Aspirin Causes Lipid Accumulation and Damage to Cell Membrane by Regulating DCI1 / OLE1 in Saccharomyces cerevisiae

Abstract

Aspirin is one of the most commonly used nonsteroidal anti-inflammatory drugs. Various potential pharmacological effects of aspirin, such as anticancer, antibacterial activity, and prolonging life expectancy have been discovered. However, the mechanism of aspirin is not fully elucidated. Herein, the effects of aspirin on fatty acid metabolism in yeast cell model Saccharomyces cerevisiae were studied. The results showed that aspirin can induce lipid accumulation and reduce the unsaturated fat index in cells. The assessment of cell membrane integrity demonstrated that aspirin caused damage to the cell membrane. These effects of aspirin were attributed to the alterations of the expression of DCI1 and OLE1. Similarly, aspirin was able to cause lipid accumulation and damage to the cell membrane by interfering with the expression of OLE1 in Candida albicans. These findings are expected to improve current understanding of the mode of action of aspirin and provide a novel strategy for antifungal drug design.

Graphical abstract

Introduction

Aspirin, or acetylsalicylic acid (ASA), is a historical nonsteroidal anti-inflammatory drug (NSAIDs) and is in widespread use for the treatment and prevention of numerous medical conditions, such as fever, pain, and inflammation.^1,2 In recent years, it has been reported that aspirin might have potential effect of anticancer, antibacterial activity, and prolonging life expectancy.^3–5

A number of studies have focused on the mechanisms of aspirin in different fields of fungal biology. For instance, Alem and Douglas found that aspirin shows a significant inhibition on Candida albicans by reducing the viability of biofilm organisms.⁶ Sapienza and Balzan reported that aspirin renders Saccharomyces cerevisiae more vulnerable to an altered redox balance and leads to growth arrest by affecting negatively the glutathione (GSH)/glutathione disulfide (GSSG) ratio, which induces apoptosis.⁷ Farrugia et al. proved that the apoptosis induced by aspirin is associated with the a significant increase in mitochondrial and cytosolic O₂⁻ and oxidation of mitochondrial nicotinamide adenine dinucleotide phosphate hydrogen.⁸ However, the mechanism underlying the effect of aspirin is still unclear.

The budding yeast S. cerevisiae is a beneficial model organism for many biological systems.⁹ It not only has a relatively short life span and is stable in both haploid and diploid forms,^10,11 but also can quickly and efficiently respond to stress phenomena resulting from environmental or nutritional insult.¹² Due to these advanced properties, S. cerevisiae has been widely applied to biochemical, genetic, and cytological studies in fundamental cellular processes.¹³ In addition, the implementation and validation of various new genomic technologies in yeast, such as drug-induced phenotypic responses,¹⁴ synthetic lethal screens,¹⁵ drug-induced haploinsufficiency¹⁶ and gene expression profiling of drug actions,¹⁷ has enabled S. cerevisiae as an ideal model organism to explore action of drugs or to identify new molecular entities with therapeutic potential.

The present study is designed to discover the potential targets of aspirin by using S. cerevisiae as a model organism and illuminate the potential mechanism of aspirin as an antifungal agent. The evidence shows that aspirin has the ability to induce lipid accumulation. Additionally, the target genes DCI1 and OLE1 that could be affected by aspirin in lipid metabolism have been identified. DCI1 and OLE1 are the key oxidase and synthetase in fatty acid metabolism, respectively.¹⁸ Deletion of DCI1 can cause a growth defect of yeast on oleic acid medium,¹⁹ whereas growth of ole1Δ requires supplemental oleic acid in the medium.²⁰ In line with these findings, aspirin can cause cell membrane damage by inhibiting expression of OLE1 in C. albicans cells. This study is expected to fill the gaps in understanding the molecular mechanism of aspirin.

Materials and Methods

Yeast strains, media, and growth conditions

The C. albicans (CMCC96001) and wild-type strain S. cerevisiae BY4741 and its mutant strains, including mga2Δ, ecl1Δ, ecm31Δ, and dci1Δ used in the present study, are listed in Table 1. The seeds of yeast strains were grown from overnight cultures on yeast extract peptone dextrose media (1% yeast extract, 2% peptone, and 2% glucose). Cells were pelleted and washed twice immediately after the cells had grown till the mid exponential phase. Then, cells were inoculated at 0.1 of OD₆₀₀ in synthetic complete (SC) media (0.67% yeast nitrogen base, 2.0% glucose, and complete amino acid mixture) or SC-Ura medium initially containing 0, 0.125, 0.25, and 0.5 mg/mL aspirin, respectively. Yeast extract and tryptone were obtained from Oxoid Ltd (Basingstoke, Hampshire, England). D-Glucose was obtained from Shanghai Lingfeng Chemical Reagent Co., Ltd. Other chemicals were purchased from Sangon Biotech (Shanghai, China). Aspirin (Sigma Chemical Co, St Louis) was freshly dissolved in dimethylsulphoxide (Sigma).

Table 1.

Yeast Strains in This Study

Strains	Feature	Origin
BY4741	MATahis3Δ1leu2Δ0ura3Δ0met15Δ0	Invitrogen
dci1Δ	BY4741 dci1Δ::KanMX4	Invitrogen
mga2Δ	BY4741 mga2Δ::KanMX4	Invitrogen
ecl1Δ	BY4741 ecl1Δ::KanMX4	Invitrogen
ecm31Δ	BY4741 ecm31Δ::KanMX4	Invitrogen

Screening for potential target genes of aspirin

Screening for potential target genes of aspirin by haploid yeast knockouts (YKOs) was carried out essentially as previously described.^21,22 Pools of isogenic MATa haploid cells were derived by growth on a haploid selection medium that either contained (experiment) or lacked (control) aspirin at 0.25 mg/mL. Relative representation of each YKO in drug-treated and untreated pools was compared by bar code microarray analysis.

