial resistance to these agents has been rapidly developed. In Enterobacteriaceae, quinolone resistance was usually related to alterations in the targets and to decreased accumulation inside the bacteria as a result of impermeability of the membrane and/or an overexpression of efflux pump systems. Both of these mechanisms are chromosomally mediated.²⁶ The first plasmid-mediated quinolone resistance (PMQR) identified gene was qnrA.²² To date, five qnr genes (qnrA, qnrB, qnrD, qnrC, and qnrS) have been described in various Gram-negative bacteria. These genes, code for pentapeptide repeat proteins that protect the complex of DNA and DNA gyrase or topoisomerase IV enzymes from the inhibitory effect of quinolones.²⁶ Recently, two additional PMQR determinants have been described. The first is aac(6′)-Ib-cr which encodes for an aminoglycoside acetyltransferase variant. The two amino acid substitutions in this variant are responsible of ciprofloxacin inactivation through the acetylation of its piperazinyl substituent.²⁴ The second consist in two efflux pumps QepA and OqxAB that extrude quinolones and belong to the Major Facilitator Subfamily and to the Resistance-Nodulation-Cell Division family, respectively.²⁶ Plasmid-mediated quinolone resistance (PMQR) determinants have been identified worldwide with a quite high prevalence among extended-spectrum β-lactamases (ESBLs)-producing enterobacteria.²⁶ In the present study, we aimed to assess the prevalence of PMQR determinants in ESBLs-positive Enterobacteriaceae and to characterize strains harboring them.

Materials and Methods

Strain collection

From January to June 2010, 120 consecutive ESBL-producing enterobacteria (40 Escherichia coli, 40 Klebsiella pneumoniae, and 40 Enterobacter cloacae) were collected at the microbial Laboratory of Charles Nicolle hospital of Tunis. Only one isolate per species and per patient was considered. The microbial identification was determined by Gram staining, oxidase test, and API 20E strips (bioMérieux).

Antimicrobial susceptibility testing

Antimicrobial susceptibility was determined by disk diffusion method, according to the Clinical and Laboratory Standards Institute (CLSI) recommendations.¹⁰ The antibiotics tested were ampicillin, amoxicillin–clavulanic acid, ticarcillin, ticarcillin–clavulanic acid, piperacillin, piperacillin–tazobactam, cefalotin, cefoxitin, latamoxef, cefotaxime, ceftriaxone, ceftazidime, imipenem, ertapenem, cefepime, aztreonam, gentamicin, tobramicin, netilimicin, amikacin, nalidixic acid, ofloxacin, ciprofloxacin, tetracycline, chloramphenicol, colistin, and trimethoprime+sulfamethoxazole. ESBL production was detected by the double disk synergy test between clavulanic acid and ceftazidime, cefotaxime, aztreonam, or cefepime (with or without cloxacillin at 75 μg/ml).¹³

Minimal inhibitory concentrations (MICs) of nalidixic acid, norfloxacin, and ciprofloxacin were determined by agar dilution method according to CLSI recommendations. The concentration ranges of antibiotics tested were 0.015 to 1,024 μg/ml.

Characterization of PMQR-harboring strains

PMQR genes identification

PMQR genes, including qnrA, qnrB, qnrC, qnrD, qnrS, qepA, and oqxAB, were identified by polymerase chain reaction (PCR) and sequencing.^2,8,9,33,34 The identification of qnrB alleles was performed by a second sequencing analysis with appropriate primers designed in this study (Table 1).

Table 1.

Primers Used for Polymerase Chain Reaction and Sequencing of qnrB Genes

Primer	Sequences (5′-3′)	Genes	Size of PCR product (pb)
qnrB1F	ATGACGCCATTACTGTATAA	qnrB1	681
qnrB1LR	GATCGCAATGTGTGAAGTTT
qnrB2F	ATGGCTCTGGCACTCGTTGG	qnrB2	645
qnrB2R	CTAGCCAATAATCGCGATGC
qnrB4F	ATGATGACTCTGGCGTTAGT	qnrB4	605
qnrB4R	TTAACCCATGACAGCGATAC
qnrB8R	TTAGCCAATAATAGCGATGC

PCR, polymerase chain reaction.

The aac(6′)-Ib-cr variant was detected by restriction fragment length polymorphism method using FokI (TAKARA) and NdeI (Fermentas) restriction enzymes as previously described.²⁰ Briefly, aac(6′)-Ib native gene is digested only by FokI resulting in two fragments of 270 and 285 pb and aac(6′)-Ib-cr variant is digested only by NdeI resulting in two fragments of 534 and 66 pb.

bla gene typing

All PMQR-positive isolates were screened for the following bla genes: bla_TEM, bla_SHV, and bla_CTX-M by PCR and sequencing as previously described.⁴

Clonality

The genetic relationship between PMQR-harboring isolates were analyzed by pulsed-field gel electrophoresis (PFGE) using XbaI (Promega) enzyme. The interpretation of the PFGE patterns was performed by the FP-Quest software (BioRad) using the Dice Similarity coefficient. The tree indicating relative genetic similarity was constructed on the basis of unweighted pair group method of averages, position tolerance of 1%. Clusters were defined as DNA patterns sharing ≥70% similarity,¹ which corresponds to the possibly related criteria of Tenover et al.^7,32

Mutation detection in the quinolone resistance-determining regions

Mutations in the quinolone resistance-determining regions (QRDRs) of gyrA and parC genes, resulting in alterations at codons Ser-83 and Asp-87 in GyrA and codons Ser-80 and Glu-84 in ParC, were assessed by PCR and sequencing.^14,27

