High-Level Macrolide-Resistant Moraxella catarrhalis and Development of an Allele-Specific PCR Assay for Detection of 23S rRNA Gene A2330T Mutation: A Three-Year Study at a Chinese Tertiary Hospital

Abstract

Previous studies indicate that macrolide resistance in Moraxella catarrhalis isolates is less common in adults than in children. However, few studies have investigated M. catarrhalis macrolide resistance mechanisms in adult patients. In this study, 124 M. catarrhalis isolates were collected from adult patients in a Chinese tertiary hospital, between 2010 and 2013, and investigated for antimicrobial resistance. We found that only seven isolates were macrolide resistant and all exhibited high-level macrolide resistance (minimum inhibitory concentrations >256 μg/ml). Multilocus sequence typing (MLST) suggested that M. catarrhalis has a diverse population; in particular, both pulsed-field gel electrophoresis and MLST revealed that all the seven high-level macrolide-resistant M. catarrhalis belonged to different clones. A 934-bp 23S rRNA gene sequencing showed that only nine isolates (including all the seven macrolide-resistant isolates) had mutations within the studied region, and only the seven macrolide-resistant isolates had mutation of A2330T. No other known macrolide-resistance determinant genes (ermA, ermB, mefA, or mefE) were detected. These findings support previous studies in children on M. catarrhalis macrolide-resistant isolates and suggest that the 23S rRNA gene A2330T mutation is responsible for the high M. catarrhalis macrolide resistance. The findings prompted us to successfully develop a simple allele-specific polymerase chain reaction assay for high-level macrolide-resistant 23S rRNA gene A2330T mutation for future clinical and further surveillance use.

Introduction

Moraxella catarrhalis has been associated with a number of respiratory infections affecting both children and adults, including laryngitis,¹² bronchitis,¹ and pneumonia.^15,17 Macrolide antibiotics initially appeared to provide a safe alternative to β-lactam antibiotics for the treatment of pediatric respiratory illnesses, with a low risk of serious side effects.¹⁰ However, macrolide-resistant M. catarrhalis has been reported in several studies worldwide.^3,9,20 At present, most surveillance on the antibiotic susceptibility of M. catarrhalis is focused on healthy children or children with community-acquired respiratory tract infections,^2,7,11,16 and limited data are available from adults.²⁴ In a previous study, we reported the high prevalence of macrolide-nonsusceptible M. catarrhalis isolated from the nasopharynx of healthy children in China.¹⁶ Nonsusceptibility rates to erythromycin and azithromycin, determined using Clinical Laboratory Standards Institute (CLSI) breakpoints, were 40.3% and 22.5%, respectively.¹⁶ Moreover, we previously determined the A2330T (position referring to M. catarrhalis 23S rRNA gene; GenBank No. NR_103214.1) macrolide-resistant mechanism and suggested that the ribosomal mutation was critical for creating macrolide-nonsusceptible M. catarrhalis.¹⁶ In the same year, Saito et al. confirmed that the 23S rRNA gene A2330T (A2058T if referring to Escherichia coli 23S rRNA gene sequence; Supplementary Table S1; Supplementary Data are available online at www.liebertpub.com/mdr) mutation could lead to isolates with high-level resistance to azithromycin (minimum inhibitory concentration [MIC] >256 μg/ml).²¹

The aims of the present study were (1) to better understand the prevalence of M. catarrhalis macrolide resistance in adult patients; (2) to further investigate the M. catarrhalis macrolide resistance mechanisms in adult patients to extend our previous findings in children; (3) using multilocus sequence typing (MLST) and pulsed field gel electrophoresis (PFGE) to understand the genetic relationships among macrolide-resistant isolates; and (4) to develop a practical allele-specific polymerase chain reaction (PCR) assay to identify M. catarrhalis macrolide-resistant 23S rRNA gene A2330T mutation for future clinical and surveillance use.

