Presence and Transfer of Antimicrobial Resistance Determinants in Escherichia coli in Pigs,Pork,and Humans in Thailand and Lao PDR Border Provinces

Abstract

This study aimed to investigate antimicrobial resistance (AMR) characteristics of Escherichia coli isolates from pig origin (including pigs, pig carcass, and pork) and humans in Thailand and Lao People's Democratic Republic (PDR) border provinces. The majority of the E. coli isolates from Thailand (69.7%) and Lao PDR (63.3%) exhibited multidrug resistance. Class 1 integrons with resistance gene cassettes were common (n = 43), of which the most predominant resistance gene cassette was aadA1. The percentage of extended-spectrum beta-lactamase (ESBL) producers was 3.4 in Thailand and 3.2 in Lao PDR. The ESBL genes found were bla_CTX-M14, bla_CTX-M27, and bla_CTX-M55, of which bla_CTX-M55 was the most common (58.6%). Ser-83-Leu and Asp-87-Asn were the predominant amino acid changes in GyrA of ciprofloxacin-resistant isolates. Twenty-two percent of all isolates were positive for qnrS. Class 1 integrons carrying aadA1 from pigs (n = 1) and ESBL genes (bla_CTX-M55 and bla_CTX-M14) from pigs (n = 2), pork (n = 1), and humans (n = 7) were located on conjugative plasmids. Most plasmids (29.3%) were typed in the IncFrepB group. In conclusion, AMR E. coli are common in pig origin and humans in these areas. The findings confirm AMR as One Health issue, and highlight the need for comprehensive and unified collaborations within and between sectors on research and policy.

Introduction

Antimicrobial resistance (AMR) has become a serious public health problem in most parts of the world, and it is evidently a result of over- and misuse of antimicrobials. AMR is associated with human, veterinary, and environmental health, referred to as One Health. The global AMR situation has been worsened by the emergence and spread of multidrug-resistant (MDR) bacteria, which are resistant to almost all the antibiotics available in the market. Particular concern has been raised on resistance to the last-line antibiotics (i.e., new-generation cephalosporins, quinolones, colistin, and meropenem) that could limit choices of antibiotic therapy for bacterial infections in the future.

Commensal Escherichia coli serve as indicator bacteria for fecal contamination in foods from animals. E. coli are generally harmless but could serve as reservoirs of AMR determinants. These AMR determinants can be shared in a process called horizontal gene transfer that can occur both between bacteria of the same species and between different species. Therefore, commensal E. coli are considered a potential AMR hazard.¹ AMR monitoring is a priority action to elucidate the root causes and estimate the burden of AMR. It has been justified that resistance phenotype and genotype in commensal bacteria can reflect antimicrobial use in food animals. In addition, commensal E. coli are commonly isolated from animal intestinal content and feces. Therefore, commensal E. coli are one of the target bacterial species in AMR monitoring.²

To date, extended-spectrum beta-lactamase (ESBL)-producing E. coli have been increasingly isolated from humans and food animals.³ The ESBL producers exhibit resistance to new-generation cephalosporins and multiple antibiotics that are clinically important, and therefore, they have been suggested to be routinely monitored.

Plasmids are transferable genetic elements that are capable of accumulating many resistance genes simultaneously.⁴ The genetic elements play an important role in the horizontal transfer of resistance genes, leading to a widespread of AMR. Resistance plasmids have been reported to spread from food animals to humans through the food chain, and this phenomenon has become a serious public health concern.⁵ Therefore, it is essential to monitor and characterize plasmids to follow the emergence and spread of resistant bacteria and their AMR determinants.⁶

Plasmid-mediated quinolone resistance (PMQR) genes are increasingly detected worldwide. The presence of PMQR genes (e.g., qnrA, qnrB, or qnrS) may not confer quinolone resistance phenotype based on clinical breakpoints.⁵ However, PMQR genes may coexist with other resistance genes and could lead to the coselection of resistance to quinolone and other antibiotics, resulting in the emergence of MDR bacteria.^7,8 While the majority of ESBL genes are mediated by highly mobilizable plasmids, a transferable plasmid harboring ESBL and PMQR genes was previously reported.^1,5 In addition, the association between PMQR and class 1 integrons gene cassettes was previously demonstrated.⁹ Taken together, these observations highlight the role of PMQR genes in the coselection and spread of resistance to other antibiotics.

Class 1 integrons are one of the most common mobile genetic elements with the capability to capture resistance genes from the environment into their variable regions. The latter has placed class 1 integrons as an indicator of AMR evolution¹⁰ that has been suggested to be included in AMR monitoring.

Thailand is located in the center of Southeast Asia and bordered by four neighboring countries, of which the northeastern region is the largest area and shares its longest border with Lao People's Democratic Republic (PDR). Thailand and Lao PDR border trade markets have grown rapidly, with pig production being one of the most extensive market forces in these areas. As pigs and their meat products are one of the most important reservoirs of AMR,¹¹ the increase in the crossborder trading of pigs and their products poses a risk of resistant bacterial transfer between humans and food animals in and across the border area, which could spread to other parts of each country.¹² Monitoring and analysis of AMR in food animals and along the food chain are essential to understand the root causes and estimate the burden of AMR. A One Health approach should be implemented to strengthen the surveillance program and the strategic actions for the control and prevention of AMR. This study is aimed to examine the prevalence and genetics underlying AMR in E. coli isolated from pigs, pig carcasses, pork, and humans in Thailand and Lao PDR border provinces.

Materials and Methods

Sample collection and bacterial isolation

A total of 847 E. coli isolates were obtained from pigs, pig carcasses, pork, and humans in Thailand (n = 416) and Lao PDR (n = 431) border provinces during 2013–2018. The isolates were collected as part of our AMR monitoring project in the region and stored in the strain collection of the Department of Veterinary Public Health. The number of collected samples was regularly calculated based on a prevalence of 50% at 95% confidence level and 5% error. The sampling sites were located in four border provinces with crossing points between Thailand and Lao PDR, including Nong Khai-Vientiane and Mukdahan-Savannakhet of Thailand and Lao PDR, respectively. In each province, the sampling sites included one municipal pig slaughterhouse, one municipal fresh market, and one municipal hospital. The slaughterhouses were large-scale abattoirs with 80 and ≥200 pig culling capacity per day in Thailand and Lao PDR, respectively. The municipal markets selected were the largest in the provinces and located in the same area as the slaughterhouses. The municipal hospitals are the main local government hospitals in the provinces, while private hospitals are not common in these areas.

The fecal samples were obtained by rectal swabbing of dead pigs after bleeding but before the scalding process at the slaughterhouses. This was to minimize interruption of the slaughtering process and avoid heat damage on bacterial cells during the scalding process. The carcass samples were obtained by swabbing pig carcasses after the first wholesale cut that separated the whole carcass into two halves. One of the halves was swabbed from neck to bottom on the inside of red meat. The pork samples were obtained by swabbing ∼50 cm² area of pork cuts at retail markets.¹³ The sample collection at slaughterhouses and retail markets was performed by the sample collection team consisting of laboratory staff trained with the same protocol to ensure the consistency of sampling.

