An Outbreak of NDM-1-Producing Klebsiella pneumoniae,Associated with OmpK35 and OmpK36 Porin Loss in Tunisia

Abstract

Objectives:

To describe clinical and molecular characteristics of an outbreak due to metallo-β-lactamases (MBLs) producing Klebsiella pneumoniae collected at Charles Nicolle Hospital of Tunis and to analyze the impact of outer membrane porin (OMP) loss on carbapenem resistance levels.

Methods:

Between 2010 and 2015, 178 carbapenem-resistant Enterobacteriaceae were isolated. Screening for MBL production was performed using combined disk diffusion method, with imipenem and ethylene diamine tetraacetic acid (EDTA) as inhibitors. Resistance genes and virulence factors were identified by polymerase chain reaction (PCR) and sequencing. Genotyping was performed by pulsed-field gel electrophoresis and multilocus sequence typing. Genetic environment of carbapenemase genes was determined by PCR mapping. Conjugation assays were performed, and plasmids were assigned to incompatibility groups by PCR-based replicon typing. OMPs were profiled by sodium dodecyl sulfate-polyacrilamide gel electrophoresis, and porin genes were sequenced.

Results:

Nineteen K. pneumoniae (10.6%) showing MBL activity were isolated from patients hospitalized on four different wards. NDM-1 was the only MBL identified, in association with bla_OXA-48. All strains lacked at least one OMP, and carbapenem resistance levels were remarkably elevated in strains lacking OmpK35 and OmpK36. bla_NDM-1 was located in IncFIA-type conjugative plasmid, with the same genetic context in all strains. The epidemiological diffusion of bla_NDM-1 was due to two clones, one major clone belonging to sequence type (ST) 147 (n = 16) and the other clone belonging to ST307 (n = 3).

Conclusions:

This study describes an outbreak of NDM-1-producing K. pneumoniae strains, isolated from a Tunisian hospital, caused by two clones belonging to ST147 and ST307; and highlights the role of OMPs loss, in combination with β-lactamase expression, in conferring high carbapenem resistance.

Introduction

Carbapenems are the drugs of choice for the treatment of serious infections caused by multidrug-resistant Enterobacteriaceae producing extended-spectrum β-lactamases (ESBLs) or Ambler class C β-lactamases (AmpC). The misuse of these antibiotics has led to the emergence of carbapenem-resistant Enterobacteriaceae (CRE). This resistance results from one or more mechanisms,¹ including (1) production of carbapenemases of class A (KPC, GES, and others), class B metallo-β-lactamases (MBLs; including imipenemase, VIM, NDM, and others), or class D (OXA-48 and related enzymes),² (2) hyperproduction or derepression of AmpC β-lactamases or ESBL production, associated with outer membrane porins (OMPs) loss or alteration,³ or (3) rarely by penicillin-binding protein alteration.⁴

Carbapenemases diffusion among Enterobacteriaceae is of particular importance, since these β-lactamases have the broadest spectrum of activity, usually hydrolyzing most β-lactams. In fact, species producing these enzymes are generally multidrug resistant, resulting in true therapeutic impasses. Furthermore, genes encoding for carbapenemases are most often located on plasmids and are very easily transferable. The mostly reported carbapenemases are KPC, VIM, imipenemase, NDM, and OXA-48 types.

MBL enzymes are reported in nonfermentative bacteria as well as members of Enterobacteriaceae family. The most frequently described MBLs are New Delhi MBL-variants, first identified from Klebsiella pneumoniae in a Swedish patient who was previously hospitalized in India.⁵ Since then, most of the outbreaks indicated a link with the Indian subcontinent and in some cases with the Balkan countries.⁶ Similar to all other MBLs, NDM efficiently hydrolyses a broad range of β-lactams, including penicillins, cephalosporins, and carbapenems, just sparing monobactams. The emergence and dissemination of NDM-producing isolates have been reported in several countries, including North Africa⁷ and in Tunisia.^8–10 Furthermore, Tunisia is considered as reservoir of OXA-48-producers and an increasing number of outbreaks due to OXA-48 (and its variants)-producing Enterobacteriaceae have been described.^7,11

Within Enterobacteriaceae species, high rates of carbapenem resistance have been recorded among K. pneumoniae clinical isolates in our hospital. This species is a highly important pathogen that causes a wide range of hospital- and community-acquired infections, such as urinary tract infections, pneumoniae, and respiratory tract infections,¹² associated with high morbidity and mortality, mainly in immunocompromised individuals.¹³

K. pneumoniae outer membrane usually contains two major nonspecific porins namely OmpK35 and OmpK36, other specific porins (i.e., LamB and PhoE), and a minor quiescent porin (OmpK37). Both OmpK35 and OmpK36 play an important role in antibiotics penetration into the cell, and their loss can contribute to decrease susceptibility or even resistance to cephalosporins and carbapenems.^14,15

Since their first description at Charles Nicolle hospital in 2010,¹⁶ regular monitoring of CRE strains has been achieved. This study aimed to characterize K. pneumoniae isolates from our hospital showing positive phenotypic testing for MBL carbapenemases, considering the following objectives: (1) to detect and identify genes coding for MBL enzymes, (2) to assess the role of OMPs in carbapenem resistance, (3) to conduct an epidemiological investigation using chromosome and plasmid fingerprints, and (4) to determine virulence factors of the selected strains.

Materials and Methods

Clinical isolates

Between 2010 and 2015, 12,702 unduplicated enterobacteria strains were isolated. Among them, 178 were ertapenem resistant. Only 19 K. pneumoniae (1 per patient) showing positive phenotypic testing for MBL carbapenemases were analyzed in this study.

