Phenotypic and Molecular Antibiotic Resistance Determination of Airborne Coagulase Negative Staphylococcus spp. Strains from Healthcare Facilities in Southern Poland

Abstract

This study assessed the antimicrobial resistance of airborne Staphylococcus spp. strains isolated from healthcare facilities in southern Poland. A total of 55 isolates, belonging to 10 coagulase-negative staphylococci (CoNS) species, isolated from 10 healthcare facilities (including hospitals and outpatient units) were included in the analysis. The most frequently identified species were Staphylococcus saprophyticus and Staphylococcus warneri, which belong to normal human skin flora, but can also be the cause of common and even severe nosocomial infections. Disk diffusion tests showed that the bacterial strains were most frequently resistant to erythromycin and tetracycline and only 18% of strains were susceptible to all tested antimicrobials. Polymerase chain reaction amplification of specific gene regions was used to determine the presence of the Macrolide–Lincosamide–Streptogramin resistance mechanisms in CoNS. The molecular analysis, conducted using specific primer pairs, identified the msrA1 gene, encoding active efflux pumps in bacterial cells, as the most frequent resistance gene. As many as seven antibiotic resistance genes were found in one isolate, whereas the most common number of resistance genes per isolate was five (n = 17). It may be concluded that drug resistance was widely spread among the tested strains, but the resulting antimicrobial resistance profile indicates that in the case of infection, the use of antibiotics from the basic antibiogram group will be effective in therapy. However, before administering treatment, determination of the specific antimicrobial resistance should be conducted, particularly in the case of hospitalized patients.

Introduction

For many years, bacteria of the genus Staphylococcus have been recognized as the most frequent causal agent of nosocomial infections. This is due to the fact that they commonly colonize human skin and mucous membranes, as well as because they easily acquire genes conferring resistance to antibiotics. This results in the selection of resistant strains, which in the case of hospital wards is both very common and at the same time very dangerous. Particular attention should be paid to rapidly spreading methicillin-resistant Staphylococcus aureus strains (MRSA), as well as methicillin-resistant coagulase-negative staphylococci (MRCoNS). Such strains are resistant not only to the β-lactam antibiotics but also to the majority of antibiotics used in treatment.^1–3 Currently there have been around 160 different antibiotic substances developed and used in the treatment of patients (National Reference Centre for Antimicrobial Susceptibility, www.korld.edu.pl). These belong to both basic antibiogram (cefoxitin, erythromycin, clindamycin) and extended antibiogram (tetracycline, ciprofloxacin, gentamicin, trimethoprim/sulfamethoxazole) groups.⁴ Unfortunately, the rapid increase in resistance of microorganisms, including staphylococci, to chemotherapeutics and commonly used disinfectants is a very serious problem currently affecting therapy.⁵ New methods of treating infections caused by increasingly more resistant bacteria are being searched for. However, we need to expect that the problem of bacterial resistance will sooner or later also affect drugs recently introduced into therapy.^2,5

Therefore, understanding the mechanisms of such resistance and the underlying genetic phenomena progress the search for new substances (drugs, disinfectants, and antiseptics) active against staphylococci, including multiresistant strains, responsible for nosocomial infections.

Currently, the most frequently identified resistance mechanisms in Staphylococcus spp. include the following: enzymatic inactivation of antibiotic particles involving hydrolases and transferases; active removal of antibiotics from the cell with the so-called efflux mechanism pumps and changing the drug affinity or duplication of target site functions due to mutations within genes encoding proteins representing the target for antibiotics, which may result in a reduction of its binding affinity to the drug.⁶ From an epidemiological point of view, the phenomenon of increasing antimicrobial resistance is very dangerous and requires careful monitoring.

Therefore, the primary aim of this study was to isolate and identify species of airborne Staphylococcus strains in selected healthcare facilities in southern Poland. A further aim was to determine the drug resistance profiles of the strains, followed by determination of the presence of genes conferring the resistance to antibiotics of the macrolides, lincosamides, and streptogramins (MLS) group in the examined strains.

Materials and Methods

General overview

Airborne Staphylococcus spp. strains were isolated from 10 healthcare facilities using a single-stage impactor and a Chapman medium. Staphylococcal strains, identified to the species level by API Staph tests, were subjected to disk diffusion tests to assess their antimicrobial resistance profile, followed by polymerase chain reaction (PCR) analyses to determine the presence of genes conferring bacterial resistance to the MLS group of antibiotics.