Materials and Methods

Bacterial isolates

Nonduplicate M. catarrhalis isolates were collected from the sputum or bronchoalveolar lavage of adult patients in the Peking Union Medical College hospital between 2010 and 2013. The isolates were identified using standard microbiological methods: colony morphology, Gram stain, oxidase test, DNase production, and a nitrate reduction test. All isolates were also identified by two different models of mass spectrometry (MALDI-TOF MS) Bruker Biotyper (Bruker Daltonics, Bremen, Germany) and Vitek MS (BioMérieux, Marcy l′Etoile, France). All the culture media (Thermo Fisher, Oxoid, Basingstoke, United Kingdom) and materials for biochemical reactions (Hangzhou Tian-He Microorganism Reagent Co., Ltd, Hangzhou, China) used for identification were purchased from the same manufacturer. Isolates were stored at −70°C until testing, with a minimum number of passages.

Antimicrobial susceptibility testing

The isolates were tested for susceptibility to erythromycin and azithromycin using the Kirby–Bauer disc diffusion (Thermo Fisher, Oxoid) method in accordance with the CLSI 2010 guideline.⁶ Breakpoint interpretations were based on the current CLSI guideline.⁶ Staphylococcus aureus ATCC 25923 was used for quality control.

In addition, the E-test (BioMérieux, France) method was used to determine MICs of the macrolide-resistant M. catarrhalis isolates. Production of β-lactamase was detected by using the Nitrocefin test (Thermo Fisher, Oxoid).

Molecular typing for genetic population study

MLST (http://mlst.warwick.ac.uk/mlst/dbs/mcatarrhalis/) and PFGE were performed on all the 124 isolates (including all 7 resistant isolates and 117 susceptible isolates), as previously described.^16,23 All isolates were also investigated by copB gene PCR-restriction fragment length polymorphisms (RFLP).

Common macrolide-resistant determinants and partial 23S rRNA gene analysis

The presence of macrolide-resistant determinants (ermA, ermB, mefA, and mefE) was detected by specific PCRs as described by Mazzariol et al.¹⁸ The 23S rRNA gene was amplified and sequenced using primer pairs described before.¹⁶

Developing allele-specific PCR assay to identify the 23S rRNA gene A2330T mutation

Targeting 23S rRNA gene A2330T mutation (Supplementary Fig. S1 for detail), we designed four pairs of allele-specific primers (2330FA ²³¹¹TGTACCCGCGGCTAGACGGA²³³⁰/2428R ²⁴⁵²AGGGTGGTATTTCAAGGTTGGCTCC²⁴²⁸; 2330FTT ²³¹¹TGTACCCGCGGCTAGACGTT²³³⁰/2428R ²⁴⁵²AGGGTGGTATTTCAAGGTTGGCTCC²⁴²⁸; 2214F ²¹⁸⁶CTATAACGGTCCTAAGGTAGCGAAATTCC²²¹⁴/2330RTA ²³⁵⁶GCTGTAGTAAAGGTTCACGGGGTCTTA²³³⁰; 2214F ²¹⁸⁶CTATAACGGTCCTAAGGTAGCGAAATTCC²²¹⁴/2330RCA²³⁵⁶GCTGTAGTAAAGGTTCACGGGGTCTCA²³³⁰) to identify the 23S rRNA gene A2330T single-nucleotide polymorphisms (SNPs) (T or A). PCR was performed in volumes of 25 μl, and 2× TransTaq High Fidelity (HiFi) PCR SuperMix I (TransGen Biotech, Beijing, China) was used for amplification, with an initial denaturation temperature of 95°C for 10 min, followed by 35 cycles of 95°C for 15 sec, 70°C for 15 sec, 72°C for 30 sec, and a final extension of 72°C for 7 min. PCR products were checked by agarose gel electrophoresis.

