Heterogeneity of Highly Susceptible Yersinia enterocolitica Isolates of Clinical and Environmental Origin: A 5-Year Survey from Iran (2011

Abstract

The aim of this study was to evaluate the resistance and virulence characteristics of Yersinia enterocolitica strains of clinical and environmental origins over a 5-year period in Iran and to determine the genetic diversity of strains using pulsed-field gel electrophoresis (PFGE) method. A total of 20 Y. enterocolitica strains were collected from 850 stool samples of patients with diarrhea, and 18 Yersinia spp. including 10 Y. enterocolitica were collected from water, food, and vegetable samples. The most frequently isolated Y. enterocolitica strains belonged to biotype (BT) 1A (83.33%). No Y. enterocolitica BT4 was detected that can be attributed to the absence of pig animal reservoir in Iranian food chain. The most frequent chromosomal virulence genes among the Y. enterocolitica isolates were inv (100%), ystA (67%), ystB (83%), tccC (20%), and ail (17%). The most frequent chromosomal virulence genes among non-enterocolitica Yersinia spp. isolates were ystB (87.5%), ystA (37.5%), and inv (37.5%). None of the Y. enterocolitica isolates harbored plasmid origin virulence genes. None of the isolates was resistant to ciprofloxacin, gentamicin, tetracycline, cotrimoxazole, and chloramphenicol, whereas 90% of the Y. enterocolitica and 62.5% of the Yersinia spp. strains were resistant to ampicillin. PFGE genotyping showed a heterogeneous population of highly susceptible Yersinia spp. in both clinical and environmental samples, putting forward a good prognosis in the treatment of patients with yersiniosis. The occurrence of biotype 1A with inv⁺ystA⁺ystB⁺ genotype in clinical strains implies the significance of inv, ystA, and ystB gene products in turning of naturally nonpathogenic biotype 1A strains into clinically important pathogens.

Introduction

The genus Yersinia belonging to the family Enterobacteriaceae consists of 18 species, only 3 of which are pathogenic for humans and animals, including Yersinia pestis (the causative agent of bubonic and pneumonic plague), Yersinia enterocolitica, and Yersinia pseudotuberculosis (enteropathogenic bacteria). Y. enterocolitica as an important food- and waterborne human enteropathogen is mainly associated with gastroenteritis, although more severe clinical manifestations such as peritonitis, ileitis, and pseudoappendicitis and several fatalities have been observed and reported in children.^1–4

It is believed that in regions with cold climate as in some European countries, Y. enterocolitica is an important cause of diarrhea; however, in some studies it has been rarely reported from stool of diarrheal patients in Iran.⁵

Although Yersinia is rarely isolated, it is usually resistant to penicillin, erythromycin, amoxicillin, and the first/second generations of cephalosporins because of the expanded beta lactamases synthesizing by this organism. In systemic and gastrointestinal infections and enterocolitis in patients with weakened immune system, patients should be given antimicrobial therapy, in most of whom, the drug of choice is cotrimoxazole. However, an antibiotic susceptibility testing is recommended in human yersiniosis. Moreover, gentamicin, chloramphenicol, and streptomycin are also used in more complicated cases.

The virulence plasmid (pYV) and the chromosomal ail and ystA genes are mainly found in pathogenic strains belonging to biotypes (BTs) 1B and 2–5. Because the strains belonging to biotype 1A do not usually carry the virulence plasmid (pYV) and lack the important chromosomal virulence genes, they are considered as nonpathogenic; however, Y. enterocolitica biotype 1A strains are isolated from a variety of sources such as environment, foods, animals, and human with yersiniosis and >80% of strains of this biotype carry the ystB gene.^6–8 The ail (attachment invasion locus) and inv (invasion) genes are the two chromosomal factors required for the adhesion and invasion, as the two first steps of infection.⁹ It seems that all Y. enterocolitica isolates harbor inv gene, but ail (attachment invasion locus) gene is only found in strains associated with human infection and is described as a target for virulence screening.¹⁰ Biotype 1A strains typically lack ail and only occasionally harbor virulence-associated genes.⁸ The occurrence of virulence genes is controversial in different studies, and more devastating is the fact that no data are available on virulence potential and genotypes of Yersinia spp. in Iran.