Air sampling

Bacteria of the genus Staphylococcus were isolated from the air of 10 healthcare facilities in southern Poland⁷ (Table 1). The selection of facilities was based on the consent to anonymously participate in this study given by their authorities. In total, 18 randomly chosen different healthcare facilities were contacted, thus, the acceptance rate was 55.6% of the contacted centers. The air sampling was conducted between 2014 and 2015. Each facility was sampled four times, ensuring one sampling per season, that is, spring—April 2014, summer—August 2014, autumn—November 2014, and winter—February 2015, when the patients were present. The samples were collected in triplicate using a MAS-100 (Merck) air sampler set to collect 100 L of air during 1 min, according to the requirements given by the Polish Standard PN-Z-04008-08:1989.⁷ Chapman medium (BioCorp) was used for the isolation of Staphylococcus spp. After sampling, the Petri dishes were transported to the laboratory and incubated at 36°C ± 1°C for 48 hr.

Table 1.

Sampling Sites

No.	Sampling sites	Abbreviation
1.	Internal medicine outpatient clinic 1—waiting room	IMOC1
2.	Specialist outpatient clinic—waiting room	SOC
3.	Hospital 1—waiting room	H1
4.	Allergology outpatient clinic—waiting room	AOC
5.	Internal medicine outpatient clinic 2—waiting room	IMOC2
6.	Hospital 2 infectious ward—treatment room	H2
7.	Hospital 3 children's ward—patient room	H3
8.	Hospital 4 cardiology ward—patient room	H4
9.	Hospital 5 ICU—patient room	H5_P
10.	Hospital 5 ICU—isolation ward	H5_I

ICU, intensive care unit.

Isolation of pure staphylococci cultures

Initial selection of cultures likely to be Staphylococcus spp. was conducted according to the methods outlined in Kloos and Schleifer,⁸ Kloos and Bannerman,⁹ Gaillot et al.,¹⁰ and Murray,¹¹ detailed below. Pure Staphylococcus spp. cultures were obtained by plate streaking of macroscopically characteristic colonies, grown on Chapman medium. Gram-stained smears were then microscopically observed, followed by a furazolidone susceptibility test to distinguish between Staphylococcus and Micrococcus isolates. Strains susceptible to furazolidone were qualified as Staphylococcus, while the remaining ones (furazolidone resistant)—as Micrococcus. Subsequently, a catalase test was conducted to exclude the presence of catalase-negative streptococci from the cultures obtained. Strains within the Staphylococcus genus were differentiated into coagulase positive and coagulase negative by using free coagulase. The final step of phenotypic identification included biochemical tests conducted using API-Staph system (BioMérieux).

Antimicrobial resistance, disk diffusion method

Disk diffusion tests on Mueller-Hinton Agar II (BioMérieux) were conducted to investigate the susceptibility of the strains to six antibiotics representing a different class: cephamycins (cefoxitin—FOX 30 μg), macrolides (erythromycin—E 15 μg), lincosamides (clindamycin—DA 2 μg), fluoroquinolones (ciprofloxacin—CIP 5 μg), tetracyclines (tetracycline—TE 30 μg), and a bacteriostatic drug trimethoprim/sulfamethoxazole (SXT 1.25/23.75 μg), all manufactured by Oxoid. The bacterial susceptibility assessment was conducted according to the guidelines of The European Committee on Antimicrobial Susceptibility Testing—EUCAST¹² presented by the National Reference Centre for Antimicrobial Susceptibility Testing (pol. Krajowego Ośrodka Referencyjnego ds. Lekowrażliwości Drobnoustrojów—KORLD; www.korld.edu.pl; IV).

Reference strains of methicillin-susceptible S. aureus ATCC 25923 and methicillin-resistant S. aureus MR 3, derived from the collection of the Jan Bober Center for Microbiological Research and Autovaccines in Krakow, were used as positive and negative controls, and the results were interpreted according to the recommendations of KORLD and EUCAST.¹²

Determination of genes responsible for the resistance to MLS group antibiotics

DNA extraction from pure cultures of staphylococci was conducted using the Genomic Mini Kit (A&A Biotechnology), following the manufacturer's instructions. Subsequently, the presence of 17 genes conferring resistance in Staphylococcus spp. strains to antibiotics of MLS group was determined by conducting PCR with specific primer sets. Brief characteristics of each of the tested gene regions along with sequences of primers used to amplify them are provided in Table 2. PCR amplification was carried out in a T100 thermal cycler (Bio-Rad), under temperature conditions optimal for each primer (Table 2).

Table 2.