The human samples included self-collected stool samples from workers at slaughterhouses and butchers at retail fresh markets, and stool samples from diarrhea patients collected by on-duty nurses at the local hospitals. The research protocols involving human subjects were approved by the Ethics Committee of the Faculty of Medicine of Khon Kaen University, with the authorization ID: HE592162.

All collected samples were stored in an icebox and transported to shipping carriers immediately. If not possible, the samples were kept in a refrigerator at 4°C until transporting. All samples arrived at the laboratory within 24 hours after sampling.

The E. coli strains were isolated and biochemically confirmed using the Indole test according to the Bacteriological Analytical Manual.¹⁴ A single colony from each positive sample was collected.² All E. coli isolates were stored in 20% glycerol at −80°C.

Antimicrobial susceptibility test and ESBL-phenotype detection

Determination of minimum inhibitory concentrations (MICs) was performed in all E. coli isolates (n = 847) by using the twofold agar dilution method.¹⁵ The antimicrobial agents and their clinical breakpoints (in parentheses) are as follows: ampicillin (32 μg/mL), chloramphenicol (32 μg/mL), ciprofloxacin (4 μg/mL), gentamicin (8 μg/mL), streptomycin (32 μg/mL), sulfamethoxazole (512 μg/mL), tetracycline (16 μg/mL), and trimethoprim (16 μg/mL). E. coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853, and Staphylococcus aureus ATCC 29213 served as quality control strains. All antimicrobial agents were purchased from Sigma-Aldrich Chemicals Company (St. Louis, MO).

ESBL production was examined in all isolates using the standard disk diffusion method.¹⁵ An initial screening test was performed with three indicator cephalosporins, namely ceftazidime (30 μg), cefotaxime (30 μg), and cefpodoxime (10 μg). Isolates resistant to at least one of the indicator cephalosporins were subsequently confirmed for ESBL production using a phenotypic confirmatory test. A difference of ≥5 mm between the inhibition zone of the cephalosporin/clavulanic acid combination and corresponding cephalosporin disks alone was interpreted as a positive ESBL phenotype. All antimicrobial disks were purchased from Oxoid Limited (Oxoid^®, Hamshire, England, United Kingdom). E. coli ATCC 25922 was used as a quality control strain.

Polymerase chain reaction and DNA sequencing analysis

DNA template for polymerase chain reaction (PCR) was prepared using whole cell boiled lysate from all E. coli isolates (n = 847). The oligonucleotide primers used in this study are listed in Table 1. For nucleotide sequencing analysis, PCR amplicons were purified using Nucleospin^® Gel and PCR cleanup (Mccherey-Nagel) and then submitted to First Base Laboratories (Selangor Darul Ehsan, Malaysia), for sequencing. The DNA sequences obtained were analyzed with Chromas programs and compared with the GenBank database using the BLAST algorithm available on the National Center for Biotechnology Information (NCBI) website. The DNA sequences obtained were deposited in the NCBI GenBank database. The genes and accession numbers are as follows: dfrA25, MT416084; aadA1, MT409422; aadA2, MT409423; dfrA1-aadA1, MT416086; aadA2-linF, MT416087; dfrA12-aadA2, MT409424; dfrA17-aadA5, MT416083; dfrA7, MT416085; bla_CTX-M55, MT409402-MT409418; bla_CTX-M14, MT416566-MT416572; and bla_CTX-M27, MT409419-MT409421.

Table 1.