Confirmation for potential target genes of aspirin and drug susceptibility assay

The drug sensitivity of yeast strains was determined via the drop test technique. In brief, yeast cells (OD₆₀₀1.0) were obtained from a single clone on medium and harvested. Each yeast strains were serially diluted 10-fold, spotted on SC plates or SC-Ura plates supplemented with 0, 0.125, 0.25 mg/mL aspirin, and incubated at 30°C for 4–7 days.

Effect of aspirin on lipid accumulation in S. cerevisiae and C. albicans

To visualize Oil red O-stained cells, samples were processed and observed as described.²³ A total of 2 × 10⁷ cells treated with 0, 0.125, and 0.25 mg/mL aspirin for 24 hours were harvested and stained with working solution of Oil red O (the ratio of 1% stock in isopropanol to H₂O is 3–2) for 10 minutes, then washed with distilled water and observed by fluorescence microscopy (Nikon Eclipse TI) at excitation wavelength of 488 nm, emission wavelength of 670 nm. Transmission images were recorded by differential interference contrast (DIC) optics.

Effect of aspirin on cellular saturated and monounsaturated fatty acids

Cellular lipids of different yeast strains were extracted as described with little modification.^24,25 Fatty acid methyl esters were prepared and detected by a modified method.²⁶ Briefly, 2 × 10⁸ cells grown on SC mediums for 24 hours were harvested, washed three times and decentralized in 1 mL ultrapure water. A VCX150 sonicator (Sonics & Materials Co. Ltd.) was used for yeast cell lysis at 150 W and 20 kHz frequency for 10 minutes. Two milliliter methyl alcohol was added into yeast cell lysis and vibrated for 5 minutes. Then, 2 mL chloroform was added immediately and vibrated for another 5 minutes. After centrifugation at 4,000g for 10 minutes, the bottom layer was transferred to a new centrifugal tube to dry under nitrogen gas. Two moles per liter sodium hydroxide in methanol-H₂O (1:1, [vol/vol]) solution was added into total lipid, followed immediately by heating at 100°C for 5 minutes. Three milliliter 2 mol/L hydrogen chloride in methanol solution was added and the solution was heated at 85°C for 1 hour. Two milliliter hexane was used to extract the methyl esters of fatty acids. The upper layer was collected and transferred into new 1.5 mL plastic tubes and dried under nitrogen gas after centrifugation at 10,000g at 4°C for 10 minutes. For the analysis of the methyl esters of fatty acids, Agilent 6890N gas chromatograph equipped with a 5975-mass spectrometer (Agilent) was used. The Gas Chromatography-Mass Spectrometry (GC-MS) was equipped with an HP-5 (30 m × 0.25 mm, 0.25 μm film thickness) column for analysis. The temperature program was set from initial temperature at 80–280°C at a rate of 20°C/minutes and maintained at 280°C for 5 minutes. Methyl undecanoate (C11:0) was used as internal standard. Helium was used as a carrier gas and the injection volume was 1 μL.

Effect of aspirin on mRNA expression of DCI1 and OLE1

One to two milliliters of aspirin treated and aspirin nontreated cells at OD₆₀₀ three to five were harvested and washed with cold water three times. Total RNA was extracted and purified using Yeast RNAiso Kit (TaKaRa, Tokyo, Japan) as described by the manufacturer. One microgram RNA was reverse-transcribed using Reverse Transcription kit (TaKaRa). Quantitative real-time assays were performed using EmeraldAmp PCR Master Mix (TaKaRa) and SYBR Premix Ex Taq (TaKaRa). DCI1, OLE1, ACT1, and MGA2 in S. cerevisiae and OLE1, SPT23, and ACT1 in C. albicans were amplified by Quantitative real-time PCR assays using the primers in Table 2.

Table 2.

Primer Sets Used in PCR

	Forward (5′-3′)	Reverse (5′-3′)
Genes in yeast
DCI1	CTCCTAACATATTTGTGGCGAAC	CTTCTGCGACAAAACCGAGA
OLE1	CTACTACGCTGTCGGTGGTG	CCACCATTTAGCGGACCCTT
MGA2	ACCAGGATGATAGCATGGCG	AAGACAACAGGTTGGGCGAA
ACT1	GCTTTGTTCCATCCTTCTG	GAAACACTTGTGGTGAACG
Genes in Candida albicans
OLE1	CTTTGGTTGCTGGATTGGGC	GGCCAAGGAGTTGACACAGA
SPT23	TTCGGCACCTAGTTCATCGG	GGCTAAAGCTTCAGATGCCG
ACT1	AGGTTTGGAAGCTGCTGGTA	ACGTTCAGCAATACCTGGGA

Effect of aspirin on cell membrane integrity

The integrity of cellular membrane was studied by using propidium iodide (PI) as described previously.²⁷ Cells grown on SC media were harvested by centrifugation at 5,000 rpm for 5 minutes at 4°C after treatment with different aspirin for 24 hours. They were then washed twice with distilled water. PI (1 mg/mL) was added to 100 μL of the cell suspensions to yield a final concentration of 10 μg/mL. After 15 minutes of incubation at room temperature, cells were examined by DIC microscopy and fluorescent microscope (Nikon Eclipse TI) at excitation wavelength of 488 nm, emission wavelength of 670 nm and then counted. The percentages of cells exhibiting red fluorescence were plotted. Each value was obtained from three independent experiments.