The GenBank/EMBL/DDBJ accession numbers

The 934-bp 23S rRNA gene fragment sequences from this study have been submitted to GenBank with accession numbers of KM114615 and the others are listed in Table 1.

Table 1.

Dual Locus (copB and 23S rRNA Genes) Typing Results of All 124 Isolates

Susceptibility	Gene mutation details	GenBank No.	Strain ID no. or isolate no.	copB	β-Lactamase
Resistant isolates	A2144T, A2330T, and C2480T	JN164689.1	11XR04410	II	+
			10R06500	II	+
	A2330T and C2480T	JN164688.1	13R13685	II	+
			11R01612	I/III	+
	A2330T	JN164698.1	10R06882	I/III	+
			10R01390	I/III	+
			13R12051	I/III	+
Susceptible isolates with 23S rRNA gene mutation	C2480T	JN164697.1	10R01363	IV	+
	A2475G, G2476A, C2480T, A2485G, and C2489T	KM114615.1	11R03731	IV	+
Susceptible isolates without 23S rRNA gene mutation	None	NR_103214.1	n=64	I/III	+
			n=50	II	+
			n=1	II	−

Results

Patient details and antibiotic susceptibility results

A total number of 124 patients were included in this study. Ages ranged from 23 to 98 years, and the majority (67%) was male.

Of the 124 isolates confirmed as M. catarrhalis, 117 were susceptible to erythromycin and azithromycin and 7 were resistant to both antibiotics. All seven resistant isolates had erythromycin and azithromycin MICs >256 μg/ml. All isolates except one (macrolide susceptible) were β-lactamase positive.

The median age of the 117 patients with macrolide-susceptible isolates was 62.0 (range 23–98) years, and the median age of the 7 patients who yielded macrolide-resistant isolates was also 62.0 (range 42–98) years. Six of these seven patients were older than 60 years and two (29%) had received macrolide antibiotics within the previous 30 days.

M. catarrhalis genetic population study

All isolates were examined using the copB PCR-RFLP method (Table 1). Results indicate that the majority of the isolates were copB I/III and II (98.4%, 122/124, respectively).

We utilized PFGE analysis to determine the clonal relationship of the seven high-level macrolide-resistant isolates, and seven pulsotypes were found (Supplementary Figs. S2 and S3), which means all of them originated from different clones.

Using MLST, the 124 isolates studied were discriminated into 78 different sequence types, including 65 novel sequence types and 37 novel alleles for abcZ (n=4), adk (n=6), efp (n=2), fumC (n=1), glyBETA (RS) (n=10), mutY (n=8), ppa (n=4), and trpE (n=2) alleles (Supplementary Table S2). This indicates that M. catarrhalis has a very diverse genetic population. Furthermore, each of the seven resistant isolates belonged to a different novel sequence type (Supplementary Table S4).

PCR detection of macrolide-resistant determinants

Based on the mechanisms of macrolide resistance that exist in other species,^18,19,25 we screened our isolates for known ermA, ermB, mefA, and mefE genes. We were unable to find any of these resistance genes in the seven isolates examined (data not shown), although our positive control was detected and confirmed by sequencing. To improve the PCR sensitivity (to take into account any possible sequence differences between these genes in Streptococcus species and in M. catarrhalis) or avoid false-negative PCR results, we altered annealing temperatures from 52°C (mef), 48°C (ermA), and 56°C (ermB) to 50°C (mef), 45°C (ermA), and 52°C (ermB), respectively. While nonspecific bands were detected, none was confirmed by sequencing.