Antimicrobial susceptibility testing

Species identification was performed with the API 20E system (BioMérieux, Marcy-l'Etoile, France) and confirmed by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF; Bruker Daltonics GmbH, Bremen, Germany). Initially, susceptibility to amoxicillin, amoxicillin–clavulanic acid, cefoxitin, ceftazidime, cefotaxime, cefalotin, cefepime, ertapenem, imipenem, aztreonam, amikacin, tobramycin, netilmicin, nalidixic acid, ofloxacin, ciprofloxacin, fosfomycin, tetracycline, minocycline, and tigecycline was determined by disk diffusion using Mueller-Hinton agar (Bio-Rad), according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines.¹⁷ Subsequently, minimal inhibitory concentrations (MICs) of amoxicillin–clavulanic acid, cefepime, cefotaxime, ceftazidime, ertapenem, imipenem, and tigecycline were determined with the Vitek 2 system (BioMérieux). In addition, MICs of ertapenem, imipenem, meropenem, and colistin were determined using E-test strips (BioMérieux) according to the manufacturer's instructions. MICs were interpreted according to EUCAST breakpoints.¹⁷

Phenotypic assays

Screening for the production of class B carbapenemases was evaluated by comparing the inhibition zones obtained with imipenem disks, with or without ethylene diamine tetraacetic acid (EDTA) (10 μl of 0.5 M solution).¹⁸ After overnight incubation, the presence of an enlarged zone of inhibition (>7 mm) was interpreted as positive. Each isolate was tested with a disk containing 30 μg of temocillin (Becton, Dickinson & Co.) to facilitate the detection of class D carbapenemases.¹¹

The production of ESBLs was evidenced by a double-disk synergy test using a combination of amoxicillin/clavulanic acid and aztreonam disks.¹⁹

Molecular analysis of carbapenem resistance genes

Multiplex polymerase chain reactions (PCRs) were performed to detect the most frequently widespread carbapenemases genes of class A (bla_KPC and bla_GES), B (bla_IMP and bla_VIM), and D (bla_OXA-48-like), as previously described.²⁰ The detection of bla_NDM gene was performed as described elsewhere.²¹ PCR products were sequenced, and the nucleotide and deduced protein sequences were analyzed with the software available from the National Center of Biotechnology Information (NCBI) website (www.ncbi.nlm.nih.gov).

Detection of associated resistance genes

ESBL genes (bla_CTX-M, bla_TEM, bla_SHV, bla_PER, bla_VEB), plasmid mediated AmpC β-lactamases (bla_ACC, bla_MOX, bla_FOX, bla_DHA, bla_CIT, bla_EBC), and broad-spectrum β-lactamase genes (bla_OXA-1-like) were searched,²⁰ together with aminoglycoside resistance genes [acc(6′)-Ib, aac(3′)-Ia, aac(3′)-IIa, aac(3′)-IVa, aph(3′)-Ia, aph(3′)-IIa, aph(3′)-VIa, ant(2″)-Ia],²² and plasmid-mediated quinolone resistance (PMQR) genes (qnrA, qnrB, and qnrS).²³ Subsequent sequencing of PCR products was performed. For the PMQR genes, the identification of qnr alleles was performed by sequencing, otherwise, the aac(6′)-Ib-cr variant was detected by restriction fragment length polymorphism method using FokI (New England Biolabs) restriction enzyme, as previously described.²⁴

Genetic environment of carbapenemase genes

The genetic environment of bla_NDM-1 gene was determined by PCR mapping, as described previously.³ For bla_OXA-48 gene, primers were designed to assess the genetic environment, targeting its right as well as its left ends²⁵ (Table 1).

Table 1.

Primers Designed in This Study to Assess Genetic Environment of bla_NDM-1 and bla_OXA-48

Primer	Sequence (5′–3′)	Gene	Amplicon size (bp)	Tm	References
ISAba125A	TGT ATA TTT CTG TGA CCC AC	ISAba125	—	57	³
ISAba125ext	ACA CCA TTA GAG AAA TTT GC	ISAba125	—
bleo-Rev	GGC GAT GAC AGC ATC ATC CG	ble _MBL	—
ORF67—Tn1999_for	TTGCCCTCGTTCACATTTTC	orf67—Tn1999	1,170	55	This study
ORF67—Tn1999_rev	AAGTCGTACCAACAGTCCAG
Tn1999—LysR_for	CACAACAGGCATTGAACCAT	Tn1999—lysR	1,758	55
Tn1999—LysR_rev	AGATCAGAGGATTGCAGTGG
LysR—OXA48_for	CCAAGGCTGTTATCGAGAGT	lysR—bla_OXA-48	1,721	57
LysR—OXA48_rev	GGTAGCAAAGGAATGGCAAG
OXA48—ΔTIR_for	TAAAAATGCTTGGTTCGCCC	bla_OXA-48—Δtir	1,629	57
OXA48—ΔTIR_rev	GGCCTGAAAATGCTTATCCC
ΔTIR—mucAB_for	GCATTTTCAGGCCAATACCA	Δtir—mucA, mucB	1,588	55
ΔTIR—mucAB_rev	GAACGTAACCACACCCCATA

MBL, metallo-β-lactamase; Tm, melting temperature.

Isolation and analysis of outer membrane components

Outer membrane protein preparations were obtained after sonication of bacterial cells grown in Mueller-Hinton broth, followed by selective solubilization of the cytoplasmic material with sodium lauroyl-sarcosynate (2%) and ultracentrifugation.²⁶ Samples were boiled and run on sodium dodecyl sulfate-polyacrylamide gels (11.0%) and stained with Coomassie blue. The encoding sequences of the ompK36 and ompK35 genes of three representative isolates based on pulsed-field gel electrophoresis (PFGE) profiles (one representative strain belonging to clones A and B and to subclone A1) were amplified, sequenced, and aligned with those of ompK gene sequences of K. pneumoniae KCTC2242 producing OmpK35 and lacking OmpK36 (NCBI accession No. CP002910) and K. pneumoniae NTUH-K2044 producing OmpK36 and lacking OmpK35 (NCBI accession No. AP006725).

Conjugation experiments

Conjugation was attempted with three donor isolates selected according to the PFGE results, using rifampin-resistant Escherichia coli J53 as the recipient strain. Transconjugants were selected on Mueller-Hinton agar plates containing 500 mg/L of rifampin with either ceftazidime (8 mg/L) or temocillin (250 mg/L). Resistance profiles of the obtained transconjugants were tested by disk diffusion method and PCR, as previously mentioned.