Statistical analysis

All experiments were performed at least three times. Values were expressed as mean ± standard deviations. A Student's t-test was used for statistical analysis. Values of p < 0.05 were considered to be statistically significant.

Results

Aspirin inhibited the growth of C. albicans and S. cerevisiae, and induced lipid accumulation in yeast cells

First, the pathogen C. albicans and the yeast S. cerevisiae cells were grown in SC media containing 0, 0.125, 0.25, 0.5, and 0.75 mg/mL aspirin, respectively. As shown in Fig. 1A and B, the growth of both cell types was inhibited in a dose-dependent manner. Cells treated with 0.125 and 0.25 mg/mL aspirin can incur 25% and 50% repression on cell growth, respectively. Hence, 0.125 and 0.25 mg/mL were used in the following experiments.

FIG. 1.

Aspirin inhibited the growth of Candida albicans and yeast and introduced lipid accumulation in wild-type yeast. (A) The growth curve of C. albicans on addition of aspirin. C. albicans cells were grown in the presence of 0, 0.125, 0.25, 0.5, and 0.75 mg/mL. (B) The growth curve of budding yeast cells on addition of aspirin. The wild-type cells were grown in the presence of 0, 0.125, 0.25, 0.5, and 0.75 mg/mL aspirin. (C) Intracellular lipid droplets of wild type were stained with Oil Red O and photographed by DIC microscopy and fluorescence microscopy with × 400 magnification, scale bar is 2 μm. Concentration of aspirin was 0.125 and 0.25 mg/mL, respectively. (D) Quantification of lipid accumulation in wild type under 0.125 and 0.25 mg/mL aspirin treatment. Values were expressed as mean ± SD. *p < 0.05. **p < 0.01 (drug-treated group vs. control group). DIC, differential interference contrast; SD, standard deviation.

To identify the potential targets of aspirin, we first systematically screened the yeast S. cerevisiae genome-wide haploid deletion mutants as described in the methods, and classified these resistance and sensitivity genes into four groups, nonspecific drug resistance genes, cell membrane-related genes, cell wall integrity-related genes, and energy metabolism-related genes (Supplementary Fig. S1). According to the result of the screening, MGA2 classified to cell membrane-related genes group was highly repressed by aspirin (Supplementary Table S1, Supplementary Fig. S1). In fact, MGA2 is also involved in regulation of OLE1 transcription²⁸ and it has been reported that aspirin has a great influence on fatty acid metabolism in mammal cells.²⁹ Thereby, we were curious about the impact of aspirin on fatty metabolism in yeast. As shown in Fig. 1C, aspirin resulted in an increase of lipid accumulation when compared with the control group. The quantification in Fig. 1D indicates that aspirin can induce cellular lipid accumulation in yeast.

Aspirin regulates the expression of DCI1 and OLE1 genes in yeast cells

To further identify the potential target genes of aspirin, mutants lacking fatty acid metabolism-related genes were chosen based on the screening result. Mutants were selected and investigated by spot assay technique (Table 1). As shown in Fig. 2A, dci1Δ mutants show super resistance toward aspirin, whereas mga2Δ mutants show susceptibility toward aspirin. Interestingly, DCI1 encodes the delta (3,5)-delta (2,4)-dienoyl-CoA isomerase involved in beta-oxidation of fatty acids,³⁰ whereas MGA2 is an important transcription factor of OLE1 that encodes delta (9) fatty acid desaturase required for monounsaturated fatty acid synthesis.²⁸ These two genes with different functions show opposite results after drug susceptibility assay, indicating that aspirin may inhibit cell growth by impacting the components of fatty acid through these two genes.

FIG. 2.

Aspirin inhibits the growth of yeast by dci1 and ole1 genes. (A) Spot assay. Strains lacking fatty acid metabolism-related genes were selected from yeast mutant library, were grown for 3–7 days on SC plates with different concentration of aspirin, 10-fold serially diluted, and then spotted on plates. (B) Quantitative real-time PCR analysis. The mRNA expression of DCI1, MGA2, and OLE1 was confirmed by real-time PCR analysis and normalized to ACT1 RNA expression. Values were expressed as mean ± SD. *p < 0.05 (drug-treated group vs. corresponding control group). (C, D) Spot assay. BY4741, dci1Δ, mga2Δ cells carrying vector or the OLE1, DCI1 plasmid were grown on SC-Ura plates with or without the addition of 0.125 and 0.25 mg/mL aspirin and were incubated at 30°C for 3–7 days. SC, synthetic complete.

Quantitative real-time PCR analysis was then performed to explore the effect of aspirin on DCI1, MGA2, and OLE1 expression. MGA2 and OLE1 were suppressed in dose-dependent manners, while the expression of DCI1 was upregulated by aspirin (Fig. 2B).

To confirm the results, we analyzed the effects of DCI1 and OLE1 on drug-resistant stress by spot testing. Since OLE1 is an essential gene for yeast, mga2Δ is used to produce low level of expression of OLE1. The results in Fig. 2C and D show that overexpression of DCI1 causes the cells to become more susceptible to aspirin. However, when overexpressing OLE1 in the cells, only the BY4741 and mga2Δ exhibited resistance to aspirin (Fig. 2C, D). Subsequently, we investigated the lipid accumulation in dci1Δ and mga2Δ with and without aspirin. As shown in Fig. 3A, aspirin had no effect on lipid accumulation in dci1Δ and mga2Δ. To conclude, these data demonstrate that aspirin induces lipid accumulation by regulating DCI1 and OLE1 in yeast cells.