PCR and sequence analysis of the 23S rRNA gene

We investigated the 23S rRNA gene sequence changes in a 934-bp region in all 124 isolates of M. catarrhalis (Table 1 and Supplementary Fig. S1). We found that the sequences of 115 isolates were identical with the wild-type GenBank reference (M. catarrhalis BBH18; GenBank No. NR_103214.1). Only nine isolates had sequences with mutations, including all seven macrolide-resistant isolates. Among the seven macrolide-resistant isolates, three 23S rRNA gene sequence patterns were found. The first pattern of 23S rRNA gene sequence was identified with nucleotide position alterations at A2144T, A2330T, and C2480T in two isolates (10R06500 and 11XR04410; GenBank No. JN164689.1) and both belong to copB II (Table 1). The second pattern included nucleotide position alterations at A2330T and C2480T in another two isolates (11R01612 and 13R13685; GenBank No. JN164688.1) (Table 1). The third pattern of 23S rRNA gene sequence was identified with the only nucleotide alteration at A2330T in the remaining three isolates (10R01390, 0R06882, and 13R12051; GenBank No. JN164698.1), which belonged to copB I/III (Table 1). We also found that all of the seven resistant isolates contained nucleotide position alterations at A2330T. There were no differences in macrolide susceptibility among the three 23S rRNA gene sequence patterns.

Among the 117 macrolide-susceptible isolates, three 23S rRNA gene sequence patterns were found. The first pattern of 23S rRNA gene sequence was identified with nucleotide position alterations at C2480T in only one isolate (10R01363; GenBank No. JN164697.1), which belongs to copB IV (Table 1). The second pattern included nucleotide position alterations at A2475G, G2476A, C2480T, A2485G, and C2489T in one isolate (11R03731; GenBank No. KM114615), which belongs to copB IV (Table 1). The third pattern was found in 115 isolates and was identical to the reference isolate (M. catarrhalis BBH18; GenBank No. NR_103214.1); 64 belong to copB I/III and 51 belong to copB II (Table 1).

Developing allele-specific PCR assay to identify the 23S rRNA gene A2330T mutation

We optimized 23S rRNA gene A2330T mutation allele-specific PCR with the seven high-level macrolide-resistant isolates and all susceptible isolates (n=117) by PCR and agarose gel electrophoresis. The results showed that the PCR product could be detected in susceptible isolates, but not in high-level macrolide-resistant isolates by using the primer pair of 2330FA/2428R (Supplementary Figs. S1 and S4). On the other hand, the PCR products were detected in high-level macrolide-resistant isolates, but not in susceptible isolates by using primer pairs of 2330FTT/2428R, 2214F/2330RTA, and 2214F/2330RCA, respectively (Supplementary Figs. S1 and S4). The PCR showed good specificity in the given conditions (Supplementary Fig. S4). Furthermore, the four pairs of primers were used in all the remaining isolates to see whether any isolates showed positive results for both wild-type and mutation-specific PCR. The results showed that none of such isolates was present. Then, we artificially mixed wild and mutation isolate DNA according to the rates (resistant:susceptible): 4:0, 3:1, 2:2, 1:3, and 0:4 (because there are four operons in M. catarrhalis), and the results showed that all of the mixed DNA were positive by using the four pairs of primers and there was no difference in the intensity. All of the results showed that the primer pair of 2330FA/2428R combined with any one of primer pairs of 2330FTT/2428R, 2214F/2330RTA, and 2214F/2330RCA can be used to reliably identify the 23S rRNA gene A2330T mutation.

Discussion

Based on our review of the literature, we found that the prevalence of macrolide-resistant M. catarrhalis in adults is much lower (generally less than 10%, Supplementary Table S3)^9,13,22 than that in children (40–60%, Supplementary Table S4).¹⁶ Although different breakpoints were used in different studies, a significantly higher prevalence of macrolide-resistant M. catarrhalis was detected in Mainland China (40–60% in children). Nevertheless, our finding in this study of 5.6% prevalence is consistent with studies in adults from other countries.