Plasmid analysis

Plasmid DNA of three isolates and their transconjugants was isolated using Plasmid Isolation Kit (Eurobio) following the manufacturer's guidelines. Plasmids were classified according to their incompatibility group using the PCR-replicon-typing scheme.²⁷ PCR assays for the repA, traU, and parA genes were performed to determine the genetic backbone of the bla_OXA-48 carrying plasmids.²⁵

Analysis of clonal relatedness

To assess clonality, all isolates were subjected to PFGE, as described by Arlet et al.²⁸ The obtained fingerprints were interpreted by using the criteria described by Tenover et al.²⁹

Multilocus sequence typing (MLST) was performed using a previously standardized MLST protocol.³⁰ The scheme used the following seven housekeeping genes: gapA, infB, mdh, pgi, phoE, rpoB, and tonB. The allelic profile was summarized by assigning a sequence type (ST) via a web database (www.pasteur.fr/recherche/genopole/PF8/mlstKpneumoniae.html).

Virulence factors in K. pneumoniae

The virulence profile was analyzed by PCR to check for the presence of nine genes linked to virulence in K. pneumoniae,^31,32 namely capsular serotype K1 and hypermucoviscosity phenotype (magA), allantoin metabolism (allS), regulator of mucoid phenotype A (rmpA), iron system capture (iroN), capsular serotype K2 and hypermucoviscosity phenotype (cps), adhesion type 3 fimbriae (mrkD), iron transport and phosphotransferase function (kfu), siderophore (entB), and siderophore yersiniabactin (ybtS).

Results

Clinical isolates and antibiotic susceptibility

The 19 K. pneumoniae strains (10.6%) showing MBL activity were isolated from patients hospitalized in 4 different wards. Indeed, the first MBL-positive strain was collected from a patient hospitalized in the intensive care unit (ICU) and, 2 months later, the second strain was isolated from a patient hospitalized in the medical ward (Table 2). Specimen sources were urine (n = 8), blood (n = 6), wound (n = 3), and catheter (n = 2).

Table 2.

Characteristics of Patients Infected with bla_NDM-1-Producing Klebsiella pneumoniae Isolates

Patient	Strain	Date of hospitalization (day/month/year)	Date of collection (day/month/year)	Ward	Specimen	Age (years)	Gender	Underlying disease	Treatment	Outcome	Septic shock, yes/no	Cause of death
1	KP1	25/02/2014	28/02/2014	ICU	Pulmonary	68	F	Pneumonia	IMP, CIP	Improved	NA	NA
2	KP2	23/01/2014	14/04/2014	Medicine	Urine	29	F	Lupus	Amoxicillin/clavulanic acid then IMP, metronidazole, cefotaxime, CIP	Improved	NA	NA
3	KP3	02/04/2014	18/04/2014	ICU	Urine	68	M	Ischemic stroke	Amoxicillin/clavulanic acid then IMP, CIP, colistin, vancomycin	Died	No	ND
4	KP4	03/07/2014	04/07/2014	Pediatrics	Blood	6	F	Cellulitis of the leg	Amoxicillin/clavulanic acid	Improved	NA	NA
5	KP5	27/08/2014	15/09/2014	Medicine	Urine	65	F	Deterioration of renal function	Amoxicillin/clavulanic acid, then IMP, FOS, amikacin	Died	No	ND
6	KP6	05/09/2014	07/10/2014	ICU	Urine	84	M	Pneumonia	Cefotaxime, CIP	Improved	NA	NA
7	KP7	01/10/2014	13/10/2014	ICU	Catheter	45	M	Respiratory distress, open leg fracture	Amoxicillin/clavulanic acid, GEN	Improved	NA	NA
8	KP8	24/08/2014	17/10/2014	ICU	Blood	45	M	Septic shock	Imipenem, colistin, FOS, teicoplanin then vancomycin	Died	Yes	CPE infection
9	KP9	06/11/2014	18/11/2014	Medicine	Urine	34	M	Chronic nephropathy	amoxicillin/clavulanic acid	Died	Yes	CPE infection
10	KP10	20/11/2014	06/12/2014	ICU	Blood	51	M	Polytrauma	Amoxicillin/clavulanic acid, GEN then, IMP, CIP	Died	Yes	CPE infection
11	KP11	04/11/2014	09/12/2014	Medicine	Urine	53	F	Advanced renal failure	IMP	Improved	NA	NA
12	KP12	11/12/2014	20/12/2014	Surgery	Blood	73	F	Fournier gangrene	Amoxicillin/clavulanic acid, GEN, then IMP, metronidazole, amikacin, vancomycin, colistin	Died	Yes	CPE infection
13	KP13	21/01/2015	23/01/2015	ICU	Wound	21	M	Polytrauma	IMP, colistin then vancomycin, FOS	Improved	NA	NA
14	KP14	23/02/2015	28/02/2015	ICU	Catheter	57	F	Polytrauma	IMP, amoxicillin, FOS	Improved	NA	NA
15	KP15	13/02/2015	06/03/2015	Surgery	Blood	20	F	Mediastinitis	Amikacin, colistin, metronidazole, CIP, rifampin	Died	Yes	CPE infection
16	KP16	28/01/2015	16/03/2015	Surgery	Blood	64	M	Gastric adenocarcinoma	IMP, teicoplanin, TGC, colistin	Died	Yes	CPE infection
17	KP17	07/01/2015	17/03/2015	Medicine	Urine	25	M	Renal failure	IMP, amoxicillin, vancomycin	Improved	NA	NA
18	KP18	18/02/2015	10/04/2015	ICU	Wound	37	M	Cranial Polytrauma	Amoxicillin/clavulanic acid, GEN	Died	No	ND
19	KP19	20/05/2015	05/06/2015	ICU	Urine	52	F	Septic shock	IMP, metronidazole, amikacin then vancomycin, colistin, FOS	Died	Yes	CPE infection

CIP, ciprofloxacin; CPE, carbapenemase-producing Enterobacteriaceae; F, female; FOS, fosfomycin; GEN, gentamicin; ICU, intensive care unit; IMP, imipenem; M, male; NA, not applicable; ND, not determined; TGC, tigecycline.

The median age of the 19 patients was 47.2 years (range: 6–84 years) and the male to female ratio was 1.11. Thirteen patients were treated, during hospitalization, with imipenem as first-line antibiotic (for eight patients), or as second-line antibiotic instead of amoxicillin/clavulanic acid (for five patients) (Table 2). Besides, combinations of different antibiotic families were used, namely polymyxins (mainly colistin), aminoglycosides (such as amikacin and/or gentamicin), and fluoroquinolones (mainly ciprofloxacin); in association with imipenem. Despite antibiotic treatment, 10 patients died (52.6%) during hospitalization. Death was a result of infection caused by carbapenemase-producing Enterobacteriaceae in seven patients. However, causal relationship between infection and death has not been clearly established in three patients (Table 2).