FIG. 3.

Effect of aspirin on the cellular lipid accumulation in dci1Δ and mga2Δ mutants and fatty acid contents in yeast. (A) Intracellular lipid droplets were stained with Oil Red O and photographed by DIC microscopy and fluorescence microscopy with × 400 magnification, scale bar is 2 and 5 μm. Concentration of aspirin was 0.125 and 0.25 mg/mL, respectively. (B) The unsaturation index in the yeast BY4741 and mutant strains with different treatment were analyzed, as described in the Materials and Methods section. Values were expressed as mean ± SD. *p < 0.05, **p < 0.01 (compared to wide-type control group).

Aspirin changes the components of fatty acids in yeast cells

DCI1 and OLE1 genes are responsible for keeping the saturated and unsaturated fatty acid balance in yeast.³⁰ To further evaluate whether aspirin inhibit yeast growth by disturbing fatty acid metabolism, we measured the content of fatty acids in BY4741, dci1Δ, and mga2Δ using GC-MS. The content of fatty acids was interfered by aspirin compared to the untreated cells (Table 3). After treatment with aspirin, the contents of saturated fatty acid in BY4741 increased significantly 1.25 times. Among unsaturated fatty acids, palmitoleic acid was dramatically decreased to 8.8%. Myristic acid, arachidic acid, and behenic acid in mutants dci1Δ increased greatly, while oleic acid decreased tremendously from 35.4% to 21.5% after treating with aspirin. However, there is no significant change in the content of fatty acids in mga2Δ. Then, we calculated the unsaturated fat index (unsaturated fat index = ratio of unsaturated fat to saturated fat) of wild type and mutants, and found that the unsaturated fat index of wild type after treatment with aspirin dramatically decreased from 0.58 to 0.27. The unsaturated fat index of dci1Δ was higher than that of wild type. Intriguingly, the unsaturated fat index of dci1Δ treated with aspirin decreased to the same level in BY4741. The unsaturated fat index of mga2Δ further decreased significantly after treatment with aspirin (Fig. 3B).

Table 3.

Analysis of Content and Composition of Fatty Acid in BY4741, dci1Δ, and mga2Δ

Fatty acid	No. of carbon atom	BY4741 (%)		dci1Δ (%)		mga2Δ (%)
Fatty acid	No. of carbon atom	Control	0.25 mg/mL ASA	Control	0.25 mg/mL ASA	Control	0.25 mg/mL ASA
Lauric acid	C12:0	0.4 ± 0.2	0.6 ± 0.1	0.2 ± 0.1	0.4 ± 0.3	0.3 ± 0.1	ND
Myristic acid	C14:0	1.7 ± 0.2	1.4 ± 0.4	0.8 ± 0.2	1.8 ± 0.3^*	1.4 ± 0.1	1.4 ± 0.3
Palmitoleic acid	C16:1	14.6 ± 2.8	8.8 ± 1.1^*	19.5 ± 4.4	12.9 ± 2.1	9.7 ± 3.5	5.6 ± 1.1
Palmitic acid	C16:0	38.6 ± 2.0	48.2 ± 5.5^*	30.0 ± 4.7	36.9 ± 0.6	50.2 ± 6.2	56.6 ± 3.8
Oleic acid	C18:1	21.7 ± 5.0	12.5 ± 4.7	35.4 ± 3.7	21.5 ± 1.6^*	10.3 ± 4.4	4.0 ± 1.3
Stearic acid	C18:0	20.8 ± 5.6	25.2 ± 2.3	12.8 ± 3.2	20.8 ± 2.9	28.2 ± 3.6	32.4 ± 2.7
Arachidic acid	C20:0	1.3 ± 0.7	1.7 ± 1.2	0.8 ± 0.1	1.9 ± 0.5^*	ND	ND
Behenic acid	C22:0	1.1 ± 0.33	1.7 ± 1.4	0.6 ± 0.2	4.0 ± 1.3^*	ND	ND

Values were expressed as mean ± standard deviation.

p < 0.05 (drug-treated group vs. corresponding control group).

ASA, acetylsalicylic acid; ND, not detected.

Aspirin causes membrane damage in yeast

Fatty acids are one of the main components of yeast cell membranes³¹ and play important roles in cell membrane fluid and membrane permeability.³² Aspirin was reported to interfere with the function of cell membrane by altering membrane fluidity.⁶ To assess the impact of aspirin on cell membrane integrity, PI was used as a fluorescent dye. The observation was detected by fluorescence microscopy.³³ As shown in Fig. 4A and B, the percentage of dead cells (PI-stained) in BY4741 was 7.3%. The percentage was increased to 41.5% after the cells were treated with 0.25 mg/mL aspirin. In the mutants dci1Δ and mga2Δ, the ratio of PI-positive cells was 9.3% and 17.8%, respectively. The percentage of dead cells in mga2Δ increased to 59.7% after treatment with aspirin, whereas dead cells in dci1Δ showed no significant change.

FIG. 4.

Effects of aspirin on membrane integrity of wild-type BY4741 and mutants. (A) Membrane integrity of wild-type BY4741 and mutants. After 24 hours cultivating in SC presenting in 0 and 0.25 mg/mL aspirin, yeast cells were stained with PI for 15 minutes and observed using a fluorescent microscope with × 160 magnification, scale bar is 20 μm. (B) Percentage of PI-stained cells shown in panel after 24 hours aspirin treatment. Values were expressed as mean ± SD. *p < 0.05, **p < 0.01 (drug-treated group vs. corresponding control group). PI, propidium iodide.