Primers Used in This Study

Target	Primer	Amplicon size (bp)	Primer sequence (5′–3′)	References
Class 1 integrons intI1	Int-F	497	CCTGCACGGTTCGAATG	Chuanchuen et al.¹⁶
Class 1 integrons intI1	Int-R	497	TCGTTTGTTCGCCCAGC	Chuanchuen et al.¹⁶
Variable region	5′-CS	Variable	GGCATCCAAGCAGCAAG	Levesque et al. (1995)¹⁷
Variable region	3′-CS	Variable	AAGCAGACTTGACCTGA	Levesque et al. (1995)¹⁷
QRDR
gyrA	gyrA-F	436	GCTGAAGAGCTCCTATCTGG	Chuanchuen and Padungtod¹⁸
gyrA	gyrA-R	436	GGTCGGCATGACGTCCGG	Chuanchuen and Padungtod¹⁸
parC	parC-F	390	GTACGTGATCATGGATCGTG	Chuanchuen and Padungtod¹⁸
parC	parC-R	390	TTCCTGCATGGTGCCGTCG	Chuanchuen and Padungtod¹⁸
PMQR
qnrA	qnrA-F	516	ATTTCTCACGCCAGGATTTG	Stephenson et al.²⁰
qnrA	qnrA-R	516	GATCGGCAAAGGTTAGGTCA	Stephenson et al.²⁰
qnrB	qnrB-F	469	GATCGTGAAAGCCAGAAAGG	Stephenson et al.²⁰
qnrB	qnrB-R	469	ACGATGCCTGGTAGTTGTCC	Stephenson et al.²⁰
qnrS	qnrS-F	417	ACGACATTCGTCAACTGCAA	Stephenson et al.²⁰
qnrS	qnrS-R	417	TAAATTGGCACCCTGTAGGC	Stephenson et al.²⁰
qepA	qepA-F	199	GCAGGTCCAGCAGCGGGTAG	Yamane et al.²¹
qepA	qepA-R	199	CTTCCTGCCCGAGTATCGTG	Yamane et al.²¹
aac(6′)-Ib-cr	aac(6′)-Ib-F	482	TTGCGATGCTCTATGAGTGGCTA	Park et al.¹⁹
aac(6′)-Ib-cr	aac(6′)-Ib-R	482	CTCGAATGCCTGGCGTGTTT	Park et al.¹⁹
ESBLs
bla_CTX-M	blaCTX-M-F	585	CGATGTGCAGTACCAGTAA	Batchelor et al.²³
bla_CTX-M	blaCTX-M-R	585	AGTGACCAGAATCAGCGG	Batchelor et al.²³
bla_TEM	blaTEM-F	964	GCGGAACCCCTATTT	Hasman et al.²²
bla_TEM	blaTEM-R	964	TCTAAAGTATATATGAGTAAACTTGGTCT	Hasman et al.²²
bla_SHV	blaSHV-F	854	TTCGCCTGTGTATTATCTCCCTG	Hasman et al.²²
bla_SHV	blaSHV-R	854	TTAGCGTTGCCAGTGYTG	Hasman et al.²²
CTXM subgroup 1^a	MultiCTXMGp1-F	688	TTAGGAARTGTGCCGCTGYA^b	Dallenne et al.²⁴
CTXM subgroup 1^a	MultiCTXMGp1-R	688	CGATATCGTTGGTGGTRCCAT^b	Dallenne et al.²⁴
CTXM subgroup 2^c	MultiCTXMGp2-F	404	CGTTAACGGCACGATGAC	Dallenne et al.²⁴
CTXM subgroup 2^c	MultiCTXMGp2-R	404	CGATATCGTTGGTGGTRCCAT^b	Dallenne et al.²⁴
CTXM subgroup 8/25^d	CTX-M group 8/25-F	326	AACRCRCAGACGCTCTAC^b	Dallenne et al.²⁴
CTXM subgroup 8/25^d	CTX-M group 8/25-R	326	TCGAGCCGGAASGTGTYAT^b	Dallenne et al.²⁴
CTXM subgroup 9^e	CTX-M group 9-F	850	GTGACAAAGAGAGTGCAACGG	Sabate et al.²⁵
CTXM subgroup 9^e	CTX-M group 9-R	850	ATGATTCTCGCCGCTGAAGCC	Sabate et al.²⁵
bla_CTX-M15	blaCTX-M15-F	996	CACACGTGGAATTTAGGGACT	Muzaheed et al.²⁶
bla_CTX-M15	blaCTX-M15-R	996	GCCGTCTAAGGCGATAAACA	Muzaheed et al.²⁶
PBRT
Multiplex 1	HI1-F	471	GGAGCGATGGATTACTTCAGTAC	Carattoli et al.²⁸
	HI1-R	471	TGCCGTTTCACCTCGTGAGTA
	HI2-F	644	TTTCTCCTGAGTCACCTGTTAACAC
	HI2-R	644	GGCTCACTACCGTTGTCATCCT
	I1-F	139	CGAAAGCCGGACGGCAGAA
	I1-V	139	TCGTCGTTCCGCCAAGTTCGT
Multiplex 2	X-F	376	AACCTTAGAGGCTATTTAAGTTGCTGAT	Carattoli et al.²⁸
	X-R	376	TGAGAGTCAATTTTTATCTCATGTTTTAGC
	L/M-F	785	GGATGAAAACTATCAGCATCTGAAG
	L/M-R	785	CTGCAGGGGCGATTCTTTAGG
	N-F	559	GTCTAACGAGCTTACCGAAG
	N-R	559	GTTTCAACTCTGCCAAGTTC
Multiplex 3	FIA-F	462	CCATGCTGGTTCTAGAGAAGGTG	Carattoli et al.²⁸
	FIA-R	462	GTATATCCTTACTGGCTTCCGCAG
	FIB-F	702	GGAGTTCTGACACACGATTTTCTG
	FIB-R	702	CTCCCGTCGCTTCAGGGCATT
	W-F	242	CCTAAGAACAACAAAGCCCCCG
	W-R	242	GGTGCGCGGCATAGAACCGT
Multiplex 4	Y-F	765	AATTCAAACAACACTGTGCAGCCTG	Carattoli et al.²⁸
	Y-R	765	GCGAGAATGGACGATTACAAAACTTT
	P-F	534	CTATGGCCCTGCAAACGCGCCAGAAA
	P-R	534	TCACGCGCCAGGGCGCAGCC
	FIC-F	262	GTGAACTGGCAGATGAGGAAGG
	FIC-R	262	TTCTCCTCGTCGCCAAACTAGAT
Multiplex 5	A/C-F	465	GAGAACCAAAGACAAAGACCTGGA	Carattoli et al.²⁸
	A/C-R	465	ACGACAAACCTGAATTGCCTCCTT
	T-F	750	TTGGCCTGTTTGTGCCTAAACCAT
	T-R	750	CGTTGATTACACTTAGCTTTGGAC
	FIIS-F	270	CTGTCGTAAGCTGATGGC
	FIIS-R	270	CTCTGCCACAAACTTCAGC
Simplex 1	FrepB-F	270	TGATCGTTTAAGGAATTTTG	Carattoli et al.²⁸
Simplex 1	FrepB-R	270	GAAGATCAGTCACACCATCC	Carattoli et al.²⁸
Simplex 2	K-F	160	GCGGTCCGGAAAGCCAGAAAAC	Carattoli et al.²⁸
Simplex 2	K-R	160	TCTTTCACGAGCCCGCCAAA	Carattoli et al.²⁸
Simplex 3	B/O-F	159	GCGGTCCGGAAAGCCAGAAAAC	Carattoli et al.²⁸
Simplex 3	B/O-R	159	TCTGCGTTCCGCCAAGTTCGA	Carattoli et al.²⁸

Group 1 includes CTX-M-1, -3, -10 to -12, -15, -22, -23, -28, -29, and -30.

Y = T or C; R = A or G; S = G or C; D = A, G, or T.

Group 2 includes CTX-M-2, -4 to -7, and -20.

Group 8/25 includes CTX-M-8, CTX-M-25, CTX-M-26, and CTX-M-39 to CTX-M-41.

Group 9 includes CTX-M-9, -14, -16 to -19, -21, and -27.

ESBLs, extended-spectrum beta-lactamases; PBRT, polymerase chain reaction-based replicon typing; PMQR, plasmid-mediated quinolone resistance.

Characterization of class 1 integrons

All E. coli isolates were screened for the presence of intl1 using PCR with specific primers, Int-F and Int-R.¹⁶ The int1-positive E. coli isolates (Thailand, n = 200 and Lao PDR, n = 194) were characterized for inserted-gene cassettes using PCR and primers in the 5′ conserved segment (5′-CS) and the 3′-CS.¹⁷ The CS-PCR amplicons were grouped based on their size, and the representative(s) of each group were submitted for nucleotide sequencing. The CS-PCR amplicons of the same size were further analyzed using restriction digestion with at least two different restriction endonuclease enzymes based on the nucleotide sequencing results, including BglI, Bsh1285I, NcoI, ClaI, DraI, EcoRV, and EcoRI (i.e., aadA1, dfrA1-aadA1, aadA2-linF, dfrA12-aadA2, and dfrA17-aadA5). The amplicons with the same restriction digestion patterns were considered identical. Finally, the CS-PCR amplicons with the same size that yielded different restriction patterns were submitted for DNA sequencing (dfrA25 and dfrA7).

Examination of fluoroquinolone resistance mediating mechanisms

All the ciprofloxacin-resistant E. coli (n = 38) were examined for mutations in gyrA and parC using PCR and DNA sequencing with specific primers, gyrA-F/gyrA-R and parC-F/parC-R, respectively.¹⁸ Three ciprofloxacin-susceptible isolates were selected and used as controls. The nucleotide sequences were compared with the published gyrA (GenBank accession No. X06373) and parC (GenBank accession No. M58408) sequences.