E-test results showed that the 19 isolates were resistant to ertapenem (MICs range 1.5 to >32 mg/L), while different results were obtained with the Vitek2 system, given that 16 strains were resistant and 3 were susceptible (MICs range <0.5 to >8 mg/L).

For imipenem, 12 strains were resistant and 7 were susceptible (MICs range 0.75 to >32 mg/L) according to E-test results. Furthermore, Vitek2 system revealed that 10 strains were resistant, 6 were intermediate, and 3 were susceptible to the same antibiotic (MICs range <0.25 to >16 mg/L).

Resistance to meropenem was tested only with E-test, and results showed that 15 isolates were resistant and 4 were susceptible (MICs range 1.5 to >32 mg/L).

Only three isolates displayed temocillin resistance, with total absence of inhibition zone.

Results obtained with disk diffusion method indicate that the 19 strains were resistant to tobramycin, netilmicin, chloramphenicol, tetracycline, nalidixic acid, ofloxacin, ciprofloxacin, trimethoprim-sulfamethoxazole, minocycline, and fosfomycin. Furthermore, they were resistant to amoxicillin/clavulanic acid (MICs >32 mg/L), to cefepime (MICs range 16 to >64 mg/L), to cefotaxime (MICs >64 mg/L), to ceftazidime (MICs >64 mg/L), and to tigecycline (MICs range 2 to >8 mg/L). Otherwise, all 19 isolates remained susceptible to colistin (MICs range 0.016–1 mg/L).

Molecular epidemiology

Molecular fingerprints clustered the 19 K. pneumoniae strains into 2 PFGE clonal types (A and B) and one subclone (A1). The largest cluster A belonged to ST147 (15 isolates; 78.9%), while cluster B belonged to ST307 (3 isolates; 15.8%). The subclone A1 belonged to ST147 (Table 3).

Table 3.

Phenotypic Assays, Antibiotic Resistance Patterns and Genotypic Characteristics of the 19 NDM-1-Producing Klebsiella pneumoniae

			MICs (E-test strips/Vitek2 system), EUCAST guidelines (mg/L)						SDS-PAGE result
Strain	PFGE pattern/MLST	EDTA	ETP (≤0.5 to >1)	IMP (≤2 to >8)	MER (≤2 to >8)	TGC (≤1 to >2)	Carbapenemase genes	Associated resistance genes	OmpK35	OmpK36	Virulence factors
KP1	A/ST147	+	32/>8	8/8	>32/ND	ND/2	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP2	A/ST147	+	12/>8	2/>16	6/ND	ND/>8	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, qnrS1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP3	A/ST147	+	4/<0.5	0.75/<0.25	2/ND	ND/2	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1	+	—	entB, mrkD, ybtS
KP4	A/ST147	+	>32/>8	0.75/8	2/ND	ND/>8	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrS1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP5	A/ST147	+	32/<0.5	1.5/<0.25	4/ND	ND/4	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, qnrS1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP6	A/ST147	+	12/<0.5	8/<0.25	12/ND	ND/4	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP7	A/ST147	+	32/>8	32/>16	32/ND	ND/2	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, qnrS1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP8	A/ST147	+	>32/4	>32/>16	>32/ND	ND/2	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, qnrS1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP9	B/ST307	+	32/4	3/8	4/ND	ND/2	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, aac(6′)-Ib-cr	—	+	entB, mrkD
KP10	A/ST147	+	12/>8	2/8	8/ND	ND/2	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP11	B/ST307	+	32/4	32/>16	32/ND	ND/2	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, aac(6′)-Ib-cr	—	+	entB, mrkD
KP12	A/ST147	+	12/>8	1.5/>16	2/ND	ND/2	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP13	A/ST147	+	>32/>8	>32/>16	>32/ND	ND/4	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP14	B/ST307	+	1.5/4	1/>16	1.5/ND	ND/2	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, aac(6′)-Ib-cr	−	+	entB, mrkD
KP15	A/ST147	+	>32/>8	>32/>16	>32/ND	ND/2	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP16	A/ST147	+	32/>8	32/8	>32/ND	ND/2	bla_NDM-1, bla_OXA-48	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP17	A/ST147	+	32/>8	32/>16	6/ND	ND/2	bla _NDM-1	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP18	A/ST147	+	>32/>8	>32/8	>32/ND	ND/4	bla_NDM-1, bla_OXA-48	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, aac(6′)-Ib-cr	+	—	entB, mrkD, ybtS
KP19	A1/ST147	+	>32/>8	>32/>16	>32/ND	ND/2	bla_NDM-1, bla_OXA-48	bla_CTX-M-15, bla_TEM-1, bla_SHV-1, bla_OXA-1, qnrB1, aac(6′)-Ib-cr	—	—	entB, mrkD, ybtS

+, positive result; —, negative result; COL, colistin; EDTA, ethylene diamine tetraacetic acid; ETP, ertapenem; EUCAST, European Committee on Antimicrobial Susceptibility Testing; MER, meropenem; MIC, minimal inhibitory concentration; MLST, multilocus sequence typing; OMP, outer membrane porin; PFGE, pulsed-field gel electrophoresis; SDS-PAGE, sodium dodecyl sulfate-polyacrilamide gel electrophoresis; ST, sequence type.

Characterization of antimicrobial resistance genes

Among the MBL-type enzymes sought, only NDM-1 was detected in all strains. Moreover, three isolates coproduced bla_OXA-48 gene. The bla_CTX-M-15, bla_OXA-1, and bla_SHV-1 genes were detected in all isolates. The distribution of PMQR genes was as follows: aac(6′)-Ib-cr (n = 19), qnrB1 (n = 14), and qnrS1 (n = 4). None of the isolates produced a plasmid mediated AmpC β-lactamase.