The aim of this study was to evaluate the resistance and virulence potential of Y. enterocolitica strains isolated from clinical and environmental origin in Iran and to determine the genetic diversity of strains using pulsed-field gel electrophoresis (PFGE), as a gold standard of molecular typing method.¹¹

Materials and Methods

Sample collection and Yersinia species identification

A total of 850 samples were collected from patients with diarrhea, who referred to Referral Yersiniology Laboratory (School of Public Health, Tehran University of Medical Sciences, Tehran, Iran) from different provinces of Iran during 2011–2016. In this study, diagnostic criteria for infective enteritis caused by Y. enterocolitica were watery mucoid diarrhea (three times bowel movement/day), fever, colicky abdominal pain, bloody stool, and white blood cells in the stool (≥41 white blood cells per high-power field). However, these criteria are common in a majority of infective enteritis diagnosis. As Y. enterocolitica penetrates the mucosa and invades the reticuloendothelial system, fecal mononuclear leukocytes are considered as the key manifestations helping exclude diarrhea with other causes and selectively include patients with probable Y. enterocolitica enteritis.¹²

Of each fecal sample, 2 g was suspended in 10 mL of phosphate-buffered saline (PBS) (pH 7.2), vortexed for 30 sec, and subjected to cold enrichment by incubating at 4°C for 21 days. A unit volume of each sample was added to 9 mL of PBS (pH 7.2), mixed thoroughly, and followed by cold enrichment process.

After cold enrichment, a loopful of each sample was streaked on cefsulodin–irgasan–novobiocin (CIN) agar (Yersinia-selective agar base; Merck). Inoculated plates were incubated at 25°C for 24–48 hr. All suspected colonies on CIN agar were subjected to identification by API 20E (BioMerieux, France).

Environmental samples were collected from fresh water of Kan and Jajrood rivers in Tehran (n = 11), lettuce and parsley vegetables (n = 4), and food (n = 3) during the same period.

Biotyping of Y. enterocolitica strains isolated from human and environmental samples

All the isolates were subjected to specific biochemical tests to assign the biotypes. Biochemical tests used in this study were as follows: salicin (acid production in 24 hr), esculin, xylose, trehalose (acid production), indole production, ornithine decarboxylase, inositol (acid production), sorbose (acid production), pyrazinamidase, and lipase activity.¹³

Molecular confirmation of Y. enterocolitica isolates

The identity of Y. enterocolitica isolates was confirmed by PCR amplification of a fragment of 16srRNA gene, which was known to be specific for this species, using primers introduced elsewhere.¹⁴ In accordance, genomic DNA was isolated with PrimePrep Genomic DNA extraction kit (Genetbio, Gobiz, Korea) according to the manufacturer's instructions. PCR amplification was carried out with 12.5 μL reaction mixtures containing 1 μL of DNA template, 4.2 μL of H₂O, 6.3 μL of PCR-Mix (Ampliqon), and 0.5 μL of each primer (0.01 nM). The PCR was run under the cycling conditions started with a denaturation step at 94°C for 5 min, followed by 36 subsequent cycles consisting of heat denaturation at 94°C for 45 sec, primer annealing at 62°C for 45 sec, extension at 72°C for 45 sec, and a final extension step at 72°C for 7 min.^9,15 After the staining of PCR products with Gel Red, electrophoresis on 1% agarose gel and visualization under the ultraviolet (UV) light were performed.

Antimicrobial susceptibility testing

Based on the CLSI recommendations, antimicrobial susceptibility testing was carried out using Kirby–Bauer disk diffusion method (CLSI, 2011).¹⁶ The sensitivity profile of each isolate was performed against seven antibiotics, including ciprofloxacin (10 μg), gentamicin (10 μg), tetracycline (25 μg), ampicillin (25 μg), cotrimoxazole (25 μg), and chloramphenicol (30 μg) using the standard disk diffusion method.

Virulotyping

Seven virulence-associated genes including, inv, ail, virF, yadA, tccC, ystA, and ystB were investigated using primers specifically chosen to amplify within the conserved region of each gene (Table 1).

Table 1.

Primers Used in This Study

Primer name	Primer sequence (5′ to 3′)	Amplicon size (bp)	Annealing °C	Location	References
inv-F	CTGTGGGGAGAGTGGGGAAGTTTGG	570	60	Chromosome	³⁷
inv-R	GAACTGCTTGAATCCCTGAAAACCG		60	Chromosome	³⁷
ail-F	ACTCGATGATAACTGGGGAG	170	52	Chromosome	³⁸
ail-R	CCCCCAGTAATCCATAAAGG	170	52	Chromosome	³⁸
yadA-F	CAGTATTGACCAAAACCAGGC	315	50	Plasmid	³⁹
yadA-R	TGTCGAGGTTACAAGTC	315	50	Plasmid	³⁹
virF-F	TCATGGCAGAACAGCAGTCAG	591	52	Plasmid	³⁸
virF-R	ACTCATCTTACCATTAAGAAG	591	52	Plasmid	³⁸
ystA-F	AATGCTGTCTTCATTTGGAGC	145	53	Chromosome	¹⁶
ystA-R	ATCCCAATCACTACTGACTTC	145	53	Chromosome	¹⁶
ystB-F	TGTCAGCATTTATTCTCAACT	180	52	Chromosome	⁴⁰
ystB-R	GCCGATAATGTATCATCAAG	180	52	Chromosome	⁴⁰
tccC-F	GGGCAAAAAATGCGTGAAGAGAG	1,035	56	Chromosome	³⁸
tccC-R	TTTACCGGAATAACGCACAGTTTTA	1,035	56	Chromosome	³⁸