The PMQR genes were screened in all the isolates using PCR with specific primers, namely qnrA, qnrA-F/qnrA-R; qnrB, qnrB-F/qnrB-R; qnrS, qnrS-F/qnrS-R; aac(6′)-Ib-cr, aac(6′)-Ib-F/aac(6′)-Ib-R; and qepA, qepA-F/qepA-R as described previously.^19–21

Detection of ESBL-encoding genes

The presence of three β-lactamase gene groups was detected in the ESBL-positive isolates (n = 29) from Thailand (n = 15) and Lao PDR (n = 14) using specific primers, namely bla_TEM (blaTEM-F/blaTEM-R), bla_SHV (blaSHV-F/blaSHV-R), and bla_CTX-M (blaCTX-M-F/blaCTX-M-R).^22,23 The E. coli isolates positive for bla_CTX-M were further investigated to determine the specific CTX-M subgroups using specific primers, namely CTX-M1 (MultiCTXMGp1-F/MultiCTXMGp1-R), CTX-M2 (MultiCTXMGp2-F/MultiCTXMGp2-R), CTX-M9 (CTX-M group 9-F/CTX-M group 9-R), and CTX-M8/25 (CTX-M group 8/25-F/CTX-M group 8/25-F).^24,25 The E. coli isolates positive for CTX-M1 group were tested for the presence of bla_CTX-M15 using the primers, blaCTX-M15-F/blaCTX-M15-R.²⁶ The PCR amplicons were purified and confirmed through DNA sequencing.

Conjugation experiments

Horizontal transfer of resistance plasmid was examined using the biparental mating technique as described previously.²⁷ All E. coli isolates carrying class 1 integrons with resistance gene cassettes or harboring β-lactamase genes were used as donors. Spontaneous rifampicin-resistant Salmonella Enteritidis (SE12) strains (rif^r SE12; MIC = 256 μg/mL) were used as recipients.²⁷ In brief, the overnight culture of the donor and recipient strains was diluted by adding 80 μL of culture to 4 mL fresh Luria Bertani broth (Difco^®) and grown at 37°C to the log phase. The donor and recipient cultures were mixed at a 1:1 ratio in a microcentrifuge. The bacterial cells were collected through centrifugation at 8,000 rpm for 1 minute, placed on a 0.45-μm-pore-size filter (Millipore^™, Merck) on LB agar plates, and incubated at 37°C overnight. The conjugation mixture was scraped and washed from the filter into a fresh microcentrifuge with 0.9% NaCl solution. The conjugation cells were collected, resuspended in 200 μL of 0.9% NaCl solution, and spread onto LB agar plates containing a combination of rifampicin (32 μg/mL) and the corresponding antibiotic. They were further confirmed on brilliant green agar and xylose lysine deoxycholate agar (Difco) containing one of the following antibiotics: ampicillin (100 μg/mL), streptomycin (50 μg/mL), and trimethoprim (25 μg/mL). The presence of corresponding class 1 integrons with resistance gene cassettes or β-lactamase genes was detected using PCR as described above. The Salmonella transconjugants were examined for plasmid incompatibility (Inc) groups using PCR-based replicon typing (PBRT) as described below.

Plasmids replicon typing

All the E. coli isolates were examined for Inc groups using a PBRT.²⁸ Eighteen genes specific for plasmid Inc groups were screened using five multiplex PCRs (i.e., HI1/HI2/I1-Iγ, X/L-M/N, FIA/FIB/W, Y/P/FIC, and A-C/T/FIIA) and three simplex PCRs (i.e., F, K, and B/O).

Statistical analysis

The chi-squared test with SPSS version 22.0 (IBM Corporation) program was used to compare the AMR phenotype and genotype. A p-value of <0.05 was considered statistically significant.

Results

AMR of the E. coli isolates (n = 847)

Overall, the majority of E. coli isolates (76.15%) were resistant to at least one antimicrobial agent. Sixty-seven percent of the isolates were MDR (being resistant to at least three different antimicrobial classes).

In Thailand, most E. coli isolates were resistant to at least one antimicrobial agent (88.34%) and MDR (69.7%). High resistance rates were observed for ampicillin (80.8%), tetracycline (68.3%), sulfamethoxazole (57.2%), and trimethoprim (54.8%) (Table 2). When considering sample sources, the E. coli isolates of pig origin (i.e., pigs, pig carcasses, and pork) were commonly resistant to ampicillin (84.1%), tetracycline (71.7%), sulfamethoxazole (61.3%), and trimethoprim (58.7%). The human isolates were frequently resistant to ampicillin (64.3%) and tetracycline (51.4%) (Table 2). The resistance rates to all antimicrobials, except ciprofloxacin, in the E. coli of pig origin were higher than those in the human isolates. MDR was more common in the isolates of pig origin than in the human isolates, of which the highest proportion was identified in the pig isolates (84.6%).

Table 2.

Resistance Rates of Escherichia coli from Pigs, Pig Carcasses, Pork, and Humans in Thailand and Lao PDR (n = 847)

Antimicrobial agent^†	No. of isolates (%)
	Thailand					Lao PDR					Grand total (n = 847)
	Pig (n = 123)	Carcass (n = 111)	Pork (n = 112)	Human (n = 70)	Total (n = 416)	Pig (n = 115)	Carcass (n = 132)	Pork (n = 104)	Human (n = 80)	Total (n = 431)	Grand total (n = 847)
MDR	104 (84.6)^a	81 (72.9)^b	77 (68.8)^b	32 (45.7)^c	290 (69.7)^*	88 (76.5)^e	87 (65.9)^ef	59 (56.7)^fg	39 (48.8)^g	273 (63.3)^**	563 (66.5)
Ampicillin	107 (86.9)^a	100 (90.1)^a	84 (75)^b	45 (64.3)^c	336 (80.8)^*	90 (78.3)^e	95 (72)^ef	66 (63.5)^fg	44 (55)^g	295 (68.4)^**	631 (74.5)
Chloramphenicol	61 (49.6)^a	37 (33.3)^b	41 (36.6)^ab	14 (20)^c	153 (36.8)	73 (63.5)^e	71 (53.8)^ef	48 (46.2)^f	23 (29)^g	215 (49.9)	368 (43.4)
Ciprofloxacin	6 (4.9)^a	3 (2.7)^a	5 (4.5)^a	3 (4.3)^a	17 (4.1)	5 (4.3)^ef	2 (1.5)^e	2 (1.9)^e	9 (11.3)^f	18 (4.2)	35 (4.1)
Gentamicin	12 (9.8)^a	9 (8.1)^a	18 (16.1)^a	11 (15.7)^a	50 (12)	19 (16.5)^e	17 (12.9)^e	9 (8.6)^e	7 (8.8)^e	52 (12.1)	102 (12)
Streptomycin	80 (65)^a	61 (55)^a	45 (40.2)^b	21 (30)	207 (49.8)^*	40 (34.8)^e	37 (28)^e	26 (25)^e	21 (26.3)^e	124 (28.8)^**	331 (39)
Sulfamethoxazole	89 (72.4)^a	65 (58.6)^b	58 (51.8)^bc	26 (37.1)^d	238 (57.2)	79 (68.7)^e	84 (63.6)^ef	56 (53.8)^fg	38 (47.5)^g	257 (59.6)	495 (58.4)
Trimethoprim	81 (65.9)^a	62 (55.9)^a	60 (53.6)^a	25 (35.7)^b	228 (54.8)	78 (67.8)^e	76 (57.6)^ef	54 (51.9)^fg	33 (41.3)^g	241 (55.9)	469 (55.3)
Tetracyclines	92 (74.8)^a	79 (71.2)^a	77 (68.8)^a	36 (51.4)^b	284 (68.3)^*	99 (86.1)^e	97 (73.5)^fg	75 (72.1)^gh	48 (60)^h	319 (74)^**	603 (71.2)
Ceftazidime	4 (3.3)^a	1 (0.9)^a	5 (4.5)^ab	10 (14.3)^b	20 (4.9)	10 (8.7)^e	7 (5.3)^e	4 (3.8)^e	9 (11.3)^e	30 (7)	50 (5.9)
Cefotaxime	7 (5.7)^a	4 (3.6)^a	6 (5.4)^a	26 (37.1)^b	43 (10.3)^*	15 (13)^e	19 (14.4)^e	11 (10.6)^e	22 (27.5)^f	67 (15.5)^**	110 (13)
Cefpodoxime	5 (4.1)^ab	2 (1.8)^a	5 (4.5)^ab	11 (15.7)^b	23 (5.5)	13 (11.3)^e	7 (5.3)^e	7 (6.7)^e	9 (11.3)^e	36 (8.4)	59 (7)