Genetic environment of the carbapenemase genes

The PCR mapping showed that the bla_NDM-1 gene was preceded by a complete copy of insertion sequence ISAba125 and followed by a bleomycin-resistance gene ble_MBL, conferring resistance to bleomycin and bleomycin-like molecules.

Analysis of the genetic environment of the bla_OXA-48 gene revealed two copies of the same insertion sequence IS1999, flanking a DNA fragment that includes the bla_OXA-48 gene. This genetic structure forms the transposon Tn1999, which is inserted within tir gene. Downstream of bla_OXA-48, a lysR gene was identified, followed by a truncated fragment of a gene encoding an acetyl coenzyme A carboxylase.

Outer membrane profiles

Analysis of OMPs showed the presence, for all isolates, of a band of ca. 32 kDa, corresponding to the OmpA-like protein³³ (Fig. 1). Furthermore, they lacked at least one porin (OmpK35, OmpK36, or both).

FIG. 1.

Sodium dodecyl sulfate-polyacrylamide gel electrophoretic analysis of OMPs from NDM-1-producing Klebsiella pneumoniae strain. M, molecular size markers (in kilodaltons); NG, negative control producing neither Ompk5 nor OmpK36; PC, positive control producing both OmpK35 and OmpK36.

Strain KP3 (belonging to pulsotype A, clone ST147) lacked a band of about 35 kDa corresponding to OmpK36. Sequencing revealed that ompK36 contains 38 nucleotide substitutions (including a frameshift mutation at amino acid position 178), an insertion of a 9 nucleotides fragment at position 1149 and a deletion of 3 nucleotides at position 1523. For this isolate, MICs of ertapenem, imipenemase, and meropenem were 4, 0.75, and 2 mg/L, respectively.

Strain KP14 (belonging to pulsotype B, clone ST307) also lacked OmpK36 porin. ompK36 sequencing revealed several substitutions (55 nucleotide substitutions), as well as insertions of 2, 7, 6, 3, 15, 3, and 3 nucleotides at positions 182, 272, 1174, 1315, 1323, and 1332, respectively (leading to a frameshift mutation); in addition to deletions of 3 nucleotides at position 1315 and 1565. For this isolate, MICs of ertapenem, imipenemase, and meropenem were 1.5, 1, and 1.5 mg/L, respectively.

Strain KP19 (belonging pulsotype A1, clone 147) lacked both OmpK35 and OmpK36. Sequencing analysis of ompK35 identified two point mutations (A to T at nucleotide position 1335 and A to G at nucleotide position 1622) and one nucleotide insertion at position 1337 causing a premature codon stop at amino acid position 26, leading to a truncated protein. The ompK36 gene contains 42 nucleotide substitutions, with a premature stop codon at amino acid position 25, as well as 9 nucleotides insertion at position 1177, and 3 nucleotides deletion at position 1552. This isolate showed high carbapenem resistance level (>32 mg/L).

Conjugation experiments

Four transconjugants were obtained from the three selected donors (KP3, KP14, and KP19), and all of them showed MBL phenotype (Table 4). They all exhibited bla_NDM-1 gene, and additional resistance markers were cotransferred, including bla_CTX-M-15, bla_TEM-1, bla_OXA-1, and bla_OXA-48. According to E-test results, decreased susceptibility to ertapenem (MICs range 0.5–4 mg/L), to imipenem (MICs range 0.19–1 mg/L), and to meropenem (MICs range 0.125–1.5 mg/L) were reported, comparing with the donors. No other antibiotic resistance markers were cotransferred, with the exception of tobramycin and minocycline in E. coli J53 transconjugant (Tc) KP19-1 and E. coli J53 Tc KP19-2.

Table 4.

Phenotypic and Genotypic Characteristics of the Three Selected NDM-1-Producing Isolates and Their Transconjugants

	MIC (mg/L)
Strain	ETP	IMP	MER	EDTA	Non-β-lactam associated resistance profile	β-lactamase genes	Incompatibility group
KP3	4	0.75	2	+	TOB, NET, CHL, TET, MNO, TGC, NAL, OFX, CIP, FOS, SXT	bla_NDM-1, bla_CTX-M-15, bla_TEM-1, bla_OXA-1, bla_SHV-1	FIA, N
Escherichia coli J53 Tc KP3	0.5	0.19	0.125	+	None	bla_NDM-1, bla_CTX-M-15, bla_TEM-1, bla_OXA-1	FIA
KP19	>32	>32	>32	+	GEN, TOB, NET, TET, MNO, TGC, NAL, OFX, CIP, FOS, SXT	bla_NDM-1, bla_OXA-48, bla_CTX-M-15, bla_TEM-1, bla_OXA-1, bla_SHV-1	FIA, L/M
E. coli J53 Tc KP19-1	4	1	1.5	+	TOB, MNO	bla_NDM-1, bla_OXA-48, bla_CTX-M-15, bla_TEM-1, bla_OXA-1	FIA, L/M
E. coli J53 Tc KP19-2	0.75	0.25	0.25	+	TOB, MNO	bla_NDM-1, bla_CTX-M-15, bla_TEM-1, bla_OXA-1	FIA
KP14	1.5	1	1.5	+	GEN, TOB, NET, TET, MNO, TGC, NAL, OFX, CIP, SXT	bla_NDM-1, bla_CTX-M-15, bla_TEM-1, bla_OXA-1, bla_SHV-1	FIA, A/C
E. coli J53 Tc KP14	0.75	0.5	0.25	+	None	bla_NDM-1, bla_CTX-M-15, bla_TEM-1, bla_OXA-1	FIA
E. coli J53	0.002	0.094	0.008	—	None	—	—

CHL, chloramphenicol; MNO, minocycline; NAL, nalidixic acid; NET, netilmicin; OFX, ofloxacin; SXT, trimethoprim-sulfamethoxazole; Tc, transconjugant; TET, tetracycline; TOB, tobramycin.

Plasmid analysis

Plasmid DNA analysis of the three E. coli transconjugants derived from KP3, KP14, and KP19 isolates showed that bla_NDM-1 gene was carried on IncFIA-type plasmid (Table 4).

The bla_OXA-48 gene was carried on a plasmid that possesses a pOXA-48-like backbone. Results of PCR assays for the repA, traU, and parA genes confirmed that each plasmid was very closely related to pOXA-48.