The inhibitory effect of aspirin on C. albicans

To test whether aspirin inhibits the growth of C. albicans via affecting the homologous genes of DCI1, MGA2, and OLE1, we performed quantitative real-time PCR analysis to explore the effect of aspirin on the expression of OLE1 and SPT23, which is a key transcription factor of OLE1 in C. albicans.³⁴ Since the homologous gene of DCI1 in C. albicans has not been confirmed, the mRNA level of DCI1 could not be detected. SPT23 and OLE1 were both highly suppressed in dose-dependent manners (Fig. 5A, B).

FIG. 5.

Effect of aspirin on genes, cellular lipid accumulation, and membrane integrity in Candida albicans. (A, B) Quantitative real-time PCR analysis. The mRNA expression of SPT23 and OLE1 was confirmed by real-time PCR analysis and normalized to ACT1 RNA expression. Values were expressed as mean ± SD. ***p < 0.001 (drug-treated group vs. corresponding control group). (C) Intracellular lipid droplets of C. albicans were stained with Oil Red O and photographed by DIC microscopy and fluorescence microscopy with × 400 magnification, scale bar is 10 μm. Concentration of aspirin was 0.125 and 0.25 mg/mL, respectively. (D) Quantification of lipid accumulation in C. albicans under 0.125 and 0.25 mg/mL aspirin treatment. Values were expressed as mean ± SD. **p < 0.01 (drug-treated group vs. control group). (E) Membrane integrity of C. albicans. After 24 hours cultivating in SC presenting in 0, 0.125, and 0.25 mg/mL aspirin, C. albicans cells were stained with PI for 15 minutes and observed using DIC microscopy and fluorescence microscopy with × 160 magnification. (F) Percentage of PI-stained cells shown in panel after 24 hours aspirin treatment. Values were expressed as mean ± SD. *p < 0.05, **p < 0.01 (drug-treated group vs. corresponding control group).

Finally, we assessed the impact of aspirin on cell membrane integrity and lipid accumulation in C. albicans using the same methods performed in yeast S. cerevisiae. As shown in Fig. 5C and D, aspirin led to an increase in lipid accumulation in C. albicans in a dose-dependent manner. In addition, the results of impact of aspirin on cell membrane integrity indicate that aspirin also caused cell membrane damage in C. albicans (Fig. 5E, F).

Discussion

According to previous studies, aspirin can interfere with fatty acid metabolism by activating the enzyme in mitochondria, leading to the increase in usage of fatty acid and level of reactive oxygen species in animal cells.^35,36 Herein, we further investigated the mode of action of aspirin on fatty metabolism in the model organism budding yeast and the pathogen C. albicans.

The results of screening the potential target genes of aspirin indicated that aspirin interfered with four groups of genes, including nonspecific drug resistance genes, cell membrane-related genes, cell wall integrity-related genes, and energy metabolism-related genes (Supplementary Table S1, Supplementary Fig. S1). It is noted that MGA2, belonging to cell membrane related genes, is also involved in regulation of OLE1 transcription and plays an important role in fatty acid metabolism in yeast.²⁸ The lack of MGA2 in the mutants showed that they were highly sensitive to aspirin. Meanwhile, our observations suggested that aspirin can induce cellular lipid accumulation in yeast (Fig. 1C, D). The findings were consistent with previous reports describing the effect of aspirin on fatty content in animal cells.^29,37 This could be contributed to the effect of aspirin on fatty acid metabolism.

Aspirin can inhibit the release of fatty acids from both phospholipids and triglycerides,³⁸ and inhibit the long chain 3-hydroxyacyl-CoA dehydrogenase, which is involved in the beta-oxidation of fatty acids.^39,40 Fatty acid synthase has been identified to be a potential antifungal target.⁴¹ Pan et al. showed aspirin causes time-dependent inhibition and acetylation of allene oxide synthase that initiates plant oxylipin synthesis.⁴² He et al. and Hawley et al. proved that aspirin can regulate lipid metabolism by activating the AMP-activated protein kinase of AMPK pathway.^35,43 In this study, we identified that DCI1 and MGA2/SPT23 genes can be the potential targets of aspirin by spot assay. Since MGA2/SPT23 is an upregulator of the OLE1 gene,^28,34 and DCI1 and OLE1 play the opposite roles in lipid metabolism, our results indicated that the effect of aspirin on lipid accumulation could be attributed to the alterations in the expression of DCI1 and OLE1 genes. Moreover, Vincent et al. found that the compound YTX-465 from 1,2,4-oxadiazole inhibited OLE1 but was inactive to SCD1, which is the human homolog of OLE1. It indicates OLE1 could be as a perspective target for antifungal agent.⁴⁴

Fatty acids are ubiquitous in nature and carry out many functions involved in cell energy storage, membrane structure, and in various signaling pathways.⁴⁵ The composition of saturated and unsaturated fatty acids plays an important role in affecting protein in cell activities, such as ion channels, receptors, and gene expression.^46,47 In this study, DCI1 and OLE1 were found to be involved in the effect of aspirin on yeast. These two genes are associated with the synthetic pathway of the saturated and unsaturated fatty acids.³⁰ Our data also verified these effects (Table 3 and Fig. 3A).