Conjugation and transformation assays

Isolates harboring PMQR determinants (n=72) were initially selected on Mueller–Hinton agar plates containing rifampicin at 400 μg/ml. Only 16 isolates were susceptible to rifampicin. These isolates were thus used for conjugation experiments. Resistance transfer was performed by a liquid mating method on brain heart broth medium. Culture mixtures were incubated overnight at 37°C with isolates harboring PMQR determinants as donor and E. coli J53 rifampicin-resistant as recipient at a 1:2 ratio (donor-to-recipient cell). Transconjugants were selected on Mueller–Hinton agar plates containing rifampicin at 400 μg/ml and ciprofloxacin at 0.05 μg/ml. When conjugation failed, transformation assays were performed. Plasmid DNA was extracted by an alkaline lysis method²⁹ and was electroporated into E. coli DH10B (Invitogen). Transformants were selected on Mueller–Hinton agar containing ciprofloxacin at 0.05 μg/ml. Antimicrobials susceptibility, PMQR and bla genes identification and plasmid incompatibility groups were determined for the isolates and their transconjugants.⁶

Results

All strains were susceptible to carbapenems and colistin. K. pneumoniae, E. coli, and E. cloacae were resistant to gentamicin (85%; 65%; 90%), tobramycin (90%;70%; 92.5%), netilmicin (62.5%; 17.5%; 35%), amikacin (57.5%; 12.5%; 17.5%), nalidixic acid (82.5%; 72.5%; 85%), ciprofloxacin (82.5%; 67.5%; 35%), and trimethoprime+sulfamethoxazole (85%; 60%; 82.5%), respectively.

PMQR determinants were detected in 72 (60%) isolates as follows: 32 (80%) in K. pneumoniae, 20 (50%) in E. coli, and 20 (50%) in E. cloacae.

The frequencies of PMQR genes were: qnr genes (n=31; 25.8%), oqxAB (n=26; 21.6%), and aac(6′)-Ib-cr variant (n=23; 19.2%) (Table 2).

Table 2.

Characteristics of the 72 Plasmid-Mediated Quinolone Resistance Positive Isolates