Polymerase Chain Reaction Primers and Reaction Conditions

No.	Gene	5′-3′ sequence	Reaction conditions	Antibiotic resistance; gene description	Product length (bp)	References
1.	msrA	GGCACAATAAGAGTGTTTAAAGG	25 × (1 min 94°C; 1 min 50°C; 90 sec 72°C)	Macrolides, streptogramins B	940	Lina et al.¹³
		AAGTTATATCATGAATAGATTGTCCTGTT				Reynolds¹⁴
2.	msrA1	GCAAATGGTGTAGGTAAGACAACT	30 × (30 sec 95°C; 45 sec 50°C; 2 min 72°C)	Macrolides	400	Sutcliffe et al.¹⁵
		ATCATGTGATGTAAACAAAAT
3.	msrB	TATGATATCCATAATAATTATCCAATC	25 × (1 min 94°C; 1 min 50°C; 90 sec 72°C)	Macrolides	595	Lina et al.¹³
		AAGTTATATCATGAATAGATTGTCCTGTT				Schmitz et al.¹⁶
4.	ereA	AACACCCTGAACCCAAGGGACG	30 × (30 sec 95°C; 45 sec 50°C; 2 min 72°C)	Macrolides	420	Sutcliffe et al.¹⁵
		CTTCACATCCGGATTCGCTCGA				Liu et al.¹⁷
5.	ereB	AGAAATGGAGGTTCATACTTACCA	30 × (30 sec 95°C; 45 sec 50°C; 2 min 72°C)	Macrolides	546	Sutcliffe et al.¹⁵
		CATATAATCATCACCAATGGCA
6.	mphA	AACTGTACGCACTTGC	30 × (30 sec 95°C; 45 sec 50°C; 2 min 72°C)	Macrolides	837	Sutcliffe et al.¹⁵
		GGTACTCTTCGTTACC
7.	mphC	GAGACTACCAAGAAGACCTGACG	30 × (30 sec 94°C; 30 sec 59°C; 1 min 72°C)	Macrolides	722	Lüthje and Schwarz¹⁸
		CATACGCCGATTCTCCTGAT
8.	lnuA	GGTGGCTGGGGGGTAGATGTATTAACTGG	30 × (30 sec 94°C; 30 sec 57°C; 1 min 72°C)	Lincosamides	323	Lina et al.¹³
		GCTTCTTTTGAAATACATGGTATTTTTCGATC
9.	ermA	TCTAAAAAGCATGTAAAAGAA	30 × (30 sec 95°C; 45 sec 52°C; 2 min 72°C)	Macrolides, lincosamides, streptogramins B	645	Sutcliffe et al.¹⁵
		CTTCGATAGTTTATTAATATTAGT
10.	ermA1	GTTCAAGAACAATCAATACAGAG	30 × (30 sec 94°C; 30 sec 52°C; 1 min 72°C)	Macrolides, lincosamides, streptogramins B	421	Lina et al.¹³
		GGATCAGGAAAAGGACATTTTAC
11.	ermB	GAAAAGGTACTCAACCAAATA	30 × (30 sec 95°C; 45 sec 52°C; 2 min 72°C)	Macrolides, lincosamides, streptogramins B	639	Sutcliffe et al.¹⁵
		AGTAACGGTACTTAAATTGTTTAC
12.	ermB1	CCGTTTACGAAATTGGAACAGGTAAAGGGC	30 × (30 sec 94°C; 30 sec 55°C; 1 min 72°C)	Macrolides, lincosamides, streptogramins B	359	Lina et al.¹³
		GAATCGAGACTTGAGTGTGC
13.	ermC	TCAAAACATAATATAGATAAA	30 × (30 sec 95°C; 45 sec 52°C; 2 min 72°C)	Macrolides, lincosamides, streptogramins B	642	Sutcliffe et al.¹⁵
		GCTAATATTGTTTAAATCGTCAAT
14.	vga	CCAGAACTGCTATTAGCAGATGAA	30 × (30 sec 94°C; 30 sec 54°C; 1 min 72°C)	Streptogramins A	470	Lina et al.¹³
		AAGTTCGTTTCTCTTTTCGACG
15.	vgb	ACTAACCAAGATACAGGACC	30 × (1 min 94°C; 1 min 53°C; 2 min 72°C)	Streptogramins A and B	734	Lina et al.¹³
		TTATTGCTTGTCAGCCTTCC
16.	vat	CAATGACCATGGACCTGATC	30 × (30 sec 94°C; 30 sec 52°C; 1 min 72°C)	Streptogramins A	619	Lina et al.¹³
		CTTCAGCATTTCGATATCTC
17.	vatB	CCCTGATCCAAATAGCATATATCC	30 × (30 sec 94°C; 30 sec 52°C; 1 min 72°C)	Streptogramins A	602	Lina et al.¹³
		CTAAATCAGAGCTACAAAGT

PCR was carried out in 25 μl volumes containing water, 50 ng of DNA template, 12.5 pM of each primer, 2.5 mM of each dNTP, 1× PCR DreamTaq Green buffer, and 1 U DreamTaq DNA polymerase. The PCR products were subjected to electrophoresis for 60 min on a 1% agarose SimplySafe (EurX) stained gel in 1× TBE. The products were visualized in UV light and documented using the Gel Doc (Bio-Rad) system. GeneRuler™ DNA Ladder Mix, 100–1,000 bp (Thermo Scientific) was used to assess the length of the analyzed PCR products (Table 2).