Pulsed-field gel electrophoresis

PFGE method was carried out according to the protocol recommended by PulseNet for Y. pestis.¹⁷ The cell suspension of the isolates was prepared using the cell suspension buffer (100 mM Tris; 100 mM ethylenediaminetetraacetic acid [EDTA]; pH 8.0). The agarose plugs were also made using 400 μL of 1% SeaKem Gold (Lonza, Rockland, ME) and 1% sodium dodecyl sulfate agarose. Cell lysis buffer (CLB; 50 mM Tris; 50 mM EDTA; pH 8.0 + sarcosil 1%) and 25 μL of proteinase K (20 mg/mL stock) were used for the lysis of the cells. After this step, the plugs were washed using the sterile ultrapure water and TE buffer (10 mM Tris; 1 mM EDTA; pH 8.0). For the restriction digestion step, the plugs were digested with 10 U/μL Xba1 (Fermentas, Glen Burnie, MD), the electrophoresis system was CHEF-DR III (Bio-Rad, Hercules, CA). The gel was stained with ethidium bromide solution (0.5 μg/mL), and the band pattern was observed by UV light. The molecular weight standard used was Salmonella choleraesuis serovar Braenderup H9812. Data analysis was performed using Gel Compare II software version 6.5 (Applied Math, Austin, TX).

Results

Isolation, identification, and confirmation of Y. enterocolitica isolates

A total of 20 Y. enterocolitica strains were collected from 850 stool samples, identified by biochemical tests, and confirmed by molecular method. Eighteen Yersinia spp. were collected from water, food, and vegetable samples, among which 10 isolates were identified as Y. enterocolitica, and the remaining ones belonged to other species, including 4 Yersinia intermedia, 3 Yersinia kristensenii, and 1 Yersinia frederiksenii.

Biotyping and virulotyping

The most frequent biotype of Y. enterocolitica strains belonged to biotype 1A with the occurrence of 25 of 30 (83.33%). Other biotypes included 1B (1 of 30), 2 (2 of 30), and 3 (2 of 30). All environmentally isolated Y. enterocolitica isolates belonged to biotype 1A.

Table 2 gives data on the frequency of virulence factors in Y. enterocolitica isolates with different biotypes and other Yersinia spp. isolates.

Table 2.

Frequency of the Virulence Markers (inv, ail, ystA, ystB, TccC, VirF and yadA Genes) in 38 Yersinia spp. Isolated from Different Origins

Species and biotypes (No. of isolates)	No. of isolates with chromosomal gene
Species and biotypes (No. of isolates)	inv	ail	ystA	ystB	tccC
Yersinia enterocolitica (n = 30)
1A (25)	25	0	16	21	4
1B (1)	1	1	0	1	0
2 (2)	2	2	2	2	1
3 (2)	2	2	2	1	1
Total (%)	30/30 (100)	5/30 (17)	20/30 (67)	25/30 (83)	6/30 (20)
Nonpathogenic Yersinia spp. (n = 8)
Yersinia intermedia (4)	3	0	3	3	0
Yersinia kristensenii (3)	0	0	0	3	0
Yersinia frederiksenii (1)	0	0	0	1	0
Total (%)	3/8 (37.5)	0/8 (0)	3/8 (37.5)	7/8 (87.5)	0/8 (0)

The most frequent chromosomal virulence genes among the Y. enterocolitica isolates were as follows: inv (30 of 30, 100%), ystA (20 of 30, 67%), tccC (6 of 30, 20%), ystB (25 of 30, 83%), and ail (5 of 30, 17%). Moreover, none of the Y. enterocolitica isolates harbored plasmid origin virulence genes.

The most frequent chromosomal virulence genes among the non-enterocolitica Yersinia spp. isolates were ystB (7 of 8, 87.5%), ystA (3 of 8, 37.5%), and inv (3 of 8, 37.5%). Other chromosomal virulence genes or plasmid-encoded virulence genes were absent from the non-enterocolitica Yersinia spp. strains (Table 2).