					MICs (μg/ml)			Mutations in QRDRs
Isolates	PMQR genes	Wards	Specimens	bla _ESBL genes	Nal (16–32) ^a	Nor (4–16) ^a	Cip (1–4) ^a	gyrA	parC	PFGE profile
KP21	oqxAB	Uro	Blood	bla_CTX-M-15	512	256	128	S(83)Y/D(87)N	S(80)I	PK1
KP10	oqxAB	Uro	Urine	bla_CTX-M-15	256	64	16	S(83)Y	wt	PK2
KP2	oqxAB	ICU	Blood	bla_CTX-M-15	256	256	128	S(83)Y/D(87)N	S(80)I	PK3
KP11	oqxAB,qnrB1	Der	Urine	bla_CTX-M-15	16	8	2	wt	wt	PK4
KP7	oqxAB,qnrB1	ICU	Blood	bla_CTX-M-15	16	8	4	wt	wt	PK5
KP6	oqxAB,qnrB1	ICU	Pus	bla_CTX-M-15	16	8	4	wt	wt	PK5
KP1	oqxAB	Ort	Urine	bla_CTX-M-15	256	64	32	S(83)F/D(87)A	wt	PK5
KP14	oqxAB	Uro	Urine	bla_CTX-M-15	512	128	64	S(83)Y/D(87)N	wt	PK5
KP24	oqxAB	ICU	Urine	bla_CTX-M-15	1,024	256	128	S(83)Y/D(87)N	S(80)I	PK5
KP41	aac(6′)-Ib-cr	ICU	Blood	bla_CTX-M-15	512	512	64	S(83)Y/D(87)N	wt	PK6
KP12	oqxAB	Ped	Urine	bla_CTX-M-15	8	0.5	0.12	wt	wt	PK6
KP35	oqxAB	Med	Urine	bla_CTX-M-15	512	256	128	S(83)Y/D(87)N	S(80)I	PK6
KP37	oqxAB	ICU	Blood	bla_CTX-M-15	512	256	128	S(83)Y/D(87)N	S(80)I	PK6
KP38	oqxAB	Uro	Urine	bla_CTX-M-15	512	256	64	S(83)F/D(87)A	wt	PK6
KP34	oqxAB	Med	Urine	bla_CTX-M-15	512	256	128	S(83)Y/D(87)N	wt	PK6
KP33	qnrB1	ICU	Urine	bla_CTX-M-15	256	16	2	S(83)Y	wt	PK6
KP40	qnrS1	Orl	Pus	bla_SHV-27	16	4	1	wt	wt	PK6
KP8	oqxAB	Med	Urine	bla_SHV-27	512	256	128	S(83)Y/D(87)N	wt	PK7
KP9	oqxAB	Uro	Urine	bla_CTX-M-15	4	2	0.12	wt	wt	PK7
KP30	oqxAB,qnrB1	ICU	Urine	bla_CTX-M-15	512	64	32	S(83)F/D(87)A	wt	PK8
KP27	oqxAB	Ped	Urine	bla_CTX-M-15	512	64	32	S(83)F/D(87)A	wt	PK8
KP3	oqxAB	Ped	Urine	bla_CTX-M-15	512	256	64	S(83)F/D(87)A	wt	PK9
KP18	oqxAB	ExC	Urine	bla_CTX-M-15	512	64	32	S(83)Y/D(87)N	wt	PK9
KP26	oqxAB	Uro	Urine	bla_CTX-M-15	512	128	64	S(83)F/D(87)A	wt	PK9
KP13	oqxAB,qnrB1	ICU	Blood	bla_CTX-M-15	512	256	64	S(83)F/D(87)N	wt	PK10
KP4	aac(6′)-Ib-cr	Ped	Urine	bla_CTX-M-15	512	512	64	S(83)Y/D(87)N	wt	PK10
KP15	oqxAB	Uro	Urine	bla_CTX-M-15	512	128	64	S(83)Y/D(87)N	wt	PK10
KP5	oqxAB	Uro	Urine	bla_CTX-M-15	512	64	8	S(83)F/D(87)A	wt	PK10
KP29	qnrB1	Ped	Urine	bla_CTX-M-15	16	4	1	wt	wt	PK11
KP19	oqxAB	Uro	Urine	bla_CTX-M-15	1,024	256	128	S(83)Y/D(87)N	wt	PK12
KP20	oqxAB	Neo	Pus	bla_CTX-M-15	2	0.5	0.06	wt	wt	PK12
KP23	aac(6′)-Ib-cr	ICU	Urine	bla_CTX-M-15	4	0.5	0.06	wt	wt	PK13
EC14	aac(6′)-Ib-cr	Uro	Urine	bla_CTX-M-15	512	128	64	S(83)L/D(87)N	S(80)I	PE1
EC18	aac(6′)-Ib-cr	Uro	Urine	bla_CTX-M-15	1,024	256	128	S(83)L/D(87)N	S(80)I/E(84)V	PE1
EC20	aac(6′)-Ib-cr	Neu	Urine	bla_CTX-M-15	4	0.25	0.06	wt	wt	PE1
EC21	aac(6′)-Ib-cr	Uro	Urine	bla_CTX-M-15	512	128	64	S(83)L/D(87)N	S(80)I	PE1
EC25	aac(6′)-Ib-cr	Ped	Urine	bla_CTX-M-15	512	128	64	S(83)L/D(87)N	S(80)I	PE1
EC33	aac(6′)-Ib-cr	ICU	Pus	bla_CTX-M-15	512	128	64	S(83)L/D(87)N	S(80)I	PE1
EC34	aac(6′)-Ib-cr	Sur	Blood	bla_CTX-M-15	1,024	256	128	S(83)L/D(87)N	S(80)I/E(84)V	PE1
EC36	aac(6′)-Ib-cr	Uro	Urine	bla_CTX-M-15	4	0.25	0.06	wt	wt	PE1
EC1	aac(6′)-Ib-cr	Uro	Urine	bla_CTX-M-15	512	128	64	S(83)L/D(87)N	S(80)I	PE2
EC19	aac(6′)-Ib-cr	Uro	Urine	bla_CTX-M-15	1,024	256	128	S(83)L/D(87)N	S(80)I/E(84)V	PE2
EC40	qnrB1, aac(6′)-Ib-cr	Uro	Urine	bla_CTX-M-15	512	128	64	S(83)L/D(87)N	S(80)I/E(84)G	PE3
EC22	aac(6′)-Ib-cr	Uro	Urine	bla_CTX-M-15	1,024	256	128	S(83)L/D(87)N	S(80)I/E(84)V	PE4
EC24	aac(6′)-Ib-cr	Uro	Urine	bla_CTX-M-15	512	128	64	S(83)L/D(87)N	S(80)I	PE5
EC30	qnrB1	Ped	Urine	bla_CTX-M-15	4	0.25	0.06	wt	wt	PE5
EC28	aac(6′)-Ib-cr	Med	Urine	bla_CTX-M-15	512	128	64	S(83)L/D(87)N	S(80)I	PE6
EC23	qnrB1, aac(6′)-Ib-cr	ICU	Pus	bla_CTX-M-15	4	0.25	0.06	wt	wt	PE7
EC4	aac(6′)-Ib-cr	ExC	Urine	bla_CTX-M-15	4	0.25	0.06	wt	wt	PE7
EC5	aac(6′)-Ib-cr	Uro	Urine	bla_CTX-M-15	512	128	64	S(83)L/D(87)N	S(80)I	PE8
EC35	aac(6′)-Ib-cr	Uro	Urine	bla_CTX-M-15	1,024	256	128	S(83)L/D(87)N	S(80)I/E(84)V	PE9
EC37	aac(6′)-Ib-cr	Uro	Urine	bla_CTX-M-15	1,024	256	128	S(83)L/D(87)N	S(80)I/E(84)V	PE9
CE4	qnrB1	Med	Urine	bla_CTX-M-15	512	512	64	S(83)I	wt	PC1
CE25	qnrB1	Gyn	Urine	bla_CTX-M-15	512	64	16	S(83)I	wt	PC1
CE10	qnrB2	Uro	Urine	bla_CTX-M-15	512	64	16	S(83)I	wt	PC2
CE19	qnrB1	Neo	Blood	bla_CTX-M-15	32	4	1	wt	wt	PC3
CE8	qnrB4	Sur	Pus	bla_CTX-M-15	16	1	0.125	wt	wt	PC4
CE23	qnrB1	Med	Urine	bla_SHV-12	512	64	16	S(83)I	wt	PC5
CE14	qnrB4	Neo	Pus	bla_CTX-M-15	16	1	0.5	wt	wt	PC6
CE18	qnrB1	Neo	Blood	bla_CTX-M-15	16	1	0.125	wt	wt	PC7
CE9	qnrB1	ICU	Blood	bla_CTX-M-15	4	0.125	0.03	wt	wt	PC8
CE3	qnrB1	Med	Urine	bla_SHV-12	512	512	64	S(83)I	wt	PC9
CE5	qnrB1	Med	Urine	bla_SHV-12	512	512	64	S(83)I	wt	PC9
CE7	qnrB1	Uro	Urine	bla_SHV-12	512	512	64	S(83)I	wt	PC9
CE2	qnrS1	Uro	Urine	bla_SHV-12	256	16	2	S(83)I	wt	PC10
CE40	qnrB1	Gyn	Urine	bla_CTX-M-15	512	64	16	S(83)I	wt	PC11
CE15	qnrB1, aac(6′)-Ib-cr	Neo	Catheter	bla_CTX-M-15	32	4	1	wt	wt	PC12
CE6	qnrB1	Neo	Pus	bla_CTX-M-15	16	2	0.5	wt	wt	PC12
CE12	qnrB1	Neo	Blood	bla_CTX-M-15	32	4	1	wt	wt	PC12
CE13	qnrB1	Neo	Pus	bla_CTX-M-15	32	4	1	wt	wt	PC12
CE17	qnrB1	Neo	Catheter	bla_CTX-M-15	32	8	0.5	wt	wt	PC12
CE21	qnrB1	Neo	Blood	bla_CTX-M-15	512	64	16	S(83)I	wt	PC12