Statistical analysis

To test for the significance of differences between the antimicrobial resistance in strains isolated from individual groups of sites, that is, outpatient and inpatient units, a χ² test was conducted using a Social Science Statistics calculator.¹⁹

Results

Sampling at the 10 sites yielded 55 strains of staphylococci, 15 from outpatient units and 40 from inpatient units. A total of 10 staphylococcal species were represented among the 15 isolates derived from the outpatient sampling sites, each species was isolated one to three times (only in the case of Staphylococcus simulans and Staphylococcus hominis). A total of 10 staphylococcal species were represented among the 40 isolates derived from the inpatient sampling sites, with species such as S. saprophyticus and S. warneri very abundantly represented (i.e., 13 and 12 isolates, respectively).

In contrast, Staphylococcus capitis, Staphylococcus epidermidis, and Staphylococcus cohnii were not detected in the inpatient units. Five out of the mentioned 13 S. saprophyticus isolates were derived from the isolation ward of the intensive care unit (ICU) and another five from the cardiology ward. In addition, 4 out of 12 isolates of S. warneri were derived from the cardiology ward and 6 isolates from the patient room of the ICU. No seasonal differences were observed in the frequency of individual species. The most frequently detected species, that is, S. saprophyticus and S. warneri, were isolated evenly throughout the year and the same two species, S. saprophyticus and S. warneri, were the predominant ones in the group of bacterial isolates (Table 3).

Table 3.

The Share of Individual Species of Staphylococci in the Isolated Material

No.	Species	Sampling site and season	Number of isolates	Overall number of isolates	Percentage share (%)
1.	Staphylococcus saprophyticus ^a	SOC, winter	1	14	25
		H2, spring	2
		H3, winter	1
		H4, winter, spring	5
		H5_I, winter, spring, summer	5
2.	Staphylococcus warneri ^a	IMOC2, winter	1	13	24
		H2, winter	1
		H3, spring	1
		H4, autumn, winter	4
		H5_P, autumn, winter, spring, summer	6
3.	Staphylococcus xylosus ^a	SOC, autumn	2	6	11
		H1, winter	1
		H2, autumn	2
		H5_P, spring	1
4.	Staphylococcus simulans	IMOC1, winter, spring	2	5	9
		SOC, spring	1
		H1, summer	1
		H5_P, summer	1
5.	Staphylococcus hominis ^a	AOC, spring	1	5	9
		IMOC2, winter	2
		H2, summer	1
		H5_I, summer	1
6.	Staphylococcus haemolyticus	AOC, autumn	1	5	9
		H1, autumn	2
		H3, summer	1
		H5_I, spring	1
7.	Staphylococcus sciuri	AOC, spring	1	4	7
		H1, spring	1
		H4, summer	1
		H5_P, summer	1
8.	Staphylococcus cohnii	SOC, autumn	1	1	2
9.	Staphylococcus epidermidis	IMOC1, winter	1	1	2
10.	Staphylococcus capitis ^a	IMOC1, autumn	1	1	2
Total				55	100

For these species, the API Staph identification was reported by Mkrtchyan et al.²⁰ to produce discrepancies in the results compared to the results provided by 16S RNA sequencing and MALDI-TOF.

MALDI-TOF, Matrix Assisted Laser Desorption Ionization Time-of-Flight.

Disk diffusion tests assessed the susceptibility of the bacterial isolates to six antimicrobials, and the results are presented in Fig. 1. Resistance to tetracycline and erythromycin was observed most frequently (49%, n = 27 isolates and 42%, n = 23 isolates, respectively). Conversely, there were no isolates resistant to gentamicin or trimethoprim/sulfamethoxazole.

FIG. 1.

The number and percentage of isolates resistant to the tested antimicrobials. The total number of isolates used in the study was n = 55.

The majority of the tested Staphylococcus spp. isolates were resistant to one (23 isolates—42%) or two antibiotics (19 isolates—35%). The resistant isolates were most frequently detected in the air of patient rooms at the cardiology ward (10 isolates—18%) and ICU (9 isolates—16%). Only one isolate was resistant to three antibiotics (S. simulans, hospital 1) and one isolate to four antibiotics (S. hominis, allergology outpatient clinic).