Antimicrobial susceptibility of Y. enterocolitica isolates

None of the isolates were resistant to ciprofloxacin, gentamicin, tetracycline, cotrimoxazole, and chloramphenicol, whereas 5 cases (62.5%) of Yersinia spp. and 27 cases (90%) of Y. enterocolitica isolates were resistant to ampicillin.

PFGE genotyping

The PFGE dendrogram allowed the grouping of the isolates with ≥70% similarity. It consisted of 30 pulsotypes (A to AF) and identified 2 common types of A and AF with 3 and 7 members, respectively, all of which fulfilled the criteria of biotype 1A. No common pulsotype was identified in clinical and environmental origin isolates. Twenty-eight single pulsotypes were also identified, containing the isolates of all isolation sources. The Y. enterocolitica isolates from human and fresh water sources with biotype 1A were dispersed throughout the dendrogram (Fig. 1).

FIG. 1.

UPGMA dendrogram generated according to PFGE analysis of Y. enterocolitica isolates by XbaI restriction enzyme in relation to species, biotype, source/place/year of isolation and virulence gene content of isolates. PFGE, pulsed field gel electrophoresis; UPGMA, unweighted pair group method with arithmetic.

Discussion

Surface waters, vegetables, foods, and human feces are considered as the main sources of Y. enterocolitica.¹⁸ The clinical significance of Y. enterocolitica has been reported to be <1% up to 22% in different countries including Iran.^16,19–21

The most frequent biotype of clinically isolated Y. enterocolitica strains in this study belonged to biotype 1A (15 of 20, 75%), whereas all environmentally isolated Y. enterocolitica strains showed this biotype properties. biotype 1A isolates have widely been reported from environments, foods, and animal samples.²² In Finland and Switzerland, biotype 1A isolates were reported to be commonly found in the feces of diarrheic humans.^23,24 In a study conducted in Switzerland (2011), 26 Y. enterocolitica strains were assigned to biotype 1A, which were frequently isolated from the clinical fecal samples of Swiss patients with diarrhea during the past decade.^6,23

In an Iranian study in 2012, 65 Y. enterocolitica isolates were isolated from 300 fresh raw chicken meat specimens randomly collected from chicken shops in Shahrekord city in which, 1A comprised the most common biotype (35.38%). Other common biotypes included 1B, 2, 3, and 4.²⁵

Untreated drinking water is known to be one of the main reservoirs for nonpathogenic Y. enterocolitica; however, pathogenic Y. enterocolitica in environment and untreated drinking water have been reported to be risk factors for sporadic Y. enterocolitica infections.²⁶

In this study, it was determined that 82% of isolates from Tehran fresh water sources belonged to Y. enterocolitica biotype 1A. Moreover, inv, ystA, and ystB genes were present in the majority of Y. enterocolitica biotype 1A isolates from Tehran fresh water, indicating the probable contamination of water with human fecal and/or the possible contribution of untreated water in human infection.

In a study by Falcão et al. in Brazil, 67 Y. enterocolitica strains isolated from untreated water were investigated. It was shown that 38 strains possessed inv, ail, and ystA genes, consistent with the finding of this study.²⁷

In this study, all Yersinia strains isolated from food samples belonged to nonpathogenic Yersinia species. Moreover, only one (25%) of four Yersinia strains from vegetable samples was identified as Y. enterocolitica biotype 1A, in which no virulence gene was detected. Therefore, it can be concluded that pathogenic Y. enterocolitica are more commonly transmitted through contaminated fresh water than vegetables or foods, although the potential role of food or vegetables as the impending sources of human yersiniosis should not be ignored.²⁸

No Y. enterocolitica BT4 was detected in this study, in neither clinical nor environmental isolates. In a study conducted in 2004, a strong correlation between BT4 infection and the consumption of pork meat as the main reservoir of this biotype was identified.²⁹ As breeding and the use of pork meat is limited in Iran, the absence of this biotype in this study can be attributed to the absence of this animal.

In a study conducted on chicken meat in Shahrekord during 2013 and 2014, the prevalence of biotype 4 was reported to be 17% and 6%, respectively.^25,30 In another study performed on pasteurized milk in Tabriz in 2011, 100% of Yersinia isolates belonged to biotype 4.³¹ Both these studies are controversial with observations from this study. Different types of environmental samples, seasonality of sample collection in each study, and different procedures used for specimen processing and isolation of Yersinia isolates can be the causes of variability in the reported BT4 isolation rate.