Virulence factors

Of the nine virulence factors searched, entB and mrkD were detected in all isolates. Moreover, ybtS was detected in 15 isolates (78.94%) (Table 3).

Discussion

In this study based on 6-year survey (2010–2015), we describe an outbreak involving 19 NDM-1-producing K. pneumoniae isolates collected from Tunisian patients in healthcare facilities, having no apparent epidemiological link to an endemic area. Thereby, Tunisia is facing a serious health problem, given that OXA-48-producing Enterobacteriaceae are already endemic in this country.

Reports describing the emergence and spread of strains carrying bla_NDM-1 gene have increased around the world over the last few years. In 2013, Ben Nasr et al.⁸ described the first K. pneumoniae strain coproducing NDM-1 and OXA-48 enzymes isolated from a Libyan patient hospitalized in the ICU in a Tunisian hospital, highlighting the role of travelers in the dissemination of pathogens. Furthermore, two recent reports have described the diffusion of NDM-1-producing strains in Tunisian healthcare settings.^9,10

The introduction of the first NDM-1-producing strain in our hospital has been attributed to index patient 1, a 68-year-old female, transferred from a Tunisian private hospital and admitted to the ICU of our hospital in February 2014. Furthermore, the majority of the specimens were from patients hospitalized in the ICU (n = 10) showing that, in this setting, NDM-1-producing K. pneumoniae isolates are associated with nosocomial infections in seriously ill patients.

During hospitalization, most patients were treated with imipenem in association with other β-lactams, fluoroquinolones, and aminoglycosides. Despite this antibiotic treatment, the mortality rate was high, being 52.6%. Our findings show an urgent need to control the use of antibiotics, especially in the ICU, and the selection of appropriate antibiotics by monitoring the dose, the treatment duration, and the administration route to obtain optimal clinical results and to limit the selection of multidrug-resistant strains.

In all isolates, we observed that there were major discordances between MICs obtained with automated instrument and gradient MICs. In fact, if the Vitek2 system was the only technique used for the detection of carbapenem resistance, some of our strains would be lost. Reports have shown that automated instruments could fail in correctly evaluating the correct MICs of several organisms.³⁴

Enterobacteriaceae isolates with KPC enzymes were not initially recognized because the carbapenem MICs were in the susceptible range when applying breakpoints to susceptibility tests results.³⁵ This susceptibility has been observed for producers of all types of carbapenemases,³⁶ and this is particularly true for OXA-48 producers that do not coproduce an ESBL.^37,38 To minimize these false-susceptible errors, both Clinical and Laboratory Standards Institute (CLSI) and EUCAST have added separate cutoff values for detecting putative carbapenemase producers for infection control and public health purposes that are considerably lower than the clinical breakpoints.^19,39

Different carbapenem resistance levels were observed, which is probably due to differences in the expression levels of carbapenemase genes,⁵ or the loss of either one or both of the two major porins (OmpK35 and OmpK36), especially in K. pneumoniae strains harboring ESBLs,⁴⁰ as observed in our strains.

All isolates showed a multidrug-resistant phenotype, but remained susceptible to colistin, according to E-test results. For colistin susceptibility testing, gradient diffusion (E-test) is not a standardized technique, according to the EUCAST guidelines.¹⁷

Genetic environment of bla_NDM-1 showed the presence of ISAba125 on the upstream region and bleomycin resistance gene ble_MBL on the downstream region, which is a genetic structure similar to those reported elsewhere.⁴¹ Furthermore, diversity of the genetic environment of bla_NDM-1 has been reported.⁴² Three strains were additionally carrying the bla_OXA-48 gene, and PCR mapping showed the previously identified Tn1999 transposon.²⁵ Moreover, the genetic backbone of bla_OXA-48 was linked to the epidemic plasmid pOXA-48, identified from diverse geographical origin.

All isolates also coproduce bla_CTX-M-15 gene as well as bla_TEM-1 and bla_OXA-1 and different combinations of PMQR genes. These multidrug resistance determinants are plasmid mediated and can disseminate easily across several unrelated genera. Besides, the dissemination of bla_NDM-1 and bla_OXA-48 carbapenemases together with ESBLs genes in K. pneumoniae isolates are a source of concern, since carbapenems are antibiotics of last resort for the treatment of multidrug-resistant strains producing ESBL.

OmpK35 loss may be one of the factors contributing to the antibiotic resistance among ESBL-producing K. pneumoniae, and OmpK36 may play an important role in the resistance or reduced susceptibility to carbapenems in K. pneumoniae that produce ESBL or AmpC-type-β-lactamases.⁴³ Our strains were lacking either one or both OMP, and we observe that carbapenem MICs were remarkably elevated in strains lacking both OMPs. These results emphasize the role of the two major porins OmpK35 and OmpK36, in association with β-lactamases production, including carbapenemases and ESBL, in increasing carbapenem resistance among K. pneumoniae strains.

Transfer of bla_NDM-1 and bla_OXA-48 genes to E. coli J53 strain was successful. Furthermore, only bla_NDM-1 was transferred from an isolate harboring both bla_NDM-1 and bla_OXA-48, suggesting that these two genes are not located on the same plasmid.

All K. pneumoniae strains possess several virulence genes namely mrkD that facilitates adhesion to extracellular matrix proteins and mediates binding to cells derived from the urinary tract⁴⁴ as well as the iron-scavenging system entB, sufficient to cause robust replication in the lung and sepsis. Besides, 80% of them produce yersiniabactin, a siderophore encoded by the Yersinia high-pathogenicity island that is less frequent in K. pneumoniae. These virulence factors are generally carried by plasmids that probably carry different antibiotic resistance genes, and their interspecies dissemination could increase strains pathogenicity.

The dissemination of bla_NDM-1 in this study was caused by two clones, based upon PFGE and MLST results; therefore, several NDM-1-producing clones could be present in Tunisia. Besides, ST147 is a major drug-resistant pathogen among carbapenemase-producing K. pneumoniae, found worldwide and in Tunisia,¹⁰ while ST307 has been reported in NDM-1-producing K. pneumoniae strains.⁴⁵

In conclusion, we characterize an outbreak of NDM-1-producing K. pneumoniae isolates from Tunisian patients. The emergence and diffusion of multiresistant clones producing MBL in our hospital require strengthening of infection control and prevention strategies, including appropriate antibiotic therapy and colonized patients' surveillance to minimize the spread of these organisms.