The distribution of mechanisms of resistance to macrolides, lincosamides, and streptogramins B is shown in Fig. 2. The most common mechanism of resistance to antibiotics of MLS_B type in staphylococci is the inducible mechanism (62%, n = 16). The second most frequent mechanism of resistance was MS_B type, observed in seven isolates (28%). In contrast, only one isolate (4%) showed the constitutive MLS_B.

FIG. 2.

The number and percentage of isolates exhibiting the resistance mechanisms to MLS_B type antibiotics. The total number of isolates used in the study was n = 55.

The presence of ermB and ermB1 genes in this study was demonstrated in 11% and 55% of strains, respectively. It can be stated that the msrA1 gene, determining the inducible resistance to erythromycin and streptogramins B in staphylococci (MS_B phenotype), was found in the greatest number of the analyzed bacterial isolates of coagulase-negative staphylococci (CoNS; n = 49 isolates, 98%, Fig. 3). Moreover, the genes, msrA, msrA1, msrB, mphC, lnuA, and ermB1, were found in more than half of the tested strains (56%, n = 31; 89%, n = 49; 58%, n = 32; 62%, n = 34; 58%, n = 32; and 55%, n = 30 isolates, respectively). In contrast, during the conducted analyses, the presence of the following genes was not detected: ereA, ermA, ermA1, ermC, vga, vgb, vat, and vatB. The presence of the msrA1 gene was observed in all Staphylococcus spp. strains exhibiting the inducible mechanism of resistance, while the genes msrA and msrB were present in 94% of those strains. Genes mphC and ermB1 were present in 81% of strains, while lnuA gene—in 75%. Only one of all isolated strains of the species Staphylococcus haemolyticus did not have any of the genes determining the resistance to MLS_B antibiotics. The greatest number of antimicrobial resistance genes, as many as 7 (msrA, msrA1, msrB, mphC, lnuA, ermB, ermB1), was observed in Staphylococcus xylosus. Most frequently (n = 17), the bacterial isolates possessed as many as five different antimicrobial resistance genes.

FIG. 3.

The prevalence of genes determining the resistance to MLS_B antibiotics in the analyzed bacterial strains. MLS, macrolides, lincosamides, and streptogramins.

The χ² tests, performed to assess the significance of differences in the susceptibility of bacterial isolates to individual antimicrobials in strains of Staphylococcus spp. isolated from different groups of sites (divided into two groups—inpatent units, i.e., hospitals and outpatient clinics), confirm a statistically significant difference in the incidence of resistant strains (p < 0.05) for cefoxitin, clindamycin, and tetracycline. The value of χ² statistics for these antibiotics is 14.04, 5.55, and 11.79, respectively.

Discussion

The species identification of the strains in this study demonstrated that the airborne CoNS isolated from the healthcare facilities belonged to species that rarely cause infections. These are often saprophytic species, such as S. epidermidis, which in most cases do not cause any unwanted symptoms in people with properly functioning immune systems. However, the species identification method used in this study has certain limitations. It has been reported by other authors, for example, Mkrtchyan et al.,²⁰ to produce discrepancies when compared to other, more accurate, methods such as 16S rDNA sequencing and/or Matrix Assisted Laser Desorption Ionization Time-of-Flight (MALDI-TOF). For instance, in the study, staphylococcal strains, identified by API ID32 STAPH as S. saprophyticus, were identified as S. warneri by both MALDI-TOF and 16S rDNA sequencing. In contrast, S. warneri identified by API STAPH was identified as Staphylococcus pasteuri by MALDI-TOF and sequencing.

Nevertheless, in the current study, similar to the one by Augustowska and Dutkiewicz,²¹ no strains of S. aureus were isolated, which is considered a major factor in hospital-acquired infections. Although all identified isolates were CoNS, which until recently have been described as only commensals of healthy human skin and mucosa, now they are more frequently being reported as important opportunistic pathogens, sometimes causing even severe nosocomial infections.²²

It must be stressed that the origin of the examined airborne staphylococcal strains is not known and they could have been transferred to the hospital/outpatient clinics from the skin of patients, their families, or personnel. Alternatively, they could be strictly environmental strains. However, the majority of identified species can act as opportunistic pathogens in immunocompromised patients. The most abundant species detected in this study was S. saprophyticus, and although it is a common component of human microflora, it is also one of the most frequent agents of community-acquired urinary tract infections.^23,24 It should also be noted that only one out of 14 S. saprophyticus isolates detected in this study originated from an outpatient clinic, while the remainder was isolated from hospitals, including five isolates from the cardiology ward and five from the isolation room of an ICU (Table 3). Patients in these units are often immunocompromised or elderly, and S. saprophyticus could cause severe infections in such patients. The second most frequent species, S. warneri, has been also reported as the causal agent of infections in hospitalized patients and the cause of, among others, ventricular shunt infections, endocarditis, and even sepsis.^25,26 Out of 13 S. warneri strains isolated in this study, 4 were from the cardiology ward and 6 from a patient room of an ICU, with sampling conducted when the patients were present in the room. These findings are one of the most important observations of this study, as the presence of such CoNS species (both S. warneri and S. saprophyticus) can cause difficult to treat infections in patients of such healthcare units.