It is well known that unsaturated fatty acids are essential for maintaining cell membrane integrity and function and for adapting to environmental stress.^48,49 Therefore, we assessed the effect of aspirin on yeast cell membrane integrity. Our results showed that aspirin causes loss of membrane integrity for passing the PI, suggesting aspirin leads to alteration in lipid composition in cell membrane. A co-relation has been observed between oxidative stress induced by aspirin and cell membrane damage, which may suggest that the damage to the cell membrane could be due to the increased lipid peroxidation.^50,51 Membrane fatty acid unsaturation plays an important role in protecting against oxidative stress.⁵² As the Fig. 3B shows, the decreasing unsaturated fat index in wild type and mutant type could be caused by oxidative stress induced by aspirin, leading to damage to the cell membrane. Fang et al. reported that overexpression of OLE1 enhances cytoplasmic membrane stability and confers resistance to cadmium in yeast.³³ Our data indicated that the overexpression of OLE1 also helps yeast cells increase the resistance to aspirin. But contradictory to our expectations, overexpression of OLE1 in dci1Δ mutants did not improve their resistance to aspirin. The reason might be attributed to the high levels of unsaturated fatty acids, which can inhibit the cell growth according to the previous report.⁵²

Herein, our finding that aspirin interferes with fatty acid metabolism in yeast has also been further proven in C. albicans. Consistent with this model, aspirin caused cell membrane damage by inhibiting expression of OLE1 in C. albicans cells. Obviously, aspirin exhibits an inhibitory effect on the fungal pathogen C. albicans. To sum up, our observations suggest that aspirin could cause lipid accumulation and damage to the cell membrane by interfering with the expression of DCI1 and OLE1, leading to the inhibition of the yeast S. cerevisiae cell growth. Additionally, the inhibitory effect of aspirin on OLE1 is conserved in C. albicans. These discoveries can be used as a novel strategy for antifungal drug design.

Footnotes

Disclosure Statement

No competing financial interests exist.

Funding Information

This work was supported by grants from the National Natural Science Foundation of China (31671309), and the Development Project of Qinghai Key Laboratory (2017-ZJ-Y10).

Supplementary Material

References

Awtry

E.H.

, and Loscalzo

. 2000. Aspirin. Circulation, 101:1206–1218.

Cryer

, and Feldman

. 1999. Effects of very low dose daily, long-term aspirin therapy on gastric, duodenal, and rectal prostaglandin levels and on mucosal injury in healthy humans. Gastroenterology, 117:17–25.

Langley

R.E.

, and Rothwell

P.M.

. 2013. Biological markers: potential biomarker for aspirin use in colorectal cancer therapy. Nat. Rev. Clin. Oncol. 10:8.

Martin, S.J. 2007. Antimicrobial stewardship: the aspirin of the 21st Century. Expert Rev. Anti-Infect. 5:159–161.

Keser

, and Karataş

. 2012. Effects of aspirin and acetaldehtde on longevity and metamorphosis duration of drosophila melanogaster. Fresen. Environ. Bull. 21:2758–2765.

Alem

M.A.S.

, and Douglas

L.J.

. 2004. Effects of aspirin and other nonsteroidal anti-inflammatory drugs on biofilms and planktonic cells of Candida albicans. Antimicrob. Agents Chemother. 48:41–47.

Sapienza

, and Balzan

. 2005. Metabolic aspects of aspirin-induced apoptosis in yeast. FEMS Yeast Res. 5:1207–1213.

Farrugia

, Bannister

W.H

, Vassallo

, and Balzan

. 2013. Aspirin-induced apoptosis of yeast cells is associated with mitochondrial superoxide radical accumulation and NAD (P) H oxidation. FEMS Yeast Res. 13:755–768.

Botstein

, and Fink

G.R.

. 2011. Yeast: an experimental organism for 21st Century biology. Genetics, 189:695–704.

10.

Arlia-Ciommo

, Piano

, Leonov

, Svistkova

, and Titorenko

V.I.

. 2014. Quasi-programmed aging of budding yeast: a trade-off between programmed processes of cell proliferation, differentiation, stress response, survival and death defines yeast lifespan. Cell Cycle, 13:3336–3349.

11.

Fontana

, Partridge

, and Longo

V.D.

. 2010. Extending healthy life span—from yeast to humans. Science, 328:321–326.

12.

Kohlwein, S.D. 2010. Obese and anorexic yeasts: experimental models to understand the metabolic syndrome and lipotoxicity. BBA-Mol. Cell Biol. 1801:222–229.

13.

Menacho-Marquez

, and Murguia

J.R.

. 2007. Yeast on drugs: Saccharomyces cerevisiae as a tool for anticancer drug research. Clin. Transl. Oncol. 9:221–228.

14.

Birrell

G.W.

, Guri

, Chu

A.M

, Davis

R.W

, and Brown

J.M

. 2001. genome-wide screen in

. Saccharomyces cerevisiae. for genes affecting UV radiation sensitivity. Proc. Natl. Acad. Sci. U.S.A. 98: 12608–1, 2613.

15.

Tong

A.H.Y.

, Lesage

, Bader

G.D

, Ding

, Xu

, Xin

, Young

, Berriz

G.F

, Brost

R.L

, Chang

, Chen

, Cheng

, Chua

, Friesen

, Goldberg

D.S

, Haynes

, Humphries

, He

, Hussein

, Ke

, Krogan

, Li

, Levinson

J.N

, Lu

, Menard

, Munyana

, Parsons

A.B

, Ryan

, Tonikian

, Roberts

, Sdicu

A.-M

, Shapiro

, Sheikh

, Suter

, Wong

S.L

, Zhang

L.V

, Zhu

, Burd

C.G

, Munro

, Sander

, Rine

, Greenblatt

, Peter

, Bretscher

, Bell

, Roth

F.P

, Brown

G.W

, Andrews

, Bussey

, and Boone

. 2004. Global mapping of the yeast genetic interaction network. Science, 303:808–813.