In this study, the prevalence of biotypes 2 and 3 among the clinically isolated Y. enterocolitica was 10% for each, whereas the frequency of these biotypes in the studies conducted on clinical samples in Switzerland (2009), Finland (2009), and Germany (2003) was reported to be 11%, 17% and 39%, respectively, consistent with the results of this study.^19,24,31

No biotypes 2, 3, and 4 were found in our environmental samples, whereas these biotypes were isolated (6–53%) in the previous studies conducted on chicken and milk in Iran.^20,25,30

The frequency of biotype 1B in clinical samples was 5% (1 of 20), whereas it was absent in the environmental samples under study which is consistent with the studies conducted on human cases in Switzerland (2003, 2011) and Germany (2009), showing the low frequency of aforementioned biotype around the world.^6,19,31

Drug susceptibility testing is important for physicians to be able to choose the best antibiotics for patient treatment. None of the isolates under study were resistant to ciprofloxacin, gentamicin, tetracycline, cotrimoxazole, and chloramphenicol, whereas 27 of 30 Y. enterocolitica isolates (90%) and 5 of 8 Yersinia spp. isolates (62.5%) showed resistance to ampicillin.

In a Chinese study (2008), antimicrobial susceptibility testing was performed for a total of 160 Y. enterocolitica virulent isolates, showing resistance to cotrimoxazole (99%), gentamicin (99%), and ciprofloxacin (99%). In parallel to this study, they detected high level of ampicillin resistance (96%), and no multiple drug-resistant strain was found among the 160 Y. enterocolitica isolates.³²

In a Nigerian study (2002), 47 of 215 patients (21.9%) were positive for Y. enterocolitica, and none of the isolates were resistant to ciprofloxacin, gentamicin, and tetracycline, whereas all of them were resistant to amoxicillin.²¹ Their results are in line with this study, depicting highly susceptible Y. enterocolitica strains of clinical origin, ignoring drugs of beta lactam group.

Antimicrobial susceptibility testing provided a good prognosis for the treatment of yersiniosis using phenicols, aminoglycosides, fluoroquinolones, trimethoprim–sulfamethoxazole, and tetracycline. Therefore, clinicians can choose the antibiotics listed previously and adjust the antibiotic treatment by referring to the susceptibility test results when yersiniosis is identified.

In this study, inv gene was found in 100% of the Y. enterocolitica and 37.5% (3 of 8) of the Yersinia spp. isolates, but ail gene was only found in 17% (5 of 30) of the Y. enterocolitica isolates (BT1B:1, BT2:2, BT3:2). and none of the non-enterocolitica Yersinia spp. and Y. enterocolitica BT1A isolates, consistent with the study by Wannet et al., in which inv gene was present in virulent and nonvirulent Y. enterocolitica strains, whereas the ail gene was found only in pathogenic serotypes of Y. enterocolitica,⁹ both of which are required for the first step of infection.

The occurrence of virulence genes did not differ significantly among the clinical and nonclinical biotype 1A strains,^19,29 except for the insecticidal toxin complex (tc) genes that have recently been reported to be predominantly associated with clinical strains.³³ Moreover, in this study, tccC gene was only found in 4 isolates of biotype 1A, 1 isolate of biotype 2, and 1 isolate of biotype 3, all of clinical origin, consistent with previous studies.

The ystA gene was found in 68% (20 of 30) of the Y. enterocolitica and 37.5% (3 of 8) of the Yersinia spp. isolates. Pathogenic strains of Y. enterocolitica (BT1B, BT2, BT3, BT4, BT5) produce the thermostable enterotoxin YstA (ystA gene), which, sporadically, may also be produced by nonpathogenic Y. intermedia and Y. enterocolitica biotype 1A strains.^19,34,35

The ystA gene was present in 64% (16 of 25) of the nonpathogenic biotype 1A isolates; these strains were of clinical and nonclinical origin, and their virulence potential can be attributed to the presence of this gene. Moreover, some of the environmental strains of Y. intermedia harbored ystA gene, this finding was also reported in another study by Singh and Virdi who showed the presence of this gene in 26% of their studied Y. intermedia strains (2003).³⁴

None of the yadA and virF genes were identified in Y. enterocolitica and Yersinia spp. isolates. Considering the plasmid origin of these genes, it can be concluded that none of the Yersinia isolates under study harbored the pYV plasmid encoding type III secretion-translocation machinery that enables Y. enterocolitica to be multiplied in lymphatic tissues and to defeat the host primary immune defenses. Previous reports on Y. enterocolitica pathogenesis showed that the bacteria harboring pYV plasmid are resistant to phagocytosis using Polymorphonuclear macrophages in vitro.^36–38

The biotype 1A strains had greater diversity in their fingerprints and were spread within other clusters. This diversity may be related to the different serotypes of this biotype.^7,39

Unweighted pair group method with arithmetic analysis with Gel Compare II software clustered Yersinia spp. isolates into 28 single and 2 common pulsotypes. Seven clonal Y. enterocolitica isolates assigned to PT-AF pulsotype were isolated from water sources; they uniformly belonged to biotype 1A and harbored ystA, ystB, and inv genes involved in Yersinia pathogenesis. Two nonclonal water-origin Y. enterocolitica isolates were also of biotype 1A properties and harbored inv, ystA, and ystB genes.