The studied isolates were predominantly resistant to tetracycline (n = 27; 49%), which may be due to the fact that this antibiotic shows bacteriostatic effects, thus not leading to the bacterial cell death, but only decreasing proliferation. Moreover, tetracyclines show antagonistic effect with cephalosporins and penicillins, which may result in elimination of their effects. The finding of frequent resistance of the strains to erythromycin, that is, as much as 42% (23 isolates), may in contrast result from it being the oldest and longest administered macrolide antibiotic. This could have contributed to the increase in bacterial resistance to this drug.²⁷

Disk diffusion tests showed that 62% of the analyzed Staphylococcus strains possessed an inducible mechanism of resistance to antibiotics of the macrolide, lincosamides, and streptogramin B group. Therefore, the treatment of infections caused by strains presenting such resistance mechanisms should not involve macrolides, lincosamides, or streptogramins B. Such isolates are being reported as resistant to clindamycin because it causes the selection of mutants exhibiting the constitutive mechanism. For the constitutive mechanism, this share was only 4%. These results were opposed to Lina et al.,¹³ who observed that among CoNS the inducible mechanism was present in 28.7% strains, while the constitutive mechanism was present in 36.6%. In addition, Castro-Alarcon et al.²⁸ found that among S. epidermidis strains, 47% showed the constitutive mechanism and only 8% the inducible mechanism.

Frequent administration of antibiotics of the macrolide class selects resistant strains much more rapidly than using β-lactam antibiotics.²⁷ The inducible mechanism results from the production of methylases, which are produced due to the induction of erm genes by 14- and 15-membered macrolides, such as erythromycin. Clindamycin does not induce this mechanism, however, there is a risk that after its application therapeutic effects will not be achieved and that it will cause the selection of bacteria showing the constitutive MLS_B mechanism of resistance. This involves the formation of the resistance to macrolides, lincosamides, and streptogramins B in such strains.¹²

The genes msr (msrA, msrA1, and msrB), causing resistance to MLS_B type antibiotics, were the most frequently detected genes in this study. They determine the inducible mechanism of resistance to erythromycin and streptogramins B in staphylococci (MS_B).¹⁴ They differ from the ones exhibiting an MLS_B phenotype by the lack of cross-resistance to lincosamides or 16-membered lactone ring macrolides, even after induction. In this study, both erm and lnuA genes were observed to co-occur in 45% of the Staphylococcus spp. strains tested.

One of the tested isolates, identified as S. xylosus, showing the constitutive mechanism of resistance, possessed both msrA1 and mphC genes. Thus, introducing macrolides during antimicrobial therapy will be ineffective in the case of this strain. The presence of the active msrA1 gene will result in active pumping of the antibiotic out of the bacterial cell, while the expression of mphC gene will cause inactivation of the drug due to the phosphotransferase activity.¹⁸ In their study on S. epidermidis isolates, Castro-Alarcon et al.²⁸ detected the presence of ermA, ermB, ermC, msrA, lnuA, and vga genes in the tested strains. As many as 32% of isolates tested in their study possessed the ermA gene, which was often accompanied by the vga gene in the same isolate. The genes were observed in the bacterial strains exhibiting a constitutive resistance mechanism to MLS_B antibiotics. Contrary to this, in our study, none of the CoNS strains possessed ermA or vga genes.

The development of the antimicrobial resistance in Staphylococcus spp. is a process that is influenced by numerous factors, among which belong antibiotic overuse and misuse both in treatment of infections and in nonmedical areas, as well as gaps in infection control programs.²⁹ The PCR tests allowed detection of antibiotic resistance genes that can be, but not necessarily are, expressed, and therefore, the results of the molecular analyses may vary from the results of disk diffusion tests. However, a high percentage of the CoNS strains were resistant to various antibiotics, and an abundance of antibiotic resistance genes was present.