MICs interpretive standard (μg/ml).

CE, Enterobacter cloacae; Cip, ciprofloxacin; Der, dermatology; EC, Escherichia coli; ExC, external consultation; Gyn, gynecology; ICU, intensive care unit; KP, Klebsiella pneumoniae; Med, medicine; MICs, minimal inhibitory concentrations; Nal, nalidixic acid; Neo, neonatology; Neu, neurology; Nor, norfloxacin; Orl, otorhinolaryngology; Ort, orthopedics; Ped, pediatrics; PFGE, pulsed-field gel electrophoresis; PMQR, plasmid-mediated quinolone resistance; QRDRs, quinolone resistance-determining regions; Sur, surgery; Uro, urology; wt, wild type.

According to species, the frequencies of qnr, aac(6′)-Ib-cr variant, and oqxAB were 7.5%, 47.5%, and 0% in E. coli, respectively, 15%, 7.5%, and 65% in K. pneumoniae, respectively and 50%, 2.5%, and 0% in E. cloacae, respectively.

The qnr alleles were identified as qnrB1 (83.8%), qnrB4 (6.4%), qnrB2 (3.2%), and qnrS1 (6.4%). The qnrA, qnrC, qnrD, and qepA genes were not detected in our collection.

In eight isolates, two PMQR determinants were concomitantly detected. They were qnrB1 and aac(6′)-Ib-cr (two E. coli and one E. cloacae isolates) and oqxAB and aac(6′)-Ib-cr (5 K. pneumoniae isolates).

The study of clonal relatedness of PMQR-positive E. coli showed nine pulsotypes (PE1 to PE9), with PE1 as the major one (eight isolates). The majority of these strains were recovered from urology (n=12), four of them belonged to PE1 clone.

In PMQR-positive K. pneumoniae, 13 different pulsotypes (PK1 to PK13) were identified with three major clusters, PK10 (four isolates), PK5 (five isolates), and PK6 (eight isolates). They were diffused mainly in the intensive care unit (n=10), urology (n=9), and in pediatrics (n=5) and showed a great genetic diversity.

E. cloacae isolates carrying PMQR determinants were clustered into 12 pulsotypes with PC12 as the major one (six isolates). This clone was confined in the neonatology ward (Table 2).

Overall, bla_CTX-M-15 was the most frequent bla_ESBL gene in the three species. It was detected in 20 (100%) E. coli (19 of them carried cr variant), 30 (93.7%) K. pneumoniae (26 of them carried oqxAB genes), and 15 (75%) E. cloacae (11 of them carried qnrB1). bla_SHV-12 was detected in five E. cloacae isolates which carried qnrB1and bla_SHV-27 was found in two K. pneumoniae isolates which carried qnrS1 and oqxAB each (Table 2).

For both species E. coli and K. pneumoniae carrying PMQR determinant, MIC₅₀ of nalidixic acid, norfloxacin, and ciprofloxacin were 512, 128, and 64 μg/ml, respectively. Those of PMQR-positive E. cloacae were 32, 8, and 1 μg/ml, respectively (Table 2).

Chromosomal mutations in gyrA and parC genes were detected in 75% of E. coli, 72.8% of K. pneumoniae, and 50% of E. cloacae harboring PMQR genes (Table 2).

Globally, isolates with mutations in their QRDRs exhibited higher quinolones/FQ resistance levels in comparison to those with wild genes (Table 2).

Over 16 PMQR determinants, only 13 (8 qnrB, 4 aac(6′)-Ib-cr and 1 qnrS1) were transferred. The frequency of transfer varied from 3.3×10⁻⁸ to 3.7×10⁻⁵. All these PMQR were cotransferred with bla_CTX-M-15 except one, which was cotransferred with bla_TEM-1.

Transferred plasmid-harboring aac(6′)-Ib-cr variant and qnrB1 were mainly associated with IncFIA and IncF-type and qnrS1 gene was associated with IncN-type. Plasmid replicon type could not be determined for four isolates which carried qnrB1 (Table 3).

Table 3.