This proposes ystA⁺inv⁺ystB⁺ genotype of environmental Y. enterocolitica. biotype 1A strains as the potential pathogens. Moreover, three clinical isolates of human origin belonged to PT-A common pulsotype and biotype 1A, two of which were inv⁺ystA⁺ystB⁺tccC⁺, and the third one had inv⁺ystA⁺ystB⁺ genotype. Besides, ystB and ystA genes were present (alone or in combination) in 80% and 55%, respectively, of clinical isolates proposing the significance of their products in bacterial pathogenesis in human. The occurrence of ystB⁺ and/or ystA⁺ biotype 1A strains in majority of human origin isolates implies the impact of inv, ystB, and ystA gene products in turning biotype 1A strains into clinically important pathogenic strains.

The remaining 28 isolates from food, human, water, and vegetable origin belonged to single pulsotypes and showed discrepancies in species, biotype, source of isolation, and virulence gene content.

Conclusion

In conclusion, (1) the most frequent biotype of clinically and environmentally isolated Y. enterocolitica strains belonged to biotype 1A, (2) the occurrence of biotype 1A with ystA⁺inv⁺ ystB⁺genotype in human origin specimens implies the significance of inv, ystA, and ystB gene products in turning naturally nonpathogenic biotype 1A strains into clinically important pathogenic strains, (3) the presence of Y. enterocolitica isolates in water sources, belonging to biotype 1A with ystA⁺inv⁺ystB⁺ genotype indicates the probable contamination of water with human fecal and/or the possible contribution of untreated water in human infection, (4) no common pulsotype was found in clinically and environmentally isolated strains, indicating that circulation of bacteria in environment causes fundamental genetic events in Y. enterocolitica genome, resulting in different pulsotypes.

Footnotes

Acknowledgments

The authors thank the Research Council of Tarbiat Modares University for supporting the project. This article was a part of a research project approved by the Food Microbiology Research Center, Tehran University of Medical Sciences, Tehran, Iran, research contract No. 28446.

Authors' Contributions

P.K. carried out the molecular test and drafted the manuscript. B.B. conceived the study, participated in the study design, and performed the analyses. S.N. participated in the study design and helped draft the article. M.S. provided the specimens and related epidemiological data, and helped draft the article. All authors read and approved the final version of the article.

Ethics Approval and Consent to Participate

This study was reviewed and approved by Medical Ethics Committee of Tarbiat Modares University before it began (Ethical Approve Code: IR.MODARES.REC.1395.345). The participants provided their written informed consent to participate in this study.

Availability of Data and Material

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Disclosure Statement

No competing financial interests exist.

References

Bottone

E.J.

, and Mollaret

H.-H.

. 1977. Yersinia enterocolitica: a panoramic view of a charismatic microorganism. CRC Crit. Rev. Microbiol. 5:211–241.

McCarthy

, and Fenwick

. 1990. Experiences with the diagnosis of Yersinia enterocolitica—an emerging gastrointestinal pathogen in the Auckland area 1987–1989. N.Z. J. Med. Lab. Sci. 45:19–22.

Hurst

M.R.

, Becher

S.A.

, Young

S.D.

, Nelson

T.L.

, and Glare

T.R.

. 2011. Yersinia entomophaga sp. nov., isolated from the New Zealand grass grub Costelytra zealandica. Int. J. Syst. Evol. Microbiol. 61:844–849.

Bancerz-Kisiel

, Pieczywek

, Łada

, and Szweda

W.J.G.

. 2018. The most important virulence markers of Yersinia enterocolitica and their role during infection. Genes (Basel), 9:235.

Soltan Dallal

, and Moezardalan

. 2004. Frequency of Yersinia species infection in paediatric acute diarrhoea in Tehran. East. Mediterr. Health J. 10:152–158.

Stephan

, Joutsen

, Hofer

, Säde

, Björkroth

, Ziegler

, and Fredriksson-Ahomaa

. 2013. Characteristics of Yersinia enterocolitica biotype 1A strains isolated from patients and asymptomatic carriers. Eur. J. Clin. Microbiol. Infect. Dis. 32:869–875.

Falcao

J.P.

, Falcao

D.P.

, Pitondo-Silva

, Malaspina

A.C.