In China, M. catarrhalis has been neglected for many years due to the appearance of more multidrug-resistant organisms (e.g., methicillin-resistant S. aureus, carbapenem-resistant Enterobacteriaceae, vancomycin-resistant Enterococci, and carbapenem-resistant Acinetobacter baumannii).²⁷ Consequently, few studies have reported the prevalence of macrolide resistance in M. catarrhalis, although China appears to have low macrolide-susceptibility rates compared to other countries.^16,24 Several factors may contribute to the increased frequency of resistance to macrolides observed in M. catarrhalis in China, although the irrational use of antimicrobial agents is likely the main cause.²⁶

Very few studies have examined the molecular mechanisms involved in M. catarrhalis macrolide resistance. In our previous study, we reported that the 23S rRNA gene mutation was responsible for macrolide resistance in M. catarrhalis.¹⁶ Saito et al. confirmed this by successfully transforming this mutation (A2058T mutation in E. coli, which equates to A2330T in M. catarrhalis; Supplementary Table S1) into M. catarrhalis strains to confirm that this 23S rRNA gene mutation could be responsible for macrolide resistance.²¹ However, all the macrolide-resistant isolates in our previous study were from healthy children.¹⁶

In this study, isolates were cultured and isolated from the sputum of adult patients. All of the macrolide-resistant isolates had the A2330T mutation, but did not appear to harbor any of the common macrolide-resistance genes. This suggests that the A2330T mutation is responsible for M. catarrhalis macrolide resistance in the studied population. However, the small number of resistant isolates was a weakness of our study and made it impossible to draw firm conclusions. Further studies with higher numbers of resistant isolates from China are needed to confirm our findings.

Although the mutations do not appear to be related to any particular copB types, there was a trend toward an increase in copB types I/III and a decrease in copB type II in adult-associated M. catarrhalis isolates when compared with isolates from children (types I/III 27.0% and type II 62.6%).¹⁶ This supports the finding of Verhaegh et al.²³ who showed that copB types I/III and II were almost exclusively associated with 16S rRNA gene type 1 (lineage 1), while copB types 0 and IV were mainly associated with 16S rRNA gene types 2 and 3 (lineage 2).²³ In that case, most isolates tested in this study belonged to the M. catarrhalis lineage 1 (16S rRNA gene type 1), a lineage previously shown to be associated with increased virulence potential and serum resistance.⁸

To interpret the M. catarrhalis macrolide-resistant A2330T mutation more practically, we successfully developed an allele-specific PCR assay to identify the 23S rRNA gene A2330T mutation SNPs (Supplementary Figs S1 and S4). Although many other SNP identification assays such as high-resolution melting analysis,^4,5,14 real-time PCR, multiplex allele-specific PCR,⁴ and PCR-single-strand conformational polymorphism were available, we decided to set up a molecular assay based on the conventional PCR because many still consider conventional PCR as the first-line molecular assay. This newly developed molecular assay is very fast and economic because it only takes less than 3 hr from DNA extraction, PCR amplification, to agarose gel electrophoresis. Therefore, it can be used readily in clinical laboratories and can easily be modified to other platforms based on our primers design.

In conclusion, we found that an A2330T mutation was the most likely mechanism explaining high-level macrolide resistance in M. catarrhalis isolates collected from adults. Further study is required to determine if other mechanisms are involved. MLST, PFGE, copB and 23S rRNA gene typing suggest that M. catarrhalis is a genetically highly diverse organism and that the macrolide-resistant strains evolved from different clones. The mutations were relatively rare events in adult strains; however, if a mutation occurs in A2330T, then these isolates become resistant to macrolide antibiotics. We also successfully developed a practical allele-specific PCR assay to identify the A2330T SNPs for future clinical or surveillance use.

Footnotes

Acknowledgments

This work was supported by the Young Scientific Research Fund of PUMCH (Peking Union Medical College Hospital) (Grant No. pumch-2013-089) and the Research Special Fund for Public Welfare Industry of Health (Grant No. 201402001). We thank Yuan-Hai You (National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China) for assistance in the analysis of PFGE profiles using BioNumerics software.