Taking into consideration the fact that CoNS are widely spread in the community, both as skin commensals and widespread colonizers of the human gut, they may serve as a wide reservoir of antibiotic resistance genes, and the same applies to S. aureus strains.³⁰ New mechanisms of antimicrobial resistance, their factors, and ways of eradication are constantly being identified and investigated. Unfortunately, we are often unable to limit the increase in antibiotic resistance, as among other factors, it results from naturally occurring horizontal gene transfer. Such observations and studies are very important for control programs of nosocomial infections and stress the importance of implementing surveillance studies to monitor the development and spread of antimicrobial resistance among airborne staphylococcal strains in Polish healthcare facilities.

Conclusions

The predominant species within the group of isolated airborne staphylococci included S. saprophyticus and S. warneri. The tested bacterial isolates were most frequently resistant to erythromycin and tetracycline. Drug resistance was widespread with over 82% of isolates resistant to one or more antimicrobials. In addition, wide variation both in the presence and composition of genes determining antimicrobial resistance was observed among the tested airborne strains of Staphylococcus spp. The msrA1 gene, which is involved in the active efflux of macrolides out of the bacterial cell, was most frequently found in the tested group of isolates. However, before administering treatment, the mechanism of antimicrobial resistance should be determined, particularly in the case of hospitalized patients.

Footnotes

Acknowledgments

This study was funded by the statutory measures of the University of Agriculture—Grant No. DS 3102/KM/2014 and by measures of the Centre for Microbiological Research and Autovaccines in Kraków.

Disclosure Statement

No competing financial interests exist.

References

Irving

, Ala'Aldeen

, and Boswell

2008. Mikrobiologia medyczna. Krótkie wykłady [Medical Microbiology. Short Lectures]. Polish Scientific Publishers PWN, Warsaw. (In Polish.)

Sadowska

, and Różalska

2010. Staphylococci–what's new about them?. Adv. Microbiol., 49:173–178. (In Polish.)

Szewczyk

E.M.

2013. Gram-positive cocci of the genus Staphylococcus, Streptococcus and others. In Szewczyk

E.M.

(ed.), Bacteriological Diagnostics. Polish Scientific Publishers PWN, Warsaw. (In Polish.) pp. 19–40.

Żabicka

, and Hryniewicz

2010. Recommendations of the test selection for the assessment of susceptibility to antibiotics and chemotherapeutics. Determination of the susceptibility of Gram-positive cocci of the genus. Staphylocococcus spp. (In Polish.)

Carlet

, Jarlier

, Harbarth

, Voss

, Goossens

, Pittet

, and Participants of the 3rd World Healthcare-Associated Infections Forum. 2012. Ready for a world without antibiotics?. The Pensières Antibiotic Resistance Call to Action. Antimicrob. Resist. Infect. Control, 1:11.

Leclerq

2002. Mechanisms of resistance to macrolides and lincosamides: nature of the resistance elements and their clinical implications. Clin. Infect. Dis., 34:482–492.

Polish Standard PN-Z-04008-08:1989 Air purity protection–Sampling–Atmospheric air sampling (imission) for microbiological analyses by aspiration and sedimentation (Ochrona czystości powietrza—Pobieranie próbek—Pobieranie próbek powietrza atmosferycznego (imisja) do badań mikrobiologicznych metodą aspiracyjną i sedymentacyjną). (In Polish.)

Kloos

W.E.

, and Schleifer

K.H.

1975. Isolation and characterization of Staphylococci from human skin II. Descriptions of four new species: Staphylococcus warneri, Staphylococcus capitis, Staphylococcus hominis, and Staphylococcus simulans. Int. J. Syst. Bacteriol., 25:62–79.

Kloos

W.E.

, and Bannerman

T.L.

1994. Update on clinical significance of coagulase-negative staphylococci. Clin. Microbiol. Rev., 7:117–140.

10.

Gaillot

, Wetsch

, Fortineau

, and Berche

2000. Evaluation of CHROMagar Staph. aureus, a new chromogenic medium, for isolation and presumptive identification of Staphylococcus aureus from human clinical specimens. J. Clin. Microbiol., 38:1587–1591.

11.

Murray

P.E.

2007. Manual of Clinical Microbiology. 9th ed. ASM Press, Washington, DC.

12.

Hryniewicz

2014. Breakpoint tables for interpretation of MICs and zone diameters. European Committee on Antimicrobial Susceptibility Testing (EUCAST), version 4.0.

13.

Lina

, Quaglia

, Reverdy

M.E.

, Leclercq

, Vandenesch

, and Etienne

1999. Distribution of genes encoding resistance to macrolides, lincosamides and streptogramin among Staphylococci. Antimicrob. Agents Chemother., 43:1062–1066.

14.

Reynolds

, Ross

J.I.

, and Cove

J.H.