Characteristics of Plasmid-Mediated Quinolone Resistance Positive Strains and Their Transconjugants

					MICs
	Plasmid incompatibility group	Resistance profile	PMQR determinants	bla associated genes	Nal (16–32) ^a	Nor (4–16) ^a	Cip (1–4) ^a
KP4	FIA	Gen-Tob-Net-Nal-Cip-Tet-Sxt	aac(6′)-Ib-cr	bla_CTX-M-15	512	512	64
TcKP4	FIA	Gen-Tob-Net-Tet-Sxt	aac(6′)-Ib-cr	bla_CTX-M-15	8	1	0.06
KP6	—	Gen-Tob-Tet-Sxt	qnrB1/oqxAB	bla_CTX-M-15	16	8	4
TcKP6	—	Tet-Sxt	qnrB1	bla_CTX-M-15	8	2	0.125
KP7	—	Gen-Tob-Tet-Sxt	qnrB1/oqxAB	bla_CTX-M-15	16	8	4
TcKP7	—	Tet-Sxt	qnrB1	bla_CTX-M-15	8	2	0.25
KP23	FIA	Gen-Tob-Net-Sxt	aac(6′)-Ib-cr	bla_CTX-M-15	4	0.5	0.06
TcKP23	FIA	Gen-Tob-Net-Sxt	aac(6′)-Ib-cr	bla_CTX-M-15	4	0.5	0.06
KP29	FIA	Gen-Tob-Net-Tet-Sxt	qnrB1	bla_CTX-M-15	16	4	1
TcKP29	FIA	Tet-Sxt	qnrB1	bla_CTX-M-15	16	2	0.125
KP40	N	Sxt	qnrS1	bla_SHV-27/bla_TEM-1	16	4	1
TcKP40	N	Sxt	qnrS1	bla_TEM-1	8	2	0.125
CE6	FIB	Gen-Tob-Tet-Sxt-C	qnrB1	bla_CTX-M-15	16	2	0.5
TcCE6	FIB	Tet-Sxt	qnrB1	bla_CTX-M-15	4	0.5	0.06
CE17	—	Gen-Tob-Net-Tet-Sxt-C	qnrB1	bla_CTX-M-15	32	8	0.5
TcCE17	—	Tet–Sxt	qnrB1	bla_CTX-M-15	16	2	0.125
CE10	F	Gen-Tob-Net-Nal-Cip-Tet-Sxt-C	qnrB2	bla_CTX-M-15	512	64	16
TcCE10	F	Tet-Sxt-C	qnrB2	bla_CTX-M-15	16	2	0.06
CE18	—	Gen-Tob-Net-Tet-Sxt	qnrB1	bla_CTX-M-15	16	1	0.125
TcCE18	—	Gen-Tob-Net-Tet-Sxt	qnrB1	bla_CTX-M-15	8	1	0.06
EC1	FIA-F	Gen-Tob-Net-Nal-Cip-Tet-Sxt	aac(6′)-Ib-cr	bla_CTX-M-15	512	128	64
TcEC1	FIA-F	Gen-Tob-Net-Tet-Sxt	aac(6′)-Ib-cr	bla_CTX-M-15	4	1	0.25
EC5	FIA-F	Gen-Tob-Net-Nal-Cip-Tet-Sxt	aac(6′)-Ib-cr	bla_CTX-M-15	512	128	64
TcEC5	FIA-F	Gen-Tob-Net- Tet-Sxt	aac(6′)-Ib-cr	bla_CTX-M-15	8	0.5	0.06
EC40	F	Gen-Nal-Cip-Tet-Sxt-C	qnrB1/aac(6′)-Ib-cr	bla_CTX-M-15	512	128	64
TcEC40	F	Gen-Tet-Sxt	qnrB1/aac(6′)-Ib-cr	bla_CTX-M-15	32	4	1

MICs interpretive standard (μg/ml).

C, chloramphenicol; CE, E. cloacae; Cip, ciprofloxacin; EC, E. coli; Gen, gentamicin; KP, K. pneumoniae; Nal, nalidixic acid; Nor, norfloxacin; Net, netilmicin; Sxt, trimethoprim-sulfamethoxazole; Tet, tetracycline; Tob, tobramycin.

Quinolones/FQ MICs of transconjugants ranged from 4 to 32 μg/ml for nalidixic acid, 0.5 to 4 μg/ml for norfloxacin, and 0.06 to 1 μg/ml for ciprofloxacin (Table 3).

Discussion

In the present study, we found that the prevalence of PMQR genes was 60% among a collection of 120 ESBL-producing isolates. The prevalence of these genes was higher in K. pneumoniae (80%) than in E. coli and E. cloacae (50%). Over the past 10 years, PMQR determinants have emerged as an important issue. Their detection among clinical ESBL-producing Enterobacteriaceae has been widely investigated and different rates have been reported depending on the country, origin of isolates, and the number of enterobacteria species included. Our results were comparable to those recently conducted in Mexico (61.1%).³⁰ A higher prevalence was noted in Argentina (66.6%), however low prevalence was noted in France (29.8%), Spain (19.8%), and China (13.5%).^12,17

Overall, qnr genes were the most frequent PMQR determinant in our series (25.8%) with qnrB1 as the major allele, however qnrB2 and qnrB4 remained rare. To date, 25 qnrB genes were described (www.lahey.org/qnrStudies), but only six variants, including qnrB1, qnrB2, qnrB4, qnrB5, qnrB6, and qnrB19 have been frequently reported over the world.²⁶ As found in our study, high prevalence of qnrB was noted in Mexico (21.6%), Morocco (36%), and in Ivory Coast (27.2%).^3,17,30 However, low frequencies were found in European countries, including Spain, Sweden (3.7%), and Hungary (4.2%).^5,15,31 In Tunisia, qnrB1 (8.6%), qnrB2 (3.9%), and qnrB6 (1.1%) were previously detected among 278 clinical Enterobacteriaceae strains resistant to extended-spectrum cephalosporins.¹⁸ The low prevalence of qnrS1 (6.4%) and the absence of qnrA observed in our series were comparable to the most surveillance studies conducted in Tunisia (7.5%), France (4.3%), and Peru (3.7%),^12,18,19 whereas they were found at similar frequencies with qnrB in China.¹⁸