Ethical Approval

The study was approved by the Human Research Ethics Committee of Peking Union Medical College Hospital (No. S-424).

Disclosure Statement

No competing financial interests exist.

References

Ahmad

1998. Bronchopulmonary infection due to Moraxella (Branhamella) catarrhalis at a specialist hospital in Saudi Arabia. J. Commun. Dis., 30:233–236.

Arri

S.J.

, Fluegge

, Mueller

, and Berner

2006. Antibiotic resistance patterns among respiratory pathogens at a German university children's hospital over a period of 10 years. Eur. J. Pediatr., 165:9–13.

Barry

A.L.

, and Fuchs

P.C.

1995. In vitro activities of a streptogramin (RP59500), three macrolides, and an azalide against four respiratory tract pathogens. Antimicrob. Agents Chemother., 39:238–240.

Cai

, Kong

, Toi

, van Hal

, and Gilbert

G.L.

2010. Differentiation of Chlamydia trachomatis lymphogranuloma venereum-related serovars from other serovars using multiplex allele-specific polymerase chain reaction and high-resolution melting analysis. Int. J. STD. AIDS., 21:101–104.

Chen

, Kong

, Wang

, Li

, Zhang

, and Gilbert

G.L.

2011. Rapid detection of isoniazid, rifampin, and ofloxacin resistance in Mycobacterium tuberculosis clinical isolates using high-resolution melting analysis. J. Clin. Microbiol., 49:3450–3457.

Clinical and Laboratory Standards Institute (CLSI). 2010. Anti-Microbial Susceptibility Testing of Fastidious or Infrequently Isolated Organisms. Approved Guideline-Second Edition. CLSI Document M45-A2. Clinical and Laboratory Standards Institute, Wayne, PA.

Dahlblom

, and Soderstrom

2012. Bacterial interactions in the nasopharynx—effects of host factors in children attending day-care centers. J. Infect. Public Health, 5:133–139.

de Vries

S.P.

, Bootsma

H.J.

, Hays

J.P.

, and Hermans

P.W.

2009. Molecular aspects of Moraxella catarrhalis pathogenesis. Microbiol. Mol. Biol. Rev., 73:389–406.

Flamm

R.K.

, Sader

H.S.

, Farrell

D.J.

, and Jones

R.N.

2012. Macrolide and tetracycline resistance among Moraxella catarrhalis isolates from 2009 to 2011. Diagn. Microbiol. Infect. Dis., 74:198–200.

10.

Guay

D.R.

1996. Macrolide antibiotics in paediatric infectious diseases. Drugs, 51:515–536.

11.

Hare

K.M.

, Singleton

R.J.

, Grimwood

, Valery

P.C.

, Cheng

A.C.

, Morris

P.S.

, Leach

A.J.

, Smith-Vaughan

H.C.

, Chatfield

, Redding

, Reasonover

A.L.

, McCallum

G.B.

, Chikoyak

, McDonald

M.I.

, Brown

, Torzillo

P.J.

, and Chang

A.B.

2013. Longitudinal nasopharyngeal carriage and antibiotic resistance of respiratory bacteria in indigenous Australian and Alaska native children with bronchiectasis. PLoS One, 8:e70478.

12.

Hol

, Schalen

, Verduin

C.M.

, Van Dijke

E.E.

, Verhoef

, Fleer

, and Van Dijk

1996. Moraxella catarrhalis in acute laryngitis: infection or colonization?. J. Infect. Dis., 174:636–638.

13.

Jacobs

M.R.

, Felmingham

, Appelbaum

P.C.

, Gruneberg

R.N.

; Alexander Project Group. 2003. The Alexander Project 1998–2000: susceptibility of pathogens isolated from community-acquired respiratory tract infection to commonly used antimicrobial agents. J. Antimicrob. Chemother., 52:229–246.

14.

Knez

, Spasic

, Janssen

K.P.