a–d

Values with different superscripts in the same row (for E. coli from Thailand) are statistically different (p ≤ 0.05).

e–h

Values with different superscripts in the same row (for E. coli from Lao PDR) are statistically different (p ≤ 0.05).

*,**

Indicate statistical difference (p ≤ 0.05) of total within the same row between E. coli from Thailand and Lao PDR.

†

Antimicrobial susceptibility of all antimicrobials was tested by agar dilution method, except ceftazidime, cefotaxime, and cefpodoxime that were tested by disk diffusion method.

MDR, multidrug resistant.

In Lao PDR, the majority of the E. coli isolates were resistant to at least one antimicrobial agent (80.1%) and MDR (63.3%). High resistance rates were observed for tetracycline (74%), ampicillin (68.4%), sulfamethoxazole (59.6%), and trimethoprim (55.9%) (Table 2). The E. coli isolates of pig origin were frequently resistant to tetracycline (77.2%), ampicillin (71.5%), sulfamethoxazole (62.4%), and trimethoprim (59.3%), while the human isolates were frequently resistant to tetracycline (60%) and ampicillin (55%) (Table 2). Resistance rates to all antimicrobials, except ciprofloxacin, were significantly higher in the pig isolates than those from pig carcasses, pork, and humans. The MDR phenotype was most common in the isolates from pigs (76.5%).

Class 1 integrons and resistance-gene cassettes

Overall, class 1 integrons were found in 48.4% of the E. coli isolates, including 23.6% from Thailand and 22.9% from Lao PDR. Forty-seven percent of the Thai isolates were positive for intl1, including the isolates from pigs (54.5%), pig carcasses (46.9%), pork (45.5%), and humans (29.1%). The intl1 gene was more common among the isolates from pig origin than those from humans (p = 0). Seven percent of the intl1-positive isolates carried class 1 integrons with variable region inserts of size ranging from 750 to 1,700 bp. Nucleotide sequencing analyses revealed seven gene cassettes (i.e., dfrA25, aadA1, aadA2, dfrA1-aadA1, aadA2-linF, dfrA12-aadA2, and dfrA17-aadA5). The most common gene cassette array was aadA1 (33.3%) (Table 3).

Table 3.

Characteristics of Class 1 Integrons Carrying Escherichia coli from Pigs, Pig Carcasses, Pork, and Humans in Thailand and Lao PDR Provinces (n = 847)

IP	Gene cassette	bp	Thailand (n = 416)			Lao PDR (n = 431)
IP	Gene cassette	bp	Isolate (No.)	PMQR	Replicon typing	Isolate (No.)	PMQR	Replicon typing
1	dfrA25	750	Pig carcass (1)	qnrB	—	—	—	—
2	dfrA7	750	—	—	—	Pig (1)	qnrS (1)	FIB (1), P (1), F_repB (1)
3	aadA1	1,000	Pig (6), pig carcass (1), pork (3)	qnrS (4)	I1 (2), FIA (1), FIB (2), P (1), Y (2), A/C (1), FIIS (1), F_repB (4)	Pig (3)	—	Y (1), F_repB (3)
				—	P (1)	Pig carcass (2)	—	F_repB (1)
				qnrS (1)	A/C (2), F_repB (2)	Human (1)	—	P (1), F_repB (1)
4	aadA2	1,000	Human (1)	—	—	—	—	—
5	dfrA1-aadA1	1,500	Pig (2)	—	FIC (1), F_repB (2)	Human (1)	—	FIB (1), FIC (1), F_repB (1)
			Pig carcass (1)	—	FIC (1)
			Pork (2)	—	I1 (1), FIC (2), F_repB (2)
			Human (2)	—	HI1 (1), FIC (2)
6	aadA2-linF	1,700	Pig (2)	qnrS (1)	HI1 (1), N (1), FIB (1), F_repB (1)	—	—	—
6	aadA2-linF	1,700	Pork (1)	—	—	—	—	—
7	dfrA12-aadA2	1,700	Pig carcass (3)	qnrS (1)	FIIS (1)	Pig (1)	—	—
7	dfrA12-aadA2	1,700	Human (1)	qnrS (1)	F_repB (1)	Pig (1)	—	—
8	dfrA17-aadA5	1,700	Pig (1)	qnrS (1)	F_repB (1)	Pig (1)	—	F_repB (1)
			Pig carcass (1)	qnrS (1)	F_repB (1)	Human (1)	—	F_repB (1)
			Pork (4)	qnrS (1)	Y (1), F_repB (1)

IP, integron profile; PMQR, plasmid-mediated quinolone resistance.

Among the isolates from Lao PDR, 44% were positive for intl1, including 56.5% from pigs, 45.5% from pig carcasses, 40.4% from pork, and 33.8% from humans. The prevalence of intl1-positive E. coli from pigs was significantly higher than that from pork and humans (p = 0.017 and 0.002, respectively). Three percent of the intl1-positive isolates harbored class 1 integrons with inserted-gene carcasses 750–1,700 bp in size. Four resistance gene cassette arrays (i.e., dfrA7, aadA1, dfrA12-aadA2, and dfrA17-aadA5) were identified, of which aadA1 was the most common (55.6%) (Table 3).

Eighty-nine percent of all intl1-positive E. coli isolates (n = 394) yielded a 150 bp variable region without inserted-gene cassettes, which corresponded to empty integrons. These included isolates from Thailand (84%) and Lao PDR (94.4%). The majority of the E. coli isolates harboring intl1 (87.6%) and those carrying empty integrons (87.7%, n = 351) were resistant to sulfamethoxazole.