In our collection, the prevalence of qnr genes was higher among E. cloacae than K. pneumoniae and E. coli. This distribution of qnr genes among different ESBL-producing Enterobacteriaceae isolates was in agreement with previous reports from Mexico and USA.^22,25 However, other investigations conducted in Tunisia, Korea, and Hungary showed that qnr genes were more prevalent among K. pneumoniae.^14,19,35

In our series, oqxAB genes were detected among 26 (21.6%) K. pneumoniae. However, they were absent among E. coli and E. cloacae. oqxAB genes were first described in E. coli from pigs in Denmark. Actually few data are available on the prevalence of this determinant especially in human clinical isolates. In Korea, oqxAB genes were found in 0.4% of E. coli, 4.6% of E. cloacae, and in 74.1% of K. pneumoniae.² In China, oqxAB genes were found in 6.6% of E. coli and in 100% of K. pneumoniae.³⁶

In our collection, the aac(6′)-Ib-cr variant was detected in 23 (19.2%) isolates. It was mainly recovered from E. coli and remained rare among K. pneumoniae and E. cloacae. The aac(6′)-Ib-cr gene is involved in resistance to FQ as well as to aminoglycosides. It was firstly reported among E. coli isolates in China, but is now recognized to be widely disseminated.²⁶ In fact, several studies carried out worldwide have shown that the prevalence of aac(6′)-Ib-cr among ESBL-producing Enterobacteriaceae varied from 9.9% in China, 16.2% in Spain to 25.5% in France, and 37.6% in Mexico.^11,18,30 The prevalence of aac(6′)-Ib-cr varied between species, but was frequently found among E. coli than other enterobacteria.

We found that E. coli harboring aac(6′)-Ib-cr variant, K. pneumoniae harboring oqxAB and E. cloacae carrying qnrB1, were specifically disseminated in urology, intensive care unit, and neonatology ward respectively. This could be explained by the large use of the third generation cephalosporins and FQ in these wards, which facilitate the selection of such multidrug resistant strains. Also the medical staff hand carriage, contaminated equipments, or instruments could contribute to the spread of these strains.¹

Currently, CTX-M extended-spectrum β-lactamases are the most common type of ESBL over the world, with CTX-M-15 as the most widespread variant mainly in the community. In the present study, CTX-M-15 was the most prevalent ESBL enzyme detected among different PMQR-carrying isolates. Among E. coli isolates, we noted a close association between bla_CTX-M-15 gene and the cr variant. It has been reported that isolates with the aac(6′)-Ib-cr variant often possess a CTX-M-15-producing plasmid.^21,23 Indeed, several reports confirmed that such a widespread association was due to the successful diffusion of E. coli ST131 pandemic clone CTX-M-15 producer.

In our series, CTX-M-15 enzyme identified among K. pneumoniae and E. cloacae isolates was mainly associated with oqxAB and qnrB1, respectively. Moreover, SHV β-lactamase was detected only in seven isolates, including five SHV-12 and two SHV-27. They were mainly harboring qnr determinants (five qnrB1 and one qnrS1). Previous reports showed that PMQR genes were associated with diverse ESBL types such as SHV, LAP, TLA, and VEB.²⁶

Successful transfer of quinolone resistance was obtained for 13 strains and all of them showed an associated ESBL phenotype, except one. The cocarriage of PMQR determinants and ESBL enzymes provides an evolutionary benefit to these strains in an antibiotic-rich environment, and leads to their selection under both β-lactam and quinolone pressure. In this respect, aac(6′)-Ib-cr provides an even greater advantage by also conferring resistance to certain aminoglycosides.

In our collection, PMQR-harboring isolates with wild-type topoisomerase expressed low MICs to FQ than those with mutated ones. These data agree with previous reports showing that the presence of PMQR determinants does not necessarily lead to FQ MICs above CLSI breakpoints.^24,26 In addition, we found that all transconjugants, carrying different PMQR determinants, were susceptible to FQ (0.06 to 1 μg/ml) suggesting that high resistance level in the original isolates could be related to chromosomal mutations in QRDR of gyrA and parC genes. Given their transferability and the difficulty of their phenotypic detection, molecular identification of PMQR determinants, as well as prudent use of FQ are required especially in ESBL-producing strains.

Our results showed that efflux pump genes oqxAB, could not be transferred neither by conjugation nor by transformation. In fact, recent studies suggested the chromosomal location of this plasmid-mediated resistance in K. pneumoniae genome.²⁸

In the present study, we demonstrate that conjugative plasmids belonged to a variety of incompatibility groups, IncFIA, IncF, IncFIB, and IncN, and were involved in the dissemination of PMQR determinants. These same plasmid groups were previously detected in our hospital among uropathogenic E.coli isolates harboring PMQR determinants during the period 2006–2009, suggesting their important role in the persistence and diffusion of multidrug resistance isolates in our hospital.¹⁶

PFGE results in this study showed that the different PMQR-harboring species have spread in our hospital through clonally related strains as well as through several sporadic clones.

In conclusion, this study revealed the high prevalence of PMQR genes among ESBL-producing enterobacteria in our institution. oqxAB, qnrB1, and aac(6′)-Ib-cr variant were widely distributed among K. pneumoniae, E. cloacae, and E. coli isolates, respectively. The bla_CTX-M-15 was found to be the dominant ESBL-encoding gene. PMQR determinants were associated with reduced quinolone susceptibility in the absence of chromosomal substitutions in gyrA and parC genes. Our study further indicates that PMQR-carrying plasmids were transconjugable, which provide an advantage in their dissemination between clones and even between species. Finally, the screening of ESBL-producing enterobacteria for PMQR carriage is needed to avoid the spread of these newer determinants.