, and Lammertyn

2014. Emerging technologies for hybridization based single nucleotide polymorphism detection. Analyst, 139:353–370.

15.

Kobayashi

2000. Bacteremic Moraxella catarrhalis pneumonia. J. Infect. Chemother., 6:68.

16.

Liu

, Zhao

, Zhang

, Chen

, and Wang

2012. High prevalence and molecular analysis of macrolide-nonsusceptible Moraxella catarrhalis isolated from nasopharynx of healthy children in China. Microb. Drug Resist., 18:417–426.

17.

Manfredi

, Nanetti

, Valentini

, and Chiodo

2000. Moraxella catarrhalis pneumonia during HIV disease. J. Chemother., 12:406–411.

18.

Mazzariol

, Koncan

, Vitali

L.A.

, and Cornaglia

2007. Activities of 16-membered ring macrolides and telithromycin against different genotypes of erythromycin-susceptible and erythromycin-resistant Streptococcus pyogenes and Streptococcus pneumoniae. J. Antimicrob. Chemother., 59:1171–1176.

19.

Rantala

, Huikko

, Huovinen

, and Jalava

2005. Prevalence and molecular genetics of macrolide resistance among Streptococcus pneumoniae isolates collected in Finland in 2002. Antimicrob. Agents Chemother., 49:4180–4184.

20.

Richard

M.P.

, Aguado

A.G.

, Mattina

, and Marre

1998. Sensitivity to sparfloxacin and other antibiotics, of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis strains isolated from adult patients with community-acquired lower respiratory tract infections: a European multicentre study. SPAR Study Group. Surveillance Programme of Antibiotic Resistance. J. Antimicrob. Chemother., 41:207–214.

21.

Saito

, Nonaka

, Nishiyama

, and Okamura

2012. Molecular mechanism of macrolide-lincosamide resistance in Moraxella catarrhalis. J. Med. Microbiol., 61:1435–1438.

22.

Thornsberry

, Ogilvie

, Kahn

, and Mauriz

1997. Surveillance of antimicrobial resistance in Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis in the United States in 1996–1997 respiratory season. The Laboratory Investigator Group. Diagn. Microbiol. Infect. Dis., 29:249–257.

23.

Verhaegh

S.J.

, Streefland

, Dewnarain

J.K.

, Farrell

D.J.

, van Belkum

, and Hays

J.P.

2008. Age-related genotypic and phenotypic differences in Moraxella catarrhalis isolates from children and adults presenting with respiratory disease in 2001–2002. Microbiology, 154:1178–1184.

24.

Wang

, Chen

, Xu

, Sun

, Yang

, Hu

, et al. 2011. Antimicrobial susceptibility of bacterial pathogens associated with community-acquired respiratory tract infections in Asia: report from the Community-Acquired Respiratory Tract Infection Pathogen Surveillance (CARTIPS) study, 2009–2010. Int. J. Antimicrob. Agents, 38:376–383.

25.

Wierzbowski

A.K.

, Nichol

, Laing

, Hisanaga

, Nikulin

, Karlowsky

J.A.

, Hoban

D.J.

, and Zhanel

G.G.

2007. Macrolide resistance mechanisms among Streptococcus pneumoniae isolated over 6 years of Canadian Respiratory Organism Susceptibility Study (CROSS) (1998 2004). J. Antimicrob. Chemother., 60:733–740.

26.

Xiao

, Zhang

, Zheng

, Zhao

, Li

, and Li

2013. Changes in Chinese policies to promote the rational use of antibiotics. PLoS Med., 10:e1001556.

27.

Xiao

Y.H.

, Giske

C.G.

, Wei

Z.Q.

, Shen

, Heddini

, and Li

L.J.

2011. Epidemiology and characteristics of antimicrobial resistance in China. Drug Resist. Updates, 14:236–250.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.14 MB

0.12 MB

0.14 MB

0.12 MB

0.09 MB

0.14 MB

0.12 MB