2003. Msr(A) and related macrolide/streptogramin resistance determinants: incomplete transporters?. Int. J. Antimicrob. Agents, 22:228–236.

15.

Sutcliffe

, Grebe

, Tait-Kamradt

, and Wondrack

1996. Detection of erythromycin-resistance determinants by PCR. Antimicrob. Agents Chemother., 40:2562–2566.

16.

Schmitz

F.J.

, Sadurski

, Kray

, Boos

, Geisel

, Köhrer

, Verhoef

, and Fluit

A.C.

2000. Prevalence of macrolide-resistance genes in Staphylococcus aureus and Enterococcus feacium isolates from 24 European university hospitals. J. Antimicrob. Chemother., 45:891–894.

17.

Liu

, Zhang

Z.Y.

, Dong

, Yuan

J.P.

, and Guo

X.K.

2009. Antibiotic resistance of probiotic strains of lactic acid bacteria isolated from marketed foods and drugs. Biomed. Environ. Sci., 22:401–412.

18.

Lüthje

, and Schwarz

2006. Antimicrobial resistance of coagulase-negative staphylococci from bovine subclinical mastitis with particular reference to macrolide-lincosamide resistance phenotypes and genotypes. J. Antimicrob. Chemother., 57:966–969.

19.

Social Science Statistics. Chi-square Calculator. Available at www.socscistatistics.com/tests/chisquare/Default.aspx, accessed July 25, 2015.

20.

Mkrtchyan

H.V.

, Russell

C.A.

, Wang

, and Cutler

R.R.

2013. Could public restrooms be an environment for bacterial resistomes?. PLoS One, 8:e54223.

21.

Augustowska

, and Dutkiewicz

2006. Variability of airborne microflora in a hospital ward within a period of one year. Ann. Agric. Environ. Med., 13:99–106.

22.

Widerström

, Wiström

, Sjöstedt

, and Monsen

2012. Coagulase-negative staphylococci: update on the molecular epidemiology and clinical presentation, with a focus on Staphylococcus epidermidis and Staphylococcus saprophyticus. Eur. J. Clin. Microbiol., 31:7–20.

23.

Ferreira

A.M.

, Bonesso

M.F.

, Mondelli

A.L.

, da Cunha Mde

2012. Identification of Staphylococcus saprophyticus isolated from patients with urinary tract infection using a simple set of biochemical tests correlating with 16S–23S interspace region molecular weight patterns. J. Microbiol. Methods., 91:406–411.

24.

Henry

, Ellison

, Sullivan

, Mansfield

D.L.

, Magner

D.J.

, and Dorr

M.B.

1998. Treatment of community-acquired acute uncomplicated urinary tract infection with sparfloxacin versus ofloxacin. The Sparfloxacin Multi Center UUTI Study Group. Antimicrob. Agents Chemother., 42:2262–2266.

25.

Martínez-Lage

J.F.

, Martínez-Lage

A.L.

, and Almagro

M.J.

2010. Staphylococcus warneri ventriculoperitoneal shunt infection: failure of diagnosis by ventricular CSF sampling. Childs Nerv. Syst., 26:1795–1798.

26.

Ivić

, Karanović

, and Pavičić-Ivelja

2013. Sepsis with multiple abscesses caused by Staphylococcus warneri: a case report. Cent. Eur. J. Med., 8:45–47.

27.

Markiewicz

, and Kwiatkowski

Z.A.

2012. Bacteria, Antibiotics, Drug Resistance. Polish Scientific Publishers. PWN, Warsaw. (In Polish.)

28.

Castro-Alarcon

, Ribas-Aparicio

R.M.

, Silva-Sanchez

, Calderon-Navarro

, Sanchez-Perez

, Parra-Rojas

, and Aparicio-Ozores

2011. Molecular typing and characterization of macrolide licosamide and streptogramin resistance in Staphylococcus epidermidis strains isolated in a Mexican hospital. J. Med. Microbiol., 60:730–736.

29.

Centers for Disease Control and Prevention (CDC). 2002. Staphylococcus aureus resistant to vancomycin—United States, 2002. MMWR Morb Mortal Wkly Rep., 51:565–567.

30.

Barbier

, Ruppé

, Hernandez

, Lebeaux

, Francois

, Felix

, Desprez

, Maiga

, Woerther

, Gaillard

, Jeanrot

, Wolff

, Schrenzel

, Andremont

, and Ruimy

2010. Methicillin-resistant coagulase-negative staphylococci in the community: high homology of SCCmec IVa between Staphylococcus epidermidis and major clones of methicillin-resistant Staphylococcus aureus. J. Infect. Dis., 202:270–281.