Three E. coli isolates from Thailand harbored class 1 integrons on a transferable plasmid, including one pig isolate carrying class 1 integrons with dfrA1-aadA1, one pork isolate carrying class 1 integrons with dfrA1-aadA1, and one isolate from pig carrying class 1 integrons with aadA1.

Mutations in quinolone resistance-determining regions and the presence of PMQR genes

All ciprofloxacin-resistant isolates from Thailand (MIC range = 8–64 μg/mL) and Lao PDR (MIC range = 4–128 μg/mL) carried at least one point mutation C-248-T in QRDR of gyrA, leading to Ser-83-Leu amino acid substitute in GyrA (Table 4). The most common point mutations identified in gyrA were C-248-T (100%) leading to amino acid substitution Ser-83-Leu, followed by G-259-A leading to Asp-87-Asn (94.3%), and G-259-T leading to Asp-87-Tyr (2.8%). The most common point mutations in parC were A-298-G leading to amino acid changes in ParC, Thr-100-Ala (54.3%), and G-191-A, leading to Cys-64-Tyr (2.8%). No mutations were found in GyrA and ParC of the ciprofloxacin-susceptible isolates. Double mutations in GyrA, Ser-83-Leu, and Asp-87-Asn were common in the isolates from Thailand (100%) and Lao PDR (88.9%). Most isolates with double mutations in GyrA (54.3%) additionally harbored the amino acid substitution, Thr-100-Ala, in ParC. Only one Thai isolate with a double mutation in GyrA additionally had Cys-64-Tyr substitution in ParC. The isolates with amino acid substitution in both GyrA and ParC had varied ciprofloxacin MICs ranging from 8 to 64 μg/mL. The isolates with amino acid changes in only GyrA exhibited ciprofloxacin MICs ranging from 4 to 128 μg/mL.

Table 4.

Amino Acid Substitutions in the QRDR of GyrA and/or ParC in ciprofloxacin resistance Escherichia coli (n = 38)

Mutation		PMQR	Ciprofloxacin MIC (μg/mL)	No. of isolates
gyr A	parC	PMQR	Ciprofloxacin MIC (μg/mL)	Thailand (n = 21)	Lao PDR (n = 18)	Total
Ser-83-Leu, Asp-87-Asn	Thr-100-Ala	—	8–64	8	7	15
Ser-83-Leu, Asp-87-Asn	Thr-100-Ala	qnrS	8–16	2	1	3
Ser-83-Leu, Asp-87-Asn	Cys-64-Tyr	—	32	1	0	1
Ser-83-Leu, Asp-87-Asn	None	—	4–128	8	7	15
Ser-83-Leu, Asp-87-Asn	None	qnrS	16	2	0	2
Ser-83-Leu, Asp-87-Tyr	None	—	32	0	1	1
Ser-83-Leu	None	qnrS	4	0	1	1

MIC, minimum inhibitory concentration; PMQR, plasmid-mediated quinolone resistance.

Of all the PMQR genes tested, qnrA (0.1%), qnrB (0.1%), and qnrS (23%) were found. Twenty-six percent of the Thai isolates (ciprofloxacin MIC range = 0.0625–16 μg/mL) carried qnrS, including 31.7% (39/123) from pigs, 29.7% (33/111) from pig carcasses, 24.1% (27/112) from pork, and 25.7% (18/70) from humans. The qnrS-positive E. coli isolates from pigs (p = 0.014) and pig carcasses (p = 0.036) were significantly higher than those from humans. The qnrA and qnrB genes were found in only two E. coli isolates in Thailand: one from human (ciprofloxacin MIC, 0.125 μg/mL) and the other from pig carcass (ciprofloxacin MIC, 0.125 μg/mL).

In Lao PDR, the E. coli isolates (18%) from pigs (17.4%, 20/115), pig carcasses (18.2%, 24/132), pork (18.3%, 19/104), and humans (18.8%, 15/80) harbored qnrS. The ciprofloxacin MICs ranged between 0.0625 and 8 μg/mL. No significant difference in qnrS was observed between the isolates of pig origin and humans.

ESBL phenotype and β-lactamase-encoding genes

Twenty-nine E. coli isolates (3.4%) in this study produced ESBL (Table 5). Four percent (15/416) of the Thai isolates (n = 15) including pigs (n = 4), pig carcasses (n = 1), pork (n = 1), and humans (n = 8) were confirmed to be ESBL-producing strains. The prevalence of ESBL-producing E. coli in Thailand was not significantly different from that in Lao PDR. Only ESBL genes in the CTX-M group 1 (i.e., bla_CTX-M55) and group 9 (i.e., bla_CTX-M14 and bla_CTX-M27) were found. The CTX-M group 1, bla_CTX-M55, was predominant and found in the isolates from pigs (n = 4), pork (n = 1), and humans (n = 4). The CTX-M group 9 genes, bla_CTX-M14 and bla_CTX-M27, were additionally found in the isolates from pig carcasses (bla_CTX-M14, n = 1) and humans (bla_CTX-M14, n = 4 and bla_CTX-M27, n = 1). The bla_TEM-1 gene encoding broad-spectrum β-lactamase was also detected in 12 E. coli isolates positive for ESBL (pigs, n = 4; pig carcasses, n = 1; pork, n = 1; and humans, n = 6). The E. coli isolates carrying bla_CTX-M55 (n = 9) and those carrying bla_CTX-M14 (n = 2) additionally carried bla_TEM-1.

Table 5.

Characteristic of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli (n = 34)

Country	Sample source^a	β-lactamase	PMQR	Inc group	Transferability of β-lactamase gene
Thailand (n = 16)	Pig (n = 2)	bla_CTX-M55, bla_TEM-1	qnrS	F_repB, K	−
	Pig	bla_CTX-M55, bla_TEM-1	qnrS	F_repB	−
	Human (n = 2)	bla_CTX-M55, bla_TEM-1	qnrS	F_repB	+
	Human	bla_CTX-M55, bla_TEM-1	—	FIA	+
	Human	bla_CTX-M55, bla_TEM-1	qnrS	I1	+
	Pig	bla_CTX-M55, bla_TEM-1	qnrS	HI, Y, A/C, K	−
	Pork	bla_CTX-M55, bla_TEM-1	qnrS	HI	+
	Human	bla _CTX-M14	qnrS	F_repB, FIB, A/C	+
	Human	bla _CTX-M14	qnrS	F_repB, FIB	+
	Pig carcass	bla_CTX-M14, bla_{TEM −1}	qnrS	F_repB, FIB	−
	Human	bla _CTX-M14	—	F_repB	+
	Human	bla_CTX-M14, bla_{TEM −1}	qnrS	HI	−
	Human	bla _CTX-M27	—	F_repB, FIB	−
	Human	bla _{TEM −1}	qnrA	—	−
Lao PDR (n = 18)	Pig	bla_CTX-M55, bla_{TEM −1}	qnrS	F_repB	+
	Pig	bla _CTX-M55	qnrS	F_repB	+
	Pig	bla _CTX-M55	qnrS	Y	−
	Pig carcass	bla_CTX-M55, bla_TEM-1	qnrS	F_repB	−
	Pork	bla_CTX-M55, bla_{TEM −1}	qnrS	F_repB	−
	Pig	bla _CTX-M55	—	Y	−
	Human	bla_CTX-M55, bla_{TEM −1}	—	K	−
	Human	bla_CTX-M55, bla_{TEM −1}	—	F_repB, FIB	−
	Pork (n = 2)	bla_CTX-M14, bla_{TEM −1}	qnrS	N	−
	Pork	bla_CTX-M14, bla_{TEM −1}	qnrS	F_repB	−
	Human	bla_CTX-M27, bla_{TEM −1}	—	F_repB, FIB	−
	Human	bla_CTX-M27, bla_{TEM −1}	—	F_repB	−
	Pig	bla_CTX-M14, bla_{TEM −1}	qnrS	HI	−
	Pig (n = 2)	bla _{TEM −1}	—	F_repB	−
	Pork	bla _{TEM −1}	—	F_repB, K	−
	Human	bla _{TEM −1}	—	F_repB	−

Only n > 1 is indicated in parentheses.

+, Transfer; −, nontransfer; Inc, incompatibility; PMQR, plasmid-mediated quinolone resistance.

In Lao PDR, 3.2% (14/431) of the E. coli isolates were ESBL-producing strains, including the isolates from pigs (n = 5), pig carcasses (n = 1), pork (n = 4), and humans (n = 4). The ESBL genes found were bla_CTX-M55 of the CTX-M group 1 and bla_CTX-M14 and bla_CTX-M27 of the CTX-M group 9. The bla_CTX-M55 gene was found in eight isolates, including pigs (n = 4), pig carcasses (n = 1), pork (n = 1), and humans (n = 2). Six isolates carried the CTX-M group 9 genes, including bla_CTX-M14 (pig, n = 1 and pork, n = 3) and bla_CTX-M27 (human, n = 2). The bla_TEM-1 gene was detected (n = 15) and found in pigs (n = 4), pig carcasses (n = 1), pork (n = 5), and humans (n = 5).

Almost all ESBL-producing E. coli isolates in both countries additionally harbored both bla_TEM-1 and qnr (Table 5). Twelve ESBL-producing E. coli isolates of Thailand carried qnrS (80%), including the isolates from pigs (n = 4), pig carcasses (n = 1), pork (n = 1), and humans (n = 6). Nine ESBL-producing E. coli from Lao PDR harbored qnrS (64.3%) (9/14), including the isolates from pigs (n = 4), pig carcasses (n = 1), and pork (n = 4). One E. coli isolate from humans in Thailand coharbored qnrA and bla_TEM-1 (Table 5).

Ten E. coli isolates horizontally transferred ESBL genes. These included seven isolates carrying bla_CTX-M55 from pork (n = 1) and humans (n = 4) from Thailand and pigs (n = 2) from Lao PDR, and bla_CTX-M14 from humans in Thailand (n = 3). Based on the conjugation experiment, five E. coli isolates harbored bla_CTX-M55 and qnrS on Inc F_repB type plasmids that were cotransferred to the Salmonella recipient when ampicillin was used as a selective agent.

Plasmid replicon typing

Of all 847 isolates tested, 18 plasmid replicon types were identified (Table 6). The most common plasmid replicon type was IncF_repB (29.3%), followed by IncFIB (13%) and IncY (11.2%). Among the Thai isolates, 12 different plasmid replicons were identified, of which the most common replicon type was IncF_repB (33.7%). IncF_repB were mostly found among the isolates from humans (48.6%), followed by pigs (36.6%), pig carcasses (31.3%), and pork (23.4%). In addition, IncF_repB was predominantly detected in the E. coli isolates carrying resistance genes, including intI1 (39.5%), qnrS (39.3%), and ESBL genes (71.4%) (Table 7).

Table 6.

Distribution of Plasmid Replicon Type of Escherichia coli Isolates from Pigs, Pig Carcasses, Pork, and Humans in Thailand and Lao PDR Border Area (n = 847)

Plasmid replicon type	No. of isolates (%)										Total
	Thailand (n = 416)					Lao PDR (n = 431)
	Pigs	Pig carcass	Pork	Human	Total	Pigs	Pig carcass	Pork	Human	Total
HI 1	17 (4)	6 (1.4)	4 (1)	6 (1.4)	33 (7.9)	9 (2.1)	8 (1.9)	3 (0.7)	4 (0.9)	24 (5.6)	57 (6.7)
I 1	8 (1.9)	8 (1.9)	6 (1.4)	7 (1.7)	29 (7)	1 (0.2)	3 (0.7)	1 (0.2)	1 (0.2)	6 (1.4)	35 (4.1)
N	16 (3.8)	10 (2.4)	3 (0.7)	3 (0.7)	32 (7.7)	5 (1.2)	5 (1.2)	2 (0.5)	3 (0.7)	15 (3.5)	47 (5.5)
FIA	6 (1.4)	2 (0.5)	3 (0.7)	5 (1.2)	16 (3.8)	0	2 (0.5)	2 (0.5)	2 (0.5)	6 (1.4)	22 (2.6)
FIB	25 (6)	16 (3.8)	11 (2.6)	18 (4.3)	70 (16.8)	6 (1.4)	13 (3)	11 (2.6)	10 (2.3)	40 (9.3)	110 (13)
FIC	9 (2.2)	9 (2.2)	7 (1.7)	2 (0.5)	27 (6.5)	0	3 (0.7)	1 (0.2)	1 (0.2)	5 (1.2)	32 (3.8)
P	4 (1)	6 (1.4)	3 (0.7)	7 (1.7)	20 (4.8)	5 (1.2)	9 (2.1)	5 (1.2)	10 (2.3)	29 (6.7)	49 (5.8)
IncY	18 (4.3)	8 (1.9)	12 (2.9)	6 (1.4)	44 (10.6)	23 (5.3)	10 (2.3)	12 (2.8)	6 (1.4)	51 (11.8)	95 (11.2)
A/C	3 (0.7)	2 (0.5)	4 (1)	1 (0.2)	10 (2.4)	0	0	0	0	0	10 (1.2)
FIIS	6 (1.4)	10 (2.4)	7 (1.7)	1 (0.2)	24 (5.8)	0	0	1 (0.2)	0	1 (0.2)	25 (3)
F_repB	45 (10.8)^a	26 (6.3)^b	35 (8.4)^ab	34 (8.2)^ab	140 (33.7)^*	26 (6)^cd	27 (6.3)^d	34 (7.9)^c	21 (4.9)^cd	108 (25.1)^**	248 (29.3)
B/O	0	0	0	1 (0.2)	1 (0.2)	1 (0.2)	0	1 (0.2)	0	2 (0.5)	3 (0.4)

Values with different superscripts in the same row (for E. coli from Thailand) are statistically different (p ≤ 0.05).

Values with different superscripts in the same row (for E. coli from Lao PDR) are statistically different (p ≤ 0.05).

^,^**Indicate significant difference (p ≤ 0.05) of values within the same row between E. coli from Thailand and Lao PDR.

Table 7.

Plasmid Replicon Type in Escherichia coli Carrying Different Resistance Determinants (n = 491)

Resistance genes	Country	Sample source	Plasmid replicon type (%)
Resistance genes	Country	Sample source	HI 1	I 1	N	FIA	FIB	FIC	P	IncY	A/C	FIIs	FrepB	B/O
intI1 (n = 394)	Thailand	Pig	14.9	9	13.4	3	22.4	9	1.5	19.4	4.5	1.5	38.8	0
		Pig carcass	7.7	7.7	9.6	1.9	19.2	7.7	3.8	9.6	1.9	1.9	21.2	0
		Pork	5.9	7.8	3.9	3.9	11.8	9.8	0	13.7	7.8	2	52.9	0
		Human	20	3.3	6.7	13.3	20	6.7	13.3	20	0	0	50	0
	Subtotal		11.5	7.5	9	4.5	18.5	8.5	3.5	15.5	4	1.5	39.5	0
	Lao PDR	Pig	12.3	0	4.6	0	6.2	0	1.5	30.8	0	0	32.3	0
		Pig carcass	6.7	1.7	3.3	0	10	0	0	15	0	0	26.7	0
		Pork	7.1	0	2.4	0	9.5	0	0	23.8	0	0	50	0
		Human	7.4	0	7.4	3.7	14.8	3.7	7.4	14.8	0	0	48.1	0
	Subtotal		8.8	0.5	4.1	0.5	9.3	0.5	1.5	22.2	0	0	36.6	0
	Total		10.2	4.1	6.6	2.5	14	4.6	2.5	18.8	2	0.8	38.1	0
qnrS (n = 195)	Thailand	Pig	15.4	2.6	7.7	0	7.7	10.3	2.6	15.4	2.6	10.3	33.3	0
		Pig carcass	3	9.1	3	3	21.2	6.1	0	6.1	3	6.1	36.4	0
		Pork	3.7	0	0	7.4	14.8	7.4	0	18.5	0	7.4	37	0
		Human	27.8	11.1	11.1	0	22.2	0	5.6	5.6	5.6	0	61.1	0
	Subtotal		11.1	5.1	5.1	2.6	15.4	6.8	1.7	12	2.6	6.8	39.3	0
	Lao PDR	Pig	15	0	5	0	5	0	5	30	0	0	25	0
		Pig carcass	0	0	0	0	0	0	0	8.3	0	0	29.2	0
		Pork	5.3	0	10.5	0	0	5.3	0	15.8	0	5.3	52.6	5.3
		Human	26.7	6.7	13.3	0	0	0	0	13.3	0	0	6.7	0
	Subtotal		10.3	1.3	6.4	0	1.3	1.3	1.3	16.7	0	1.3	29.5	1.3
	Total		10.8	3.6	5.6	1.5	9.7	4.6	1.5	13.8	1.5	4.6	35.4	0.5
ESBLs (n = 30)	Thailand	Pig	25	0	0	0	0	0	0	25	25	0	75	0
		Pig carcass	0	0	0	0	100	0	0	0	0	0	100	0
		Pork	100	0	0	0	0	0	0	0	0	0	0	0
		Human	12.5	12.5	0	0	37.5	0	0	0	12.5	0	75	0
	Subtotal		21.4	7.1	0	0	28.6	0	0	7.1	14.3	0	71.4	0
	Lao PDR	Pig	20	0	0	0	0	0	0	20	0	0	40	0
		Pig carcass	0	0	0	0	0	0	0	0	0	0	100	0
		Pork	0	0	50	0	0	0	0	0	0	0	50	0
		Human	0	0	0	25	50	0	0	25	0	0	75	0
	Subtotal		7.1	0	14.3	7.1	14.3	0	0	14.3	0	0	57.1	0
	Total		14.3	3.6	7.1	3.6	21.4	0	0	10.7	7.1	0	64.3	0
Grand total			10.5	3.9	6.3	2.3	13	4.4	2.1	16.9	2.1	1.9	38.4	0.2

ESBLs, extended-spectrum beta-lactamases.

Eleven different replicon types were identified among the Laos isolates. The most predominant Inc group was IncF_repB (25.1%). The most commonly found Inc group among the isolates of pig origin and humans was IncF_repB (17.4% and 17.5%, respectively). The IncF_repB group was common among the E. coli isolates positive for intI1 (36.6%), qnrS (29.5%), and ESBL (57.1%) (Table 7).

Discussion

The high prevalence of MDR E. coli in pigs (80.7%), pig carcasses (69.1%), pork (63%), and humans (47.3%) in Thai–Lao PDR border provinces was highlighted in this study. The E. coli isolates were commonly resistant to ampicillin (74.5%), tetracycline (71.2%), sulfamethoxazole (58.4%), and trimethoprim (55.3%), in agreement with a previous study in the same area.¹³ This could be related to the types of antimicrobials used in pig production, which is influenced by the relatively low cost of the antibiotics.²⁹ It is noted that almost all AMR rates in the isolates from pig origin were higher than those from humans, in agreement with a previous study.³⁰ This suggests that there may be more frequent use of antimicrobial agents in pig farming than in humans. However, the exception was resistant to ciprofloxacin. Ciprofloxacin resistance rates in the pig (4%) and human (4.3%) isolates were not different in Thailand, but the rate was higher in the human isolates (11.3%) in Lao PDR. The results may reflect the frequent use of ciprofloxacin in humans in Lao PDR. The ciprofloxacin resistance rate in this study is higher than that in a previous study on Salmonella in the same area.^13,31 The possible explanation could be that E. coli are commensal bacteria and reside in the intestinal tract of the host pigs. Therefore, they have longer antimicrobial contact duration than Salmonella. It could also be because E. coli develop resistance to antimicrobials more easily and rapidly than Salmonella.³²

Almost half of the E. coli isolates from Thailand (47%) and Lao PDR (44%) harbored intI1, of which most were empty integrons (84% and 94.4% in Thailand and Lao PDR, respectively). All the E. coli isolates carrying empty integrons yielded a 150 bp amplicon of the variable region, indicating the absence of gene cassettes inserted between the conserved segments of the integron gene cassettes. These could be a result of losing gene cassettes in the absence of selection pressure,³³ or it could represent ancestral elements that have never acquired gene cassette inserts.³⁴ It was previously demonstrated that the lack of a 3′-conserved region can result in the existence of empty integrons and can be confirmed by the susceptibility to sulfamethoxazole.³⁵ However, this is not the case