, and Brocchi

. 2006. Molecular typing and virulence markers of Yersinia enterocolitica strains from human, animal and food origins isolated between 1968 and 2000 in Brazil. J. Med. Microbiol. 55:1539–1548.

Tennant

S.M.

, Grant

T.H.

, Robins-Browne

R.M.

. 2003. Pathogenicity of Yersinia enterocolitica biotype 1A. FEMS Immunol. Med. Microbiol. 38:127–137.

Wannet

W.J.

, Reessink

, Brunings

H.A.

, and Maas

H.M.

. 2001. Detection of pathogenic Yersinia enterocolitica by a rapid and sensitive duplex PCR assay. J. Clin. Microbiol. 39:4483–4486.

10.

Miller

V.L.

, Farmer

, Hill

, and Falkow

. 1989. The ail locus is found uniquely in Yersinia enterocolitica serotypes commonly associated with disease. Infect. Immun. 57:121–131.

11.

Magalhães

V.D.

, Ferreira

J.C.

, Barelli

, and Darini

A.L.C.

. 2005. Pulsed field gel electrophoresis use in bacteriology: a technical review. Rev. Inst. Adolfo Lutz (Impresso), 64:155–161.

12.

Vantrappen

, Ponette

, Geboes

, and Bertrand

P.J.G.

. 1977. Yersinia enteritis and enterocolitis: gastroenterological aspects. Gastroenterology, 72:220–227.

13.

Bottone, E.J. 1997. Yersinia enterocolitica: the charisma continues. Clin. Microbiol. Rev. 10:257–276.

14.

Neubauer

, Hensel

, Aleksic

, and Meyer

. 2000. Identification of Yersinia enterocolitica within the genus Yersinia. Syst. Appl. Microbiol. 23:58–62.

15.

Simonova

, Borilova

, and Steinhauserova

. 2008. Occurrence of pathogenic strains of Yersinia enterocolitica in pigs and their antimicrobial resistance. Bull. Vet. Inst. Pulawy, 52:39–43.

16.

Clinical and Laboratory Standards Institute. 2011. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-First Informational Supplement. CLSI Document M100-S21. CLSI, Wayne PA.

17.

One-day (24–28 h) standardized laboratory protocol for molecular subtyping of Yersinia pestis by pulsed field gel electrophoresis (PFGE), PulseNet, CDC, USA. Available at www.cdc.gov/pulsenet/protocols/yersinia_Apr2006.pdf

18.

Sandery

, Stinear

, and Kaucner

. 1996. Detection of pathogenic Yersinia enterocolitica in environmental waters by PCR. J. Appl. Bacteriol. 80:327–332.

19.

Thoerner

, Kingombe

C.B.

, Bögli-Stuber

, Bissig-Choisat

, Wassenaar

, Frey

, and Jemmi

. 2003. PCR detection of virulence genes in Yersinia enterocolitica and Yersinia pseudotuberculosis and investigation of virulence gene distribution. Appl. Environ. Microbiol. 69:1810–1816.

20.

Hanifian

, and Khani

. 2012. Prevalence of virulent Yersinia enterocolitica in bulk raw milk and retail cheese in northern-west of Iran. Int. J. Food Microbiol. 155:89–92.

21.

Amasiani

, Agbo

, Ezeifeka

, and Chah

. 2013. prevalence of Yersinia enterocolitica in human population and transmission vehicles in Anambra State, Nigeria. Int. J. Environ. Sci. Tech. 2:877–885.

22.

Bhagat

, and Virdi

J.S.

. 2011. The enigma of Yersinia enterocolitica biovar 1A. Crit. Rev. Microbiol. 37:25–39.

23.

Fredriksson-Ahomaa

, Cernela

, Hächler

, and Stephan

. 2012. Yersinia enterocolitica strains associated with human infections in Switzerland 2001–2010. Eur. J. Clin. Microbiol. Infect. Dis. 31:1543–1550.

24.

Sihvonen

, Haukka

, Kuusi

, Virtanen

, and Siitonen

. 2009. Yersinia enterocolitica and Y. enterocolitica-like species in clinical stool specimens of humans: identification and prevalence of bio/serotypes in Finland. Eur. J. Clin. Microbiol. Infect. Dis. 28:757.

25.

Saberianpour

, Tajbakhsh

, Khamesipour

, and Branch

. 2014. Prevalence of virulence genes and biotyping of Yersinia enterocolitica isolated from chicken meat in Shahrekord, Iran. Vidyabharati Int. Interdisciplin. Res. J. 3:71–76.

26.

Ostroff

, Kapperud

, Hutwagner

, Nesbakken

, Bean

, Lassen

, and Tauxe

R.V.