16.

Lum

P.Y.

, Armour

C.D

, Stepaniants

S.B

, Cavet

, Wolf

M.K

, Butler

J.S

, Hinshaw

J.C

, Garnier

, Prestwich

G.D

, Leonardson

, Garrett-Engele

, Rush

C.M

, Bard

, Schimmack

, Phillips

J.W

, Roberts

C.J

, and Shoemaker

D.D.

. 2004. Discovering modes of action for therapeutic compounds using a genome-wide screen of yeast heterozygotes. Cell, 116:121–137.

17.

Marton

M.J.

, DeRisi

J.L

, Bennett

H.A

, Iyer

V.R

, Meyer

M.R

, Roberts

C.J

, Stoughton

, Burchard

, Slade

, Dai

, Bassett Jr

D.E

., Hartwell

L.H

, Brown

P.O

, and Friend

S.H.

. 1998. Drug target validation and identification of secondary drug target effects using DNA microarrays. Nat. Med. 4:1293.

18.

Natter

, Leitner

, Faschinger

, Wolinski

, McCrait

, Fields

, and Kohlwein

S.D.

. 2005. The spatial organization of lipid synthesis in the yeast Saccharomyces cerevisiae derived from large scale green fluorescent protein tagging and high resolution microscopy. Mol. Cell. Proteom. 4:662–672.

19.

Geisbrecht

B.V.

, Schulz

, Nau

, Geraghty

M.T

, Schulz

, Erdmann

, and Gould

S.J.

. 1999. Preliminary characterization of Yor180Cp: identification of a novel peroxisomal protein of Saccharomyces cerevisiae involved in fatty acid metabolism.” Biochem. Biophys. Res. Commun. 260:28–34.

20.

Ogasawara

, Kira

, Mukai

, Noda

and Yamamoto

. 2017. Ole1, fatty acid desaturase, is required for Atg9 delivery and isolation membrane expansion during autophagy in Saccharomyces cerevisiae. Biol. Open, 6:35–40.

21.

Pan

, Yuan

D.S

, Ooi

S.-L

, Wang

, Sookhai-Mahadeo

, Meluh

, and Boeke

J.D.

. 2007. dSLAM analysis of genome-wide genetic interactions in Saccharomyces cerevisiae. Methods, 41:206–221.

22.

Pan

, D.S.Yuan, Xiang

, Wang

, Sookhai-Mahadeo

, Bader

J.S

, Hieter

, Spencer

, and Boeke

J.D.

. 2004. A robust toolkit for functional profiling of the yeast genome. Mol. Cell, 16:487–496.

23.

Adeyo

, Horn

P.J

, Lee

, Binns

D.D

, Chandrahas

, Chapman

K.D

, and Goodman

J.M.

. 2011. The yeast lipin orthologue Pah1p is important for biogenesis of lipid droplets. J. Cell Biol. 192:1043–1055.

24.

Schneiter

, and Daum

. 2006. Extraction of yeast lipids. Methods Mol. Biol. 313:41–45.

25.

Liu

, Zeng

X.A

, Sun

D.W

, and Han

. 2013. Disruption and protein release by ultrasonication of yeast cells. Innov. Food Sci. Emerg. 18:132–137.

26.

Wang

, Wang

, Zhang

, Hu

, Fang

, Huang

, and Shi

. 2016. Trivalent chromium alleviates oleic acid induced steatosis in SMMC-7721 cells by decreasing fatty acid uptake and triglyceride synthesis. Biometals, 29:881–892.

27.

Malik

M.A.

, Al-Thabaiti

S.A

, and Malik

M.A.

. 2012. Synthesis, structure optimization and antifungal screening of novel tetrazole ring bearing acyl-hydrazones. Int. J. Mol. Sci. 13:10880–10898.

28.

Chellappa

, Kandasamy

, Oh

C.S

, Jiang

, Vemula

, and Martin

C.E.

. 2001. The membrane proteins, Spt23p and Mga2p, play distinct roles in the activation of Saccharomyces cerevisiae OLE1 gene expression fatty acid-mediated regulation of Mga2p activity is independent of its proteolytic processing into a soluble transcription activator. J. Biol. Chem. 276:43548–43556.

29.

Yoshida

, Wang

, and Osame

. 1998. Aspirin induces short-chain free fatty acid accumulation in rats. Eur. J. Pharmacol. 349:49–52.

30.

Gurvitz

, Mursula

A.M

, Yagi

A.I

, Hartig

, Ruis

, Rottensteiner

, and Hiltunen

J.K.

. 1999. Alternatives to the isomerase-dependent pathway for the β-oxidation of oleic acid are dispensable in Saccharomyces cerevisiae identification of Yor180c/DCI1 encoding peroxisomal Δ3, 5-Δ2, 4-dienoyl -CoA isomerase. J. Biol. Chem. 274:24514–24521.

31.

Van der Rest

M.E.

, Kamminga

A.H

, Nakano

, Anraku

, Poolman

, and Konings

W.N.

. 1995. The plasma membrane of Saccharomyces cerevisiae: structure, function, and biogenesis. Microbiol. Rev. 59:304–322.

32.

Ferreira

, Teixeira

P.G

, Siewers

, and Nielsen

. 2018. Redirection of lipid flux toward phospholipids in yeast increases fatty acid turnover and secretion. Proc. Natl. Acad. Sci. U.S.A. 115:1262–1267.

33.