Footnotes

Acknowledgments

This work was supported by the Ministry of Scientific Research, Technology, and Competence Development of Tunisia.

E. coli qnrA(+), K. pneumoniae qnrB(+), E. cloacae qnrS(+) positive control strains were kindly given by Nordman P (France) and E. coli aac(6′)-Ib-cr (+) by Berçot B (France). Plasmids DNA containing qepA1, qnrD, and qnrC genes were kindly given by Yamane K (Japan), Cavacalo L (Denmark), and Wang M (China), respectively.

Disclosure Statement

No competing financial interests exist.

References

Barbosa

T.M.

, and Levy

S.B.

. 2000. The impact of antibiotic use on resistance development and persistence. Drug Resist. Update, 3:303–311.

Bin Kim

, Wang

, Park

C.H.

, Kim

E.C.

, Jacoby

G.A.

, and Hooper

D.C.

. 2009. oqxAB encoding a multidrug efflux pump in human clinical isolates of Enterobacteriaceae. Antimicrob. Agents Chemother., 53:3582–3584.

Bouchakour

, Zerouali

, Gros Claude

J.D.P.

, Amarouch

, El Mdaghri

, Courvalin

, and Timinouni

. 2010. Plasmid-mediated quinolone resistance in expanded spectrum beta lactamase producing Enterobacteriaceae in Morocco. J. Infect. Dev. Ctries., 4:799–803.

Branger

, Zamfir

, Geoffroy

, Laurans

, Arlet

, Thien

H.V.

, Gouriou

, Picard

, and Denamur

. 2005. Genetic background of Escherichia coli and extended-spectrum beta-lactamase type. Emerg. Infect. Dis., 11:54–61.

Briales

, Rodríguez-Martínez

J.M.

, Velasco

, de Alba

P.D.

, Rodríguez-Baño

, Martínez-Martínez

, and Pascual

. 2012. Prevalence of plasmid-mediated quinolone resistance determinants qnr and aac(6′)-Ib-cr in Escherichia coli and Klebsiella pneumoniae producing extended-spectrum β-lactamases in Spain. Int. J. Antimicrob. Agents, 39:431–434.

Carattoli

, Bertini

, Villa

, Falbo

, Hopkins

K.L.

, and Threlfall

E.J.

. 2005. Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods, 63:219–228.

Carriço

J.A.

, Pinto

F.R.

, Simas

, Nunes

, Sousa

N.G.

, Frazão

, de Lencastre

, and Almeida

J.S.

. 2005. Assessment of band-based similarity coefficients for automatic type and subtype classification of microbial isolates analyzed by pulsed-field gel electrophoresis. J. Clin. Microbiol., 43:5483–5490.

Cattoir

, Poirel

, Rotimi

, Soussy

C.J.

, and Nordmann

. 2007. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J. Antimicrob. Chemother., 60:394–397.

Cavaco

L.M.

, Hasman

, Xia

, and Aarestrup

F.M.

. 2009. qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovismorbificans strains of human origin. Antimicrob. Agents Chemother., 53:603–608.

10.

Clinical and Laboratory Standards Institute (CLSI). 2006. Performance Standards for Antimicrobial Susceptibility Testing. Sixteenth information supplement, M100-S16. CLSI, Wayne, PA.

11.

Crémet

, Caroff

, Dauvergne

, Reynaud

, Lepelletier

, and Corvec

. 2011. Prevalence of plasmid-mediated quinolone resistance determinants in ESBL Enterobacteriaceae clinical isolates over a 1-year period in a French hospital. Pathol. Biol., 59:151–156.

12.

Cruz

G.R.

, Radice

, Sennati

, Pallecchi

, Rossolini

G.M.

, Gutkind

, Di Conza

J.A.

. 2013. Prevalence of plasmid-mediated quinolone resistance determinants among oxyiminocephalosporin-resistant Enterobacteriaceae in Argentina. Mem Inst Oswaldo Cruz, Rio de Janeiro., 108:924–927.

13.

Drieux

, Brossier

, Sougakoff

, and Jarlier

. 2008. Phenotypic detection of extended-spectrum b-lactamase production in Enterobacteriaceae: review and bench guide. Clin. Microbiol. Infect., 14:90–103.

14.

Everett

M.J.

, Jin

Y.F.

, Ricci

, and Piddock

L.J.

. 1996. Contributions of individual mechanisms to fluoroquinolone resistance in 36 Escherichia coli strains isolated from humans and animals. Antimicrob. Agents Chemother., 40:2380–2386.

15.

Fang

, Huang

, Shi

, Hedin

, Nord

C.E.

, and Ullberg

. 2009. Prevalence of qnr determinants among extended-spectrum beta-lactamase-positive Enterobacteriaceae clinical isolates in southern Stockholm, Sweden. Int. J. Antimicrob. Agents, 34:268–270.

16.

Ferjani

, Saidani

, Quuenti

, Slim Amine

, Boutiba Ben Boubaker

, and Dubois

. 2014. Prevalence and characterization of uropathogenic Escherichia coli harboring plasmid-mediated quinolone resistance in a Tunisian university hospital. Diagn. Microbiol. Infect. Dis., 79:247–251.

17.

Guessennd

, Bremont

, Gbonon

, Kacou-Ndouba

, Ekaza

, Lambert

, Dosso

, and Courvalin

. 2008. Qnr-Type quinolone resistance in extended-spectrum beta-lactamase producing enterobacteria in Abidjan, Ivory Coast. Pathol. Biol., 56:439–446.