Footnotes

Acknowledgment

This study was financially supported by the Ministry of Scientific Research Technology and Competence Development of Tunisia.

Disclosure Statement

No competing financial interests exist.

References

Patel

, and Bonomo

R.A.

. 2013. “Stormy waters ahead”: global emergence of carbapenemases. Front. Microbiol., 4:48.

Sekar

2013. OXA-181 beta lactamase is not a major mediator of carbapenem resistance in Enterobacteriaceae. J. Clin. Diagn. Res., 7:1986–1988.

Poirel

, Dortet

, Bernabeu

, and Nordmann

. 2011. Genetic features of bla_NDM-1-positive Enterobacteriaceae. Antimicrob. Agents Chemother., 55:5403–5407.

Zapun

, Contreras-Martel

, and Vernet

. 2008. Penicillin-binding proteins and beta-lactam resistance. FEMS Microbiol. Rev., 32:361–385.

Yong

, Toleman

M.A.

, Giske

C.G.

, Cho

H.S.

, Sundman

, Lee

, et al. 2009. Characterization of a new metallo-β-lactamase gene, bla_NDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob. Agents Chemother., 53:5046–5054.

Livermore

D.M.

, Walsh

T.R.

, Toleman

, and Woodford

. 2011. Balkan NDM-1: escape or transplant? Lancet Infect. Dis., 11:164.

Shibl

, Al-Agamy

, Memish

, Senok

, Khader

S.A.

, and Assiri

. 2013. The emergence of OXA-48- and NDM-1-positive Klebsiella pneumoniae in Riyadh, Saudi Arabia. Int. J. Infect. Dis., 17:e1130–e1133.

Ben Nasr

, Decre

, Compain

, Genel

, Barguellil

, and Arlet

. 2013. Emergence of NDM-1 in association with OXA-48 in Klebsiella pneumoniae from Tunisia. Antimicrob. Agents Chemother., 57:4089–4090.

Izdebski

, Bojarska

, Baraniak

, Literacka

, Herda

, Żabicka

, et al. 2015. NDM-1- or OXA-48-producing Enterobacteriaceae colonising Polish tourists following a terrorist attack in Tunis, March 2015. Euro Surveill., 20:21150.

10.

Messaoudi

, Haenni

, Mansour

, Saras

, Bel Haj Khalifa

, Chaouch

, et al. 2017. ST147 NDM-1-producing Klebsiella pneumoniae spread in two Tunisian hospitals. J. Antimicrob. Chemother., 72:315–316.

11.

Potron

, Poirel

, Rondinaud

, and Nordmann

. 2013. Intercontinental spread of OXA-48 beta-lactamase-producing Enterobacteriaceae over a 11-year period, 2001 to 2011. Euro Surveill., 18:20549.

12.

Peirano

, Pillai

D.R.

, Pitondo-Silva

, Richardson

, and Pitout

J.D.D.

. 2011. The characteristics of NDM-producing Klebsiella pneumoniae from Canada. Diagn. Microbiol. Infect. Dis., 71:106–109.

13.

Abdelaziz

M.O.

, Bonura

, Aleo

, El-Domany

R.A.

, Fasciana

, and Mammina

. 2012. OXA-163-producing Klebsiella pneumoniae in Cairo, Egypt, in 2009 and 2010. J. Clin. Microbiol., 50:2489–2491.

14.

Bornet

, Davin-Regli

, Bosi

, Pages

J.M.

, and Bollet

. 2000. Imipenem resistance of Enterobacter aerogenes mediated by outer membrane permeability. J. Clin. Microbiol., 38:1048–1052.

15.

Bradford

P.A.

, Urban

, Mariano

, Projan

S.J.

, Rahal

J.J.

, and Bush

. 1997. Imipenem resistance in Klebsiella pneumoniae is associated with the combination of ACT-1, a plasmid-mediated AmpC beta-lactamase, and the foss of an outer membrane protein. Antimicrob. Agents Chemother., 41:563–569.

16.

Saïdani

, Hammami

, Kammoun

, Slim

, and Boutiba-Ben Boubaker

. 2012. Emergence of carbapenem-resistant OXA-48 carbapenemase-producing Enterobacteriaceae in Tunisia. J. Med. Microbiol., 61:1746–1749.

17.

The European Committee on Antimicrobial Susceptibility Testing (EUCAST). 2014. Antimicrobial susceptibility testing EUCAST disk diffusion method. Tables Interpret. MICs Zone Diameters. Version 3.0. http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Disk_test_documents/Manual_v_3.0_EUCAST_Disk_Test.pdf Accessed January 20, 2014.

18.

Galani

, Rekatsina

P.D.

, Hatzaki

, Plachouras

, Souli

, and Giamarellou

. 2008. Evaluation of different laboratory tests for the detection of metallo-beta-lactamase production in Enterobacteriaceae. J. Antimicrob. Chemother., 61:548–553.

19.

Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Third Informational Supplement. CLSI Doc. M100-S23. Wayne, PA.

20.

Dallenne

, Da Costa

, Decré

, Favier

, and Arlet

. 2010. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother., 65:490–495.

21.

Yoo

J.S.

, Kim

H.M.

, Koo

H.S.

, Yang

J.W.

, Yoo

J.I.

, Kim

H.S.

, et al. 2013. Nosocomial transmission of NDM-1-producing Escherichia coli ST101 in a Korean hospital. J. Antimicrob. Chemother., 68:2170–2172.

22.

Fernández-Martínez

, Miró

, Ortega

, Bou

, González-López

J.J.

, Oliver

, et al. 2015. Molecular identification of aminoglycoside-modifying enzymes in clinical isolates of Escherichia coli resistant to amoxicillin/clavulanic acid isolated in Spain. Int. J. Antimicrob. Agents, 46:157–163.

23.

Ferjani

, Saidani

, Amine

F.S.

, and Boutiba-Ben Boubaker

. 2015. Prevalence and characterization of plasmid-mediated quinolone resistance genes in extended-spectrum β-lactamase-producing Enterobacteriaceae in a Tunisian hospital. Microb. Drug Resist., 21:158–166.