Fang

, Chen

, Wang

, Shi

, Shen

, Zhang

, Xiao

, and Huang

. 2017. Overexpression of OLE1 enhances cytoplasmic membrane stability and confers resistance to cadmium in Saccharomyces cerevisiae. Appl. Environ. Microb. 83:e02319-16.

34.

C.S.

, and Martin

C.E.

. 2006. Candida albicans Spt23p controls the expression of the Ole1p Δ9 fatty acid desaturase and regulates unsaturated fatty acid biosynthesis. J. Biol. Chem. 281:7030–7039.

35.

Hawley

S.A.

, Fullerton

M.D

, Ross

F.A

, Schertzer

J.D

, Chevtzoff

, Walker

K.J

, Peggie

M.W

, Zibrova

, Green

K.A

, Mustard

K.J

, Kemp

B.E

, Sakamoto

, Steinberg

G.R

, and Hardie

D.G.

. 2012. The ancient drug salicylate directly activates AMP-activated protein kinase. Science, 336:918–922.

36.

Uppala

, Dudiak

, Beck

M.E

, Bharathi

S.S

, Zhang

, Stolz

D.B

, and Goetzman

E.S.

. 2017. Aspirin increases mitochondrial fatty acid oxidation. Biochem. Biophys. Res. Commun. 482:346–351.

37.

Murai

, Okumura

, and Furuse

. 1996. Aspirin promotes hepatic triacylglycerol accumulation in essential fatty acid-deficient Japanese quail. Naunyn Schmiedebergs Arch. Pharmacol. 353:689–692.

38.

Calder, P.C. 2001. Polyunsaturated fatty acids, inflammation, and immunity. Lipids, 36:1007–1024.

39.

Glasgowa

J.F.

, Middletonb

, Moorea

, Graya

, and Hill

. 1999. The mechanism of inhibition of β-oxidation by aspirin metabolites in skin fibroblasts from Reye's syndrome patients and controls. BBA-Mol. Basis Dis. 1454:115–125.

40.

Glasgow

J.FT.

, and Middleton

. 2001. Reye syndrome—insights on causation and prognosis. Arch. Dis. Child. 85:351–353.

41.

X.C.

, Joshi

A.S

, ElSohly

H.N

, Khan

S.I

, Jacob

M.R

, Zhang

, Khan

I.A

, Ferreira

, Walker

L.A

, Broedel Jr

S.E

, Raulli

R.E

, and Cihlar

R.L.

. 2002. Fatty acid synthase inhibitors from plants: isolation, structure elucidation, and SAR studies. J. Nat. Prod. 65:1909–1914.

42.

Pan

, Camara

, Gardner

H.W

, and Backhaus

R.A.

. 1998. Aspirin inhibition and acetylation of the plant cytochrome P450, allene oxide synthase, resembles that of animal prostaglandin endoperoxide H synthase. J. Biol. Chem. 273:18139–18145.

43.

, Peng

, Duan

, Tian

, Zhang

, Hu

, Cai

, Feng

, and Li

. 2015. Aspirin regulates hepatocellular lipid metabolism by activating AMPK signaling pathway. J. Toxicol. Sci. 40:127–136.

44.

Vincent

B.M.

, Tardiff

D.F

, Piotrowski

J.S

, Aron

, Lucas

M.C

, Chung

C.Y

, Bacherman

, Chen

, Pires

, Subramaniam

, Doshi

D.B

, Sadlish

, Raja

W.K

, Solis

E.J

, Khurana

, Le Bourdonnec

, Scannevin

R.H

, and Rhodes

K.J.

. 2018. Inhibiting stearoyl-CoA desaturase ameliorates α-synuclein cytotoxicity. Cell Rep. 25: 2742–2754.

45.

Liu

, Ruan

, Li

, Xu

, Wang

, Gao

, and Wang

. 2008. Biological control of phytopathogenic fungi by fatty acids. Mycopathologia, 166:93–102.

46.

Ntambi

J.M.

, and Bene

. 2001. Polyunsaturated fatty acid regulation of gene expression. J. Mol. Neurosci. 16:273–278.

47.

Litman

B.J.

, Niu

S.L

, Polozova

, and Mitchell

D.C.

. 2001. The role of docosahexaenoic acid containing phospholipids in modulating G protein-coupled signaling pathways: visual transduction. J. Mol. Neurosci. 16:237–242.

48.

You

K.M.

, Rosenfield

C.L

, and Knipple

D.C.

. 2003. Ethanol tolerance in the yeast Saccharomyces cerevisiae is dependent on cellular oleic acid content. Appl. Environ. Microbiol. 69:1499–1503.

49.

Rupčić

, and G.Č. Jurešić. 2010. Influence of stressful fermentation conditions on neutral lipids of a Saccharomyces cerevisiae brewing strain. World J. Microb. Biotechnol. 26:1331–1336.

50.

Choi

S.S.

, Park

S.H

, Sim

Y.B

, and Suh

H.W.

. 2012. Effect of decursinol on the aspirin-induced gastric ulcer in mice. J. Korean Soc. Appl. Biol. Chem. 55:343–345.

51.

Nku

C.O.

, Oghale

G.O

, and Ajiwhen

I.O.

. 2015. Locomotor behaviour and anxiety in the open field and light/dark box in CD1 mice treated with aspirin, cataflam and ethanolic extract of cannabis sativa. Br. J. Med. Med. Res. 6:563.

52.

Bossie

M.A.

, and Martin

C.E.

. 1989. Nutritional regulation of yeast delta-9 fatty acid desaturase activity. J. Bacteriol. 171:6409–6413.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.11 MB

0.02 MB