18.

Jiang

, Zhou

, Qian

, Wei

, Yu

, Hu

, and Li

. 2008. Plasmid-mediated quinolone resistance determinants qnr and aac(6′)-Ib-cr in extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in China. J. Antimicrob. Chemother., 61:1003–1006.

19.

Jlili

N.E

, Réjiba

, Smaoui

, Guillard

, Chau

, Kechrid

, and Cambau

2014. Trend of plasmid-mediated quinolone resistance genes at the Children's Hospital in Tunisia. J. Med. Microbiol., 63:195–202.

20.

Jones

G.L.

, Warren

R.E.

, Skdmore

S.J.

, Davies

V.A.

, Gilbreel

, and Upton

. 2008. Prevalence and distribution of plasmid-mediated quinolone resistance genes in clinical isolates of Escherichia coli lacking extented-spectrum ß-lactamases. J. Antimicrob. Chemother., 62:1245–1251.

21.

Machado

, Coque Rafael Cantón

T.M.

, Baquero

, Sousa

J.C.

, and Peixe

. 2006. Dissemination in Portugal of CTX-M-15-, OXA-1-, and TEM-1-producing Enterobacteriaceae strains containing the aac(6)-Ib-cr gene, which encodes an aminoglycoside-and fluoroquinolone-modifying enzyme. Antimicrob. Agents Chemother., 50:3220–3221.

22.

Martínez-Martínez

, Pascual

, and Jacoby

G.A.

. 1998. Quinolone resistance from a transferable plasmid. Lancet, 351:797–799.

23.

Perilli

, Forcella

, Celenza

, Frascaria

, Segatore

, Pellegrini

, and Amicosante

. 2009. Evidence for qnrB1 and aac(6)-Ib-cr in CTX-M-15-producing uropathogenic Enterobacteriaceae in an Italian teaching hospital. Diagn. Microbiol. Infect. Dis., 64:90–93.

24.

Robicsek

, Strahilevitz

, Jacoby

G.A.

, Macielag

, Abbanat

, Park

C.H.

, Bush

, and Hooper

D.C.

. 2006. Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase. Nat. Med., 12:83–88.

25.

Robicsek

, Strahilevitz

, Sahm

D.F.

, Jacoby

G.A.

, and Hooper

D.C.

. 2006. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother., 50:2872–2874.

26.

Rodríguez-Martínez

J.M.

, Cano

M.E.

, Velasco

, Martínez-Martínez

, and Pascual

. 2011. Plasmid-mediated quinolone resistance: an update. J. Infect. Chemother., 17:149–182.

27.

Rodriguez-Martinez

J.M.

, Velasco

, Pascual

, Garcia

, and Martinez-Martinez

. 2006. Correlation of quinolone resistance levels and differences in basal and quinolone-induced expression from three qnrA-containing plasmids. Clin. Microbiol. Infect., 12:440–445.

28.

Ruiz

, Sáenz

, Zarazaga

, Gracia

R.R.

, Martínez

L.M.

, Arleté

, and Torres

. 2012. qnr, aac(6′)-Ib-cr and qepA genes in Escherichia coli and Klebsiella spp:genetic environments and plasmid and chromosomal location. J. Antimicrob. Chemother., 67:886–897.

29.

Sambrouk

, and Russel

D.W.

. Molecular Cloning, 3rd edition. Cold spring Habor Laboratory Press, Cold spring Habor, NY, 2001.

30.

Silva-Sanchez

, Barrios

, Reyna-Flores

, Bello-Diaz

, Sanchez-Perez

, and Rojas; Bacterial Resistance Consortium

and Garza-Ramos

. 2011. Prevalence and characterization of plasmid-mediated quinolone resistance genes in extended-spectrum β-lactamase-producing Enterobacteriaceae isolates in Mexico. Microb. Drug Resist., 17:497–505.

31.

Szabo

, Kocsis

, Rókusz

, Szentandrássy

, Katona

, Kristóf

, and Nagy

. 2008. First detection of plasmid-mediated, quinolone resistance determinants qnrA, qnrB, qnrS and aac(6′)-Ib-cr in extended-spectrum b-lactamase (ESBL)-producing Enterobacteriaceae in Budapest, Hungary. J. Antimicrob. Chemother., 62:630–632.

32.

Tenover

F.C.

, Arbeit

R.D.

, Goering

R.V.

, Mickelsen

P.A.

, Murray

B.E.

, Persing

D.H.

, and Swaminathan

. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin Microbiol., 33:2233–2239.

33.

Wang

, Guo

, Xu

, Wang

, Ye

, Wu

, Hooper

D.C.

, and Wang

. 2009. New plasmid-mediated quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis. Antimicrob. Agents Chemother., 53:1892–1897.

34.

Yamane

, Wachino

, Suzuki

, Kimura

, Shibata

, Kato

, Shibayama

, Konda

, and Arakawa

. 2007. New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob. Agents Chemother., 51:3354–3360.

35.

Young Kang

, Dorji

T.M.

, Seol

S.Y.

, and Kim

. 2009. Dissemination of Plasmid-mediated qnr, aac(6′)-Ib-cr, and qepA Genes Among 16S rRNA Methylase Producing Enterobacteriaceae in Korea. J. Bacteriol. Virol., 39:173–182.

36.

Yuan

, Xu

, Guo

, Zhao

, Ye

, Guo

, and Wang

. 2012. Prevalence of the oqxAB gene complex in Klebsiella pneumoniae and Escherichia coli clinical isolates. J. Antimicrob. Chemother., 67:1655–1659.