24.

Kim

Y.-T.

, Jang

J.-H.

, Kim

H.-C.

, Kim

, Lee

K.-R.

, Park

K.S.

, et al. 2011. Identification of strain harboring both aac(6′)-Ib and aac(6′)-Ib-cr variant simultaneously in Escherichia coli and Klebsiella pneumoniae. BMB Rep., 44:262–266.

25.

Poirel

, Bonnin

R.A.

, and Nordmann

. 2012. Genetic features of the widespread plasmid coding for the carbapenemase OXA-48. Antimicrob. Agents Chemother., 56:559–562.

26.

Martínez-Martínez

, Conejo

M.C.

, Pascual

, Hernández-Allés

, Ballesta

, Ramírez De Arellano-Ramos

, et al. 2000. Activities of imipenem and cephalosporins against clonally related strains of Escherichia coli hyperproducing chromosomal beta-lactamase and showing altered porin profiles. Antimicrob. Agents Chemother., 44:2534–2536.

27.

Carattoli

2009. Resistance plasmid families in Enterobacteriaceae. Antimicrob. Agents Chemother., 53:2227–2238.

28.

Arlet

, Rouveau

, Casin

, Bouvet

P.J.

, Lagrange

P.H.

, and Philippon

. 1994. Molecular epidemiology of Klebsiella pneumoniae strains that produce SHV-4 beta-lactamase and which were isolated in 14 French hospitals. J. Clin. Microbiol., 32:2553–2558.

29.

Tenover

F.C.

, Arbeit

R.D.

, Goering

R.V.

, Mickelsen

P.A.

, Murray

B.E.

, Persing

D.H.

, et al. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol., 33:2233–2239.

30.

Diancourt

, Passet

, Verhoef

, Grimont

P.A.D.

, and Brisse

. 2005. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J. Clin. Microbiol., 43:4178–4182.

31.

Compain

, Babosan

, Brisse

, Genel

, Audo

, Ailloud

, et al. 2014. Multiplex PCR for detection of seven virulence factors and K1/K2 capsular serotypes of Klebsiella pneumoniae. J. Clin. Microbiol., 52:4377–4380.

32.

W.-L.

, Ko

W.-C.

, Cheng

K.-C.

, Lee

C.-C.

, Lai

C.-C.

, and Chuang

Y.-C.

. 2008. Comparison of prevalence of virulence factors for Klebsiella pneumoniae liver abscesses between isolates with capsular K1/K2 and non-K1/K2 serotypes. Diagn. Microbiol. Infect. Dis., 62:1–6.

33.

Martínez-Martínez

, Pascual

, Conejo Mdel

, García

, Joyanes

, Doménech-Sánchez

, et al. 2002. Energy-dependent accumulation of norfloxacin and porin expression in clinical isolates of Klebsiella pneumoniae and relationship to extended-spectrum beta-lactamase production. Antimicrob. Agents Chemother., 46:3926–3932.

34.

Tenover

F.C.

, Kalsi

R.K.

, Williams

P.P.

, Carey

R.B.

, Stocker

, Lonsway

, et al. 2006. Carbapenem resistance in Klebsiella pneumoniae not detected by automated susceptibility testing. Emerg. Infect. Dis., 12:1209–1213.

35.

Richter

S.S.

, and Marchaim

. 2017. Screening for carbapenem-resistant Enterobacteriaceae: who, when, and how? Virulence, 8:417–426.

36.

Nordmann

, Gniadkowski

, Giske

C.G.

, Poirel

, Woodford

, and Miriagou

. 2012. Identification and screening of carbapenemase-producing Enterobacteriaceae. Clin. Microbiol. Infect., 18:432–438.

37.

Nordmann

, Naas

, and Poirel

. 2011. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg. Infect. Dis., 17:1791–1798.

38.

Castanheira

, Deshpande

L.M.

, Mathai

, Bell

J.M.

, Jones

R.N.

, and Mendes

R.E.

. 2011. Early dissemination of NDM-1- and OXA-181-producing Enterobacteriaceae in Indian hospitals: report from the SENTRY Antimicrobial Surveillance Program, 2006–2007. Antimicrob. Agents Chemother., 55:1274–1278.

39.

Giske

C.G.

, Martinez-Martinez

, Stefani

, Glupczynski

, Nordmann

, Wootton

, et al. 2013. EUCAST guidelines for detection of resistance mechanisms and specific resistances of clinical and/or epidemiological importance. Basel, European Society of Clinical Microbiology and Infectious Diseases.

40.

Martínez-Martínez

, Pascual

, Hernández-Allés

, Alvarez-Díaz

, Suárez

A.I.

, Tran

, et al. 1999. Roles of beta-lactamases and porins in activities of carbapenems and cephalosporins against Klebsiella pneumoniae. Antimicrob. Agents Chemother., 43:1669–1673.

41.

Dortet

, Poirel

, Al Yaqoubi

, and Nordmann

. 2012. NDM-1, OXA-48 and OXA-181 carbapenemase-producing Enterobacteriaceae in Sultanate of Oman. Clin. Microbiol. Infect. Dis., 18:E144–E148.

42.

Rimrang

, Chanawong

, Lulitanond

, Wilailuckana

, Charoensri

, Sribenjalux

, et al. 2012. Emergence of NDM-1- and IMP-14a-producing Enterobacteriaceae in Thailand. J. Antimicrob. Chemother., 67:2626–2630.

43.

Tsai

Y.-K.

, Fung

C.-P.

, Lin

J.-C.

, Chen

J.-H.

, Chang

F.-Y.

, Chen

T.-L.

, et al. 2011. Klebsiella pneumoniae outer membrane porins OmpK35 and OmpK36 play roles in both antimicrobial resistance and virulence. Antimicrob. Agents Chemother., 55:1485–1493.

44.

Clegg

, and Murphy

C.N.

. 2016. Epidemiology and virulence of Klebsiella pneumoniae. Microbiol. Spectr., 4: UTI-0005-2012.

45.

Xie

, Dou

, Zhou

, Chen

, Han

, Guo

, et al. 2017. Coexistence of bla_OXA-48 and truncated bla_NDM-1 on different plasmids in a Klebsiella pneumoniae Isolate in China. Front. Microbiol., 8:133.