. 1994. Sources of sporadic Yersinia enterocolitica infections in Norway: a prospective case–control study. Epidemiol. Infect. 112:133–141.

27.

Falcão

, Brocchi

, Proença-Módena

, Acrani

, Correa

, and Falcao

. 2004. Virulence characteristics and epidemiology of Yersinia enterocolitica and Yersiniae other than Y. pseudotuberculosis and Y. pestis isolated from water and sewage. J. Appl. Microbiol. 96:1230–1236.

28.

Bari

, Hossain

M.A.

, Isshiki

, and Ukuku

. 2011. Behavior of Yersinia enterocolitica in Foods. J. Pathog. 2011: Article ID 420732.

29.

Grant

, Bennett-Wood

, and Robins-Browne

R.M.

. 1998. Identification of virulence-associated characteristics in clinical isolates of Yersinia enterocolitica lacking classical virulence markers. Infect. Immun. 66:1113–1120.

30.

Momtaz

, Davood Rahimian

, and Safarpoor Dehkordi

. 2013. Identification and characterization of Yersinia enterocolitica isolated from raw chicken meat based on molecular and biological techniques. J. Appl. Poult. Res. 22:137–145.

31.

Fredriksson-Ahomaa

, Wacheck

, Koenig

, Stolle

, and Stephan

. 2009. Prevalence of pathogenic Yersinia enterocolitica and Yersinia pseudotuberculosis in wild boars in Switzerland. Int. J. Food Microbiol. 135:199–202.

32.

Zheng

, Sun

, Lin

, Mao

, and Jiang

. 2008. Yersinia enterocolitica infection in diarrheal patients. Eur. J. Clin. Microbiol. Infect. Dis. 27:741.

33.

Tennant

S.M.

, Skinner

N.A.

, Joe

, and Robins-Browne

R.M.

. 2005. Homologues of insecticidal toxin complex genes in Yersinia enterocolitica biotype 1A and their contribution to virulence. Infect. Immun. 73:6860–6867.

34.

Singh

, and Virdi

J.S.

. 2004. Production of Yersinia stable toxin (YST) and distribution of yst genes in biotype 1A strains of Yersinia enterocolitica. J. Med. Microbiol. 53:1065–1068.

35.

Platt-Samoraj

, Ugorski

, Szweda

, Szczerba-Turek

, Wojciech

, and Procajło

. 2006. Analysis of the presence of ail, ystA and ystB genes in Yersinia enterocolitica strains isolated from aborting sows and aborted fetuses. J. Vet. Med. B Infect. Dis. Vet. Public Health, 53:341–346.

36.

Bohn

, Schmitt

, Bielfeldt

, Noll

, Schulte

, and Autenrieth

I.B.

. 1998. Ambiguous role of interleukin-12 in Yersinia enterocolitica infection in susceptible and resistant mouse strains. Infect. Immun. 66:2213–2220.

37.

de Koning-Ward

T.F.

, Grant

, Oppedisano

, and Robins-Browne

R.M.

. 1998. Effect of bacterial invasion of macrophages on the outcome of assays to assess bacterium–macrophage interactions. J. Immunol. Methods, 215:39–44.

38.

Portnoy

D.A.

, and Falkow

. 1981. Virulence-associated plasmids from Yersinia enterocolitica and Yersinia pestis. J. Bacteriol. 148:877–883.

39.

Souza

R.A.

, Pitondo-Silva

, Falcão

D.P.

, and Falcão

J.P.

. 2010. Evaluation of four molecular typing methodologies as tools for determining taxonomy relations and for identifying species among Yersinia isolates. J Microbiol Methods, 82:141–150.

40.

Zadernowska

, and Chajęcka-Wierzchowska

. 2017. Prevalence, biofilm formation and virulence markers of Salmonella sp. and Yersinia enterocolitica in food of animal origin in Poland. LWT. 75:552–556.

Heterogeneity of Highly Susceptible Yersinia enterocolitica Isolates of Clinical and Environmental Origin: A 5-Year Survey from Iran (2011–2016)

Abstract

Introduction

Materials and Methods

Sample collection and Yersinia species identification

Biotyping of Y. enterocolitica strains isolated from human and environmental samples

Molecular confirmation of Y. enterocolitica isolates

Antimicrobial susceptibility testing

Virulotyping

Pulsed-field gel electrophoresis

Results

Isolation, identification, and confirmation of Y. enterocolitica isolates

Biotyping and virulotyping

Antimicrobial susceptibility of Y. enterocolitica isolates

PFGE genotyping

Discussion

Conclusion

Footnotes

Acknowledgments

Authors' Contributions

Ethics Approval and Consent to Participate

Availability of Data and Material

Disclosure Statement

References