Comparison of Carba NP-Direct,Carbapenem Inactivation Method,and β-CARBA Tests for Detection of Carbapenemase Production in Enterobacteriaceae

Abstract

Rapid and accurate detection of carbapenemase-producing isolates are extremely important for management of antimicrobial therapy and the implementation of infection control measures. We evaluated the performance of Carba NP-direct, carbapenem inactivation method (CIM), and the commercial β-CARBA tests for detection of carbapenemase production in Enterobacteriaceae. Enterobacteriaceae isolates with previously characterized carbapenemase types (n = 110) and non-carbapenemase-producing Escherichia coli (n = 15) isolates were tested. Sensitivities of Carba NP-direct, CIM, and β-CARBA tests were 99.0%, 92.7%, and 93.6%, respectively, while specificity was 100% for all three tests. For β-CARBA test, a 60-min incubation time instead of 30 increased the sensitivity to 98.1%, and lessened false negativity, particularly with OXA-48-like producers. Our results showed that Carba NP-direct, CIM, and β-CARBA tests are useful tools for the reliable detection of carbapenemase activity in enterobacterial isolates. Carba NP-direct is a simple, rapid, and low-cost test for routine use.

Introduction

In the last decade, the incidence of carbapenemase-producing Enterobacteriaceae (CPE) infections has increased in the world as well as in Turkey.^1,2 Effective antibiotics for treatment of infections due to CPE are limited and these infections lead to prolonged hospital stay, high mortality rates, and economic loss.^3,4

Carbapenem resistance in Enterobacteriaceae can be due to a decrease in outer-membrane permeability coupled with high production of AmpC and/or extended-spectrum β-lactamases (ESBLs), or increased expression of efflux pumps. However, carbapenemase enzyme production is a more common mechanism and considered to be much more important from a public health perspective since the genes encoding these enzymes are located on transferable plasmids causing rapid spread of the resistance. It is also of concern that these plasmids may transport other resistance determinants, giving rise to multidrug resistance and even pandrug resistance. Therefore, rapid detection of carbapenemase-producing isolates is crucial for appropriate therapeutic management as well as preventing the spread of resistance by implementation of infection control measures.^5,6

Detection of carbapenemases in clinical laboratories is a challenging task. Molecular methods are usually considered the gold standard for identification of carbapenemases, but the high cost, possible requirement for expertise, and variety of target genes included limit their use.^3,7 Many phenotypic assays have been developed for rapid and affordable detection of carbapenemases based on inhibition of carbapenemases by specific inhibitors or detection of carbapenem hydrolysis by colorimetric assays (Carba NP tests and derivatives),^8,9 carbapenem inactivation method (CIM),¹⁰ matrix-assisted laser desorption/ionization mass spectrometry (MALDI-TOF MS),¹¹ or finally, immunochromatographic methods.¹² Among those phenotypic assays, two of them, Carba NP and CIM, have been included in the recommendations of current Clinical and Laboratory Standards Institute (CLSI) guideline.¹³ On the other hand, European Committee on Antimicrobial Susceptibility Testing (EUCAST) document suggests application of above-mentioned phenotypic methods for detection of carbapenemase production following reduced susceptibility to carbapenems in routine susceptibility tests.¹⁴ Recently, Pasteran et al.¹⁵ have described a simplified protocol of the Carba NP (named as Carba NP-direct) that allows direct use of colonies instead of bacterial extracts, which resulted in greater protocol simplicity and cost reduction per reaction with improved detection.

In our study, we investigated the diagnostic values of three phenotypic assays, Carba NP-direct, CIM, and β-CARBA test, to detect CPE isolates. To our knowledge, this is the fourth evaluation of CARBA NP-direct test in literature.

Materials and Methods

Bacterial isolates

A total of 125 isolates were included in the study. One hundred nine of them were clinical isolates (96 Klebsiella pneumoniae, 8 Escherichia coli, 3 Klebsiella oxytoca, and 2 Enterobacter cloacae) with decreased susceptibility or resistant to meropenem and/or ertapenem isolated between 2011 and 2017. One KPC-producing K. pneumoniae external quality control strain (College of American Pathologist) was incorporated as positive control. Fifteen carbapenem-susceptible ESBL-positive E. coli isolates (without carbapenemase genes) were used as negative controls.

Species identification and antimicrobial susceptibility testing

Species identification of the isolates was performed by MALDI-TOF MS (Bruker Daltonics, Germany). Antimicrobial susceptibility testing was performed by using BD Phoenix (BD, Sparks, ABD) and the results were interpreted according to the CLSI guideline for the years 2011–2015 and according to EUCAST criteria in the year 2016 and later (due to national switch to the EUCAST guideline).^13,16 Minimal inhibitory concentrations (MICs) of the isolates for meropenem, imipenem, and ertapenem were determined by the E-test (bioMeérieux, Marcy L'Etoile, France) on Mueller-Hinton (MH) agar (Becton Dickonson). We performed E-test according to manufacturer's recommendation.

Carba NP-direct test

Carba NP-direct test was performed using a modified procedure described previously with direct use of colonies instead of bacterial extracts.¹⁵ In brief, an indicator solution consisting of 0.05% phenol red with 0.1 mmol/L ZnSO4 and 0.1% (vol/vol) Triton X-100 (Merck) was prepared and pH was adjusted to 7.8. A 1-μL loop full of a fresh pure bacterial culture was directly suspended in 1.5-mL Eppendorf tubes containing 100 μL of indicator solution, supplemented with 12 mg/mL imipenem-cilastatin injectable form (Silanem; Koçak Farma, Turkey) (reaction tube) and without antibiotic (control tube). Tubes were vortexed and then incubated for 2 hr at 35°C, with a positive result interpreted as a color change from red to orange/yellow.

Carbapenem inactivation method

The CIM was performed as previously described¹⁰ on strains cultured on blood agar for 18–24 hr. Briefly, a 10 μg meropenem susceptibility disk (Oxoid Ltd.) was incubated for 2 hr in a suspension of the tested strain. A 0.5 McFarland suspension of E. coli ATCC 25922 was used to prepare a lawn culture on an MH agar plate (Becton Dickinson). The incubated meropenem disk was removed from the suspension, placed on the MH agar plate, and further incubated at 35°C in ambient air. Test results were evaluated after an overnight incubation. The absence of an inhibition zone was interpreted as the presence of carbapenemase activity due to enzymatic hydrolysis of meropenem, whereas a clear inhibition zone indicated the absence of carbapenemase activity.¹⁰ For negative results, tests were repeated by using modified CIM (mCIM), in which meropenem disks were incubated for 4 hr in trypticase soy broth with the test isolate.¹³

β-CARBA test

The commercially available β-CARBA test (Bio-Rad, Marne la Coquette, France) is similar in principle to the Carba NP test as it is also based on the color change of a chromogenic substrate in the presence of carbapenem-hydrolyzing enzymes. The test was performed according to the manufacturer's recommendations. Briefly, 1 μL loopful colony was resuspended in a reaction mixture and incubated at room temperature for 30 min. For negatives, incubation time prolonged to 60 min. A color change from yellow to orange, red, or purple was interpreted as a positive test result indicating the presence of carbapenem-hydrolyzing activity.

In-house multiplex PCR assay

An in-house multiplex PCR method, including bla_KPC, bla_NDM, bla_OXA-48, bla_IMP, and bla_VIM primers, was used to determine carbapenemase genes, as described by Doyle et al.¹⁷ Briefly, 2 μL of template DNA was added to PCR mixture (final volume 25 μL), and then amplified with the following PCR protocol: 95°C for 5 min; 35 cycles of 95°C for 45 sec, 60°C for 45 sec, and 72°C for 1 min; and 72°C for 8 min, on GeneAmp PCR System 9700 (Applied Biosystems) thermal cycler. PCR products were analyzed with agarose gel electrophoresis. The primers used are displayed in Table 1¹⁷.

Table 1.

Primers Used in the Amplification of Selected Genes

Gene	Size (bp)	Primer	Nucleotide sequence (5′-3′)
bla _KPC	900	F1	TGTCACTGTATCGCCGTC
bla _KPC	900	R1	CTCAGTGCTCTACAGAAAACC
bla _NDM	782	F2	GCAGCTTGTCGGCCATGCGGGC
bla _NDM	782	R2	GGTCGCGAAGCTGAGCACCGCAT
bla _IMP	587	F3	GAAGGCGTTTATGTTCATAC
bla _IMP	587	R3	GTACGTTTCAAGAGTGATGC
bla _OXA-48like	438	F4	GCGTGGTTAAGGATGAACAC
bla _OXA-48like	438	R4	CATCAAGTTCAACCCAACCG
bla _VIM	389	F5	GTTTGGTCGCATATCGCAAC
bla _VIM	389	R5	AATGCGCAGCACCAGGATAG

Statistical analysis

Statistical analyses were performed using SPSS Statistics for Windows^®, version 15.0 (SPSS, Inc., Chicago, IL). Descriptive statistics were given as number and percentage for categorical variables. Dependent group comparisons were performed by McNemar analysis. The sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and accuracy value of the tests were calculated using PCR as gold standard.

Results

The strain collection of CPEs included 89 OXA-48 (80 K. pneumoniae, six E. coli, and three K. oxytoca), two KPC (two K. pneumoniae), five NDM (four K. pneumoniae and one E. cloacae), two VIM (one K. pneumoniae and one E. coli), one IMP (K. pneumoniae), 10 OXA-48+NDM (eight K. pneumoniae, one E. coli, and one E. cloacae), and one OXA-48+VIM (K. pneumoniae) producer.

For the isolates tested, the results of Carba NP-direct, CIM, and β-CARBA tests and carbapenem MIC ranges are shown in Table 2. Of the 110 CPE isolates (including the positive control isolate), 100 were found to be positive by all three tests and 10 isolates showed discordant results. Carba NP-direct, CIM, and β-CARBA tests detected 109, 102, and 108 isolates as positive, respectively. Of the isolates detected with incompatible results, eight isolates were OXA-48-, one was an NDM-, and the remaining one was an OXA-48+NDM-type carbapenemase producer. For one OXA-48- and one OXA-48+NDM-producing isolate, color of the reaction tubes was difficult to interpret in the Carba NP-direct test. Tests were repeated for those isolates and interpreted as positive by consulting two other microbiologists who were blinded to the study. Five β-CARBA-negative isolates (all OXA-48) at the first half an hour were converted into positive at 60 min. Fifteen control isolates with no carbapenemase genes were negative for all three phenotypic tests. The sensitivity, specificity, PPV, and NPV of Carba NP-direct, CIM, and β-CARBA tests are shown in Table 3.

Table 2.

Results of Carbapenem Inactivation Method, CARBA NP and β-CARBA Tests for the Study Isolates (n = 125)

		MIC range (mg/L)			No. of isolates with a positive test/no. of isolates tested
Species	Carbapenemase	Ertapenem	Imipenem	Meropenem	Carba NP-direct	CIM	β-CARBA
Clinical isolates (109)
Klebsiella pneumoniae (80)	OXA-48	1 to >32	0.12 to >32	0.5 to >32	79/80	74/80	78/80
K. pneumoniae (8)	OXA-48+NDM	12 to >32	8 to >32	8 to >32	8/8	7/8	8/8
K. pneumoniae (4)	NDM	>32	>32	>32	4/4	3/4	4/4
K. pneumoniae (1)	KPC	>32	16	4	2/2	2/2	2/2
K. pneumoniae (1)	IMP	>32	8	4	1/1	1/1	1/1
K. pneumoniae (1)	VIM	>32	8	>32	1/1	1/1	1/1
K. pneumoniae (1)	OXA-48+VIM	>32	16	>32	1/1	1/1	1/1
Klebsiella oxytoca (3)	OXA-48	1–8	4–8	0.25–8	3/3	3/3	3/3
Escherichia coli (6)	OXA-48	1–3	2 to >32	0.5 to >32	6/6	6/6	6/6
E. coli (1)	OXA-48+NDM	1.5	4	2	1/1	1/1	1/1
E. coli (1)	VIM	4	8	1	1/1	1/1	1/1
Enterobacter cloacae (1)	NDM	8	32	16	1/1	1/1	1/1
E. cloacae (1)	OXA-48+NDM	>32	>32	>32	1/1	1/1	1/1
Positive control (1)
K. pneumoniae (1)	KPC	>32	>32	>32	1/1	1/1	1/1
Negative control (15)
E. coli (15)	Not detected	<0.25	<0.25–2	<0.125	0/15	0/15	0/15

CIM, carbapenem inactivation method; MIC, minimal inhibitory concentration.

Table 3.

Comparison of the Tests According to Gold Standard PCR

Test	Sensitivity	Specificity	PPV	NPV	Accuracy value
Carba NP-direct	99.0	100	100	93.7	99.2
CIM	92.7	100	100	65.2	93.6
β-CARBA 30 min	93.6	100	100	68.1	94.4
β-CARBA 60 min	98.1	100	100	88.2	98.4

NPV, negative predictive value.

Discussion

In the antibiotic resistance report of the United States Centers for Disease Control and Prevention (CDC) in 2013, carbapenem resistance was classified as an “immediate threat” in the most serious category and reported as a public health problem requiring urgent and aggressive action.⁴ Among carbapenem resistance mechanisms, carbapenemases, which have the ability to spread rapidly by mobile genetic elements, have become a global concern. In an extensive report on CPE epidemiology in Europe, Turkey has been identified as a country in which the OXA-48-type carbapenemases are endemic, NDM-1-type carbapenemases spread regionally, and VIM-type carbapenemases cause hospital outbreaks.¹

Molecular methods remain the gold standard in the identification of carbapenemase-producing strains and enzyme types. Clinically common carbapenemase genes can be easily detected by PCR.⁵ However, for reasons such as the high cost and the inability to detect new carbapenemase genes, various phenotypic methods have been developed. Two of them, which can be done with routine laboratory equipment (in-house), the Carba NP and mCIM, have been recently recommended by CLSI guidelines.¹³ In the detection of carbapenemase production by phenotypic methods, the type of enzyme, species of bacteria, the expression level of the gene encoding the enzyme, and the presence of other mechanisms other than carbapenemase production are complicating factors.^18,19

The Carba NP test is a simple and rapid test based on the demonstration of the pH change caused by the hydrolysis of the β-lactam ring in the presence of the carbapenemase enzyme by the color change in the phenol red indicator.^8,20 In studies conducted with Enterobacteriaceae, the specificity of the test was reported as 100% while the sensitivity varies between 87% and 100%.^8,20–25 However, there are studies that determine sensitivity below 80%.^26,27 False negativity has been reported to occur in OXA-48-like and non-KPC group A enzymes.^{7,23,26,28,29} CLSI guideline stated that the Carba NP test has over 90% sensitivity for detecting KPC, NDM, VIM, IMP, SPM, and SME, but has decreased sensitivity for OXA-48 (11%).¹³ However, the sensitivity of Carba NP test for OXA-48 strains was reported higher in the literature.^29,30 Pasteran et al.¹⁵ compared the Carba NP test issued by the CLSI and a novel and easier protocol, Carba NP-direct, designed for carbapenemase detection direct from bacterial cultures instead of bacterial extracts. In the study, the specificities were comparable (100%), but the Carba NP-direct was more sensitive (98% vs. 84%). We found Carba NP-direct test as the most sensitive (99.0%) test among the three tests evaluated. The test was able to successfully identify all OXA-48 isolates except one. The Carba NP-direct test has several advantages over Carba NP, including improved sensitivity, direct use of bacterial colonies, and the use of the cheaper chemical Triton X instead of the lysis solution. Furthermore, the use of an injectable form of imipenem/cilastatin instead of imipenem monohydrate powder provides cost savings as well as practicality.¹⁸

Carba NP test results may be affected by factors such as pH changes of the solution, the amount of inoculum, test duration, isolation medium, mucoid colony structure, and low enzyme activity (OXA-48 like).^26,30 Besides, the Carba NP test has challenges in interpretations due to indeterminate results (an orange color close to red).⁷ We experienced difficulties in interpreting results of Carba NP-direct test in two isolates, one OXA-48- and one OXA-48+NDM-type carbapenemase producer. Interpretation of indeterminate results often depends on the observer and necessitates confirmation by other phenotypic or genotypic methods.

Another test that has been included in the CLSI guideline in 2017 is the mCIM.^13,14 CIM is a phenotypic test based on inactivation of carbapenem and can be easily implemented in routine laboratory practices at a low cost, requiring no special equipment (pH meter, etc.) and solution (phenol red, ZnSO4, etc.). Contrary to the evaluation difficulties that can be experienced in colorimetric tests, observation of bacterial growth around the disc in this method facilitates interpretation.^7,23 Van der Zwaluw et al.,¹⁰ who developed the test, reported that the concordance with the molecular method was 100% in Enterobacteriaceae isolates and the results were obtained in 8 hr. In a study comparing CIM and Carba NP tests, sensitivity of both tests was found to be 92.1%; the CIM test missed three NDM-1 isolates and one VIM-1 isolate, and the Carba NP test missed five OXA-48-like isolates. While results were obtained within 2 hr by the Carba NP, an overnight incubation was required for the CIM test.³¹ Tijet et al.²³ reported that the sensitivity (98.8%) and NPV (99%) of the CIM test were higher than those of the Carba NP test (90.1% and 88.2%, respectively).

The sensitivity and specificity of the mCIM test in the CLSI guideline for detection of KPC-, NDM-, VIM-, IMP-, SPM-, SME-, and OXA-type carbapenemases are above 99%.¹³ In accordance with this, Aguirre-Quinonero et al.³² were able to detect all KPC-, NDM-, VIM-, IMP-, and OXA-48-producing isolates by the original method. However, 11 GES-6-producing isolates were false negative and one SHV-12 plus high-level AmpC-producing isolate was false positive, and the sensitivity and specificity of the test were determined as 85.7% and 95.7%, respectively. In our study, the CIM test performed well, although not as sensitive as stated in the guidelines and literature.^25,31 A recent study reported that by using mCIM, the sensitivity increased from 91% to 98% and the OXA-48 isolates were detected better without compromising from the specificity.⁷ So, we retested eight CIM-negative isolates (six OXA-48, one OXA-48+NDM, and one NDM) with the mCIM and three OXA-48 producer isolates yielded positive results. mCIM might be advantageous over the original CIM for routine laboratory practices where OXA-48 enzyme is highly prevalent. Moreover, our findings suggest that CIM-negative isolates should be retested by another phenotypic method, since seven CIM-negative isolates were detected as carbapenemase producer with both Carba NP-direct and β-CARBA tests. The CIM test should be evaluated after an overnight incubation as reported by the other investigators,^7,23,31 not at the eighth hour, as indicated in the reference study,¹⁰ which was considered a drawback of the test in terms of turnaround time.

In recent years, many commercial colorimetric tests based on the detection of carbapenem hydrolysis activity have been developed. β-CARBA is one of the most recently produced colorimetric tests, which is a derivative of Carba NP test. Sensitivity and specificity of β-CARBA have been reported between 85.1–98.7% and 92.7–99.9%, respectively, with a high performance in OXA-48 producers.^28,33 However, Mancini et al.⁹ have found that the β-CARBA had lower detection rates for OXA-48-like enzymes (OXA-162, OXA-181, OXA-204, and OXA-232) and was unable to detect non-KPC Class A carbapenemases, with an overall sensitivity of 64%. According to the manufacturer kit insert, β-CARBA test result should be read at 30 min. When we increased the incubation time to 60 min, we could detect five more OXA-48-like producers and the sensitivity increased remarkably (93.6% vs. 98.1%). Concordant with previous reports, we showed that the recommended incubation time by the manufacturer might be insufficient and prolongation of the incubation time could increase sensitivity of the β-CARBA test, especially for isolates having weak carbapenemase activity.^34,35

The low number of enzyme types other than OXA-48 like and NDM, and the absence of non-KPC group A enzymes with low carbapenemase activity can be regarded as limitations of our study. However, our data reflect the epidemiological status of our region, since our isolates are collections from a routine bacteriology laboratory. Besides, problems in the detection of OXA-48-like enzymes by phenotypic tests are frequently reported in the literature. The high number of OXA-48-producing isolates in the study collection can also be considered an advantage for comparing the performances of the tests. The absence of carbapenemase-negative carbapenem-resistant Enterobacteriaceae isolates in the control group is another limitation. However, those strains are very rare and hard to find.

Overall, the accuracy of carbapenemase detection varied across the three phenotypic tests evaluated in this study, mainly due to the difference in detection capability of the tests for OXA-48-like enzymes. The CIM was the least sensitive test for the detection of OXA-48-type producers. We also identified limited sensitivity of the CIM for detecting NDM compared to the Carba NP-direct and β-CARBA tests. On the other hand, we suggest that the CIM is the most practical assay to select since all the necessary supplies are readily available. Furthermore, interpreting the results of the CIM is clearer than colorimetric tests, as it is based on a defined zone diameter. The main limitation of the CIM is the time requirement since an overnight incubation is needed to obtain results. Combined use of Carba NP-direct and CIM will increase diagnostic sensitivity. The β-CARBA test is the most rapid method with a turnaround time of 30 min to 1 hr and is easy to perform with a quick setup that required relatively little hands-on time compared to the Carba NP-direct test that required an extemporaneous preparation of solutions and experienced personnel. However, β-CARBA test is more expensive than home-brewed tests. When selecting the most appropriate phenotypic test in a certain laboratory, the workload, common carbapenemase enzyme types in the region, cost-effectiveness, and the sensitivity and specificity of the tests with the local strains should be considered.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Albiger

, Glasner

, Struelens

M.J.

, Grundmann

, and Monnet

D.L.

. 2015. European Survey of Carbapenemase-Producing Enterobacteriaceae (EuSCAPE) working group. Carbapenemase-producing Enterobacteriaceae in Europe: assessment by national experts from 38 countries, May 2015. Euro. Surveill., 20:45.

Grundmann

, Glasner

, Albiger

, Aanensen

D.M.

, Tomlinson

C.T.

, Andrasević

A.T.

, Canton

, Carmeli

, Friedrich

A.W.

, Giske

C.G.

, Glupczynski

, Gniadkowski

, Livermore

D.M.

, Nordmann

, Poirel

, Rossolini

G.M.

, Seifert

, Vatopoulos

, Walsh

, Woodford

, Monnet

D.L.

, and European Survey of Carbapenemase-Producing Enterobacteriaceae (EuSCAPE) Working Group. 2017. Occurrence of carbapenemase-producing Klebsiella pneumoniae and Escherichia coli in the European Survey of Carbapenemase-Producing Enterobacteriaceae (EuSCAPE): a prospective, multinational study. Lancet Infect. Dis., 17:153–163.

Nordmann

, Naas

, and Poirel

. 2011. Global spread of Carbapenemase-producing Enterobacteriaceae. Emerg. Infect. Dis., 17:1791–1798.

Centers for Disease Control and Prevention.. 2013. Antibiotic resistance threats in the United States. Available at www.cdc.gov/drugresistance/threat-report-2013 (accessed September 21, 2017).

Nordmann

, and Poirel

. 2013. Strategies for identification of carbapenemase-producing Enterobacteriaceae. J. Antimicrob. Chemother., 68:487–489.

Nordmann

, and Poirel

. 2014. The difficult-to-control spread of carbapenemase producers among Enterobacteriaceae worldwide. Clin. Microbiol. Infect., 20:821–830.

Tamma

P.D.

, Opene

B.N.

, Gluck

, Chambers

K.K.

, Carroll

K.C.

, and Simner

P.J.

. 2017. Comparison of 11 phenotypic assays for accurate detection of carbapenemase-producing Enterobacteriaceae. J. Clin. Microbiol., 55:1046–1055.

Nordmann

, Poirel

, and Dortet

. 2012. Rapid detection of carbapenemase-producing Enterobacteriaceae. Emerg. Infect. Dis., 18:1503–1507.

Mancini

, Kieffer

, Poirel

, and Nordmann

. 2017. Evaluation of the RAPIDEC CARBA NP and β-CARBA tests for rapid detection of Carbapenemase-producing Enterobacteriaceae. Diagn. Microbiol. Infect. Dis., 88:293–297.

10.

van der Zwaluw

, de Haan

, Pluister

G.N.

, Bootsma

H.J.

, de Neeling

A.J.

, and Schouls

L.M.

. 2015. The carbapenem inactivation method (CIM), a simple and low-cost alternative for the Carba NP test to assess phenotypic carbapenemase activity in gram-negative rods. PLoS One, 10:e0123690.

11.

Lasserre

, De Saint Martin

, Cuzon

, Bogaerts

, Lamar

, Glupczynski

, Naas

, and Tandé

. 2015. Efficient detection of carbapenemase activity in Enterobacteriaceae by matrix-assisted laser desorption ionization-time of flight mass spectrometry in less than 30 minutes. J. Clin. Microbiol., 53:2163–2171.

12.

Wareham

D.W.

, and Abdul Momin

M.H.

. 2017. Rapid detection of carbapenemases in Enterobacteriaceae: evaluation of the resist-3 O.K.N. (OXA-48, KPC, NDM) lateral flow multiplexed assay. J. Clin. Microbiol., 55:1223–1225.

13.

Clinical and Laboratory Standards Institute.. 2017. Performance Standards for Antimicrobial Susceptibility Testing: 27th Informational Supplement. CLSI M100-S27. CLSI, Wayne, PA.

14.

The European Committee on Antimicrobial Susceptibility Testing.. 2017. EUCAST guideline for the detection of resistance mechanisms and specific resistances of clinical and/or epidemiological importance. July 2017 (v 2.0). Available at www.eucast.org/resistance_mechanisms

15.

Pasteran

, Tijet

, Melano

R.G.

, and Corso

. 2015. Simplified protocol for carba NP test for enhanced detection of carbapenemase producers directly from bacterial cultures. J. Clin. Microbiol., 53:3908–3911.

16.

The European Committee on Antimicrobial Susceptibility Testing.. 2017. Breakpoint tables for interpretation of MICs and zone diameters. Version 7.1. Available at www.eucast.org/clinical_breakpoints (accessed October 15, 2017).

17.

Doyle

, Peirano

, Lascols

, Lloyd

, Church

D.L.

, and Pitout

J.D.

. 2012. Laboratory detection of Enterobacteriaceae that produce carbapenemases. J. Clin. Microbiol., 50:3877–1380.

18.

Aguirre-Quiñonero

, and Martínez-Martínez

. 2017. Non-molecular detection of carbapenemases in Enterobacteriaceae clinical isolates. J. Infect. Chemother., 23:1–11.

19.

Voulgari

, Poulou

, Koumaki

, and Tsakris

. 2013. Carbapenemase-producing Enterobacteriaceae: now that the storm is finally here, how will timely detection help us fight back? Future Microbiol., 8:27–39.

20.

Dortet

, Bréchard

, Cuzon

, Poirel

, and Nordmann

. 2014. Strategy for rapid detection of carbapenemase-producing Enterobacteriaceae. Antimicrob. Agents Chemother., 58:2441–2445.

21.

Yamada

, Kashiwa

, Arai

, Nagano

, and Saito

. 2016. Comparison of the Modified-Hodge test, Carba NP test, and carbapenem inactivation method as screening methods for carbapenemase-producing Enterobacteriaceae. J. Microbiol. Methods, 128:48–51.

22.

Dortet

, Agathine

, Naas

, Cuzon

, Poirel

, and Nordmann

. 2015. Evaluation of the RAPIDEC^® CARBA NP, the Rapid CARB Screen^® and the Carba NP test for biochemical detection of carbapenemase-producing Enterobacteriaceae. J. Antimicrob. Chemother., 70:3014–3022.

23.

Tijet

, Patel

S.N.

, and Melano

R.G.

. 2016. Detection of carbapenemase activity in Enterobacteriaceae: comparison of the carbapenem inactivation method versus the Carba NP test. J. Antimicrob. Chemother., 71:274–276.

24.

Dortet

, Bréchard

, Poirel

, and Nordmann

. 2014. Rapid detection of carbapenemase-producing Enterobacteriaceae from blood cultures. Clin. Microbiol. Infect., 20:340–344.

25.

Bayramoğlu

, Uluçam

, Gençoğlu Özgür

Ç.

, Kılıç

A.O.

, and Aydın

. 2016. Comparison of the modified Hodge test and the Carba NP test for detection of carbapenemases in Enterobacteriaceae isolates. Mikrobiyol. Bul., 50:1–10.

26.

Tijet

, Boyd

, Patel

S.N.

, Mulvey

M.R.

, and Melano

R.G.

. 2013. Evaluation of the Carba test for rapid detection of carbapenemase-producing NP Enterobacteriaceae and Pseudomonas aeruginosa. Antimicrob. Agents Chemother., 57:4578–4580.

27.

Mitra

, Kazi

, Panchal

, Rodriguez

, and Shetty

. 2015. Evaluation of Carba NP test for rapid detection of carbapenemase producing Enterobacteriaceae. Indian J. Med. Microbiol., 33:603–606.

28.

Bernabeu

, Dortet

, and Naas

. 2017. Evaluation of the β-CARBA™ test, a colorimetric test for the rapid detection of carbapenemase activity in Gram-negative bacilli. J. Antimicrob. Chemother., 72:1646–1658.

29.

Pragasam

A.K.

, Sahni

R.D.

, Anandan

, Sharma

, Gopi

, Hadibasha

, Gunasekaran

, and Veeraraghavan

. 2016. A pilot study on carbapenemase detection: do we see the same level of agreement as with the CLSI observations. J. Clin. Diagn. Res., 10:DC09–DC13.

30.

Dortet

, Bréchard

, Poirel

, and Nordmann

. 2014. Impact of the isolation medium for detection of carbapenemase-producing Enterobacteriaceae using an updated version of the Carba NP test. J. Med. Microbiol., 63:772–776

31.

Gauthier

, Bonnin

R.A.

, Dortet

, and Naas

. 2017. Retrospective and prospective evaluation of the Carbapenem inactivation method for the detection of carbapenemase-producing Enterobacteriaceae. PLoS One., 12:e0170769.

32.

Aguirre-Quiñonero

, Cano

M.E.

, Gamal

, Calvo

, and Martínez-Martínez

. 2017. Evaluation of the carbapenem inactivation method (CIM) for detecting carbapenemase activity in enterobacteria. Diagn. Microbiol. Infect. Dis., 88:214–218.

33.

Noël

, Huang

T.D.

, Berhin

, Hoebeke

, Bouchahrouf

, Yunus

, Bogaerts

, and Glupczynski

. 2017. Comparative evaluation of four phenotypic tests for detection of carbapenemase-producing gram-negative bacteria. J. Clin. Microbiol., 55:510–518.

34.

Compain

, Gallah

, Eckert

, Arlet

, Ramahefasolo

, Decré

, Lavollay

, and Podglajen

. 2016. Assessment of carbapenem resistance in Enterobacteriaceae with the rapid and easy-to-use chromogenic β carba test. J. Clin. Microbiol., 54:3065–3068.

35.

Dortet

, and Naas

. 2017. Noncarbapenemase OXA-48 variants (OXA-163 and OXA-405) falsely detected as carbapenemases by the β carba test. J. Clin. Microbiol., 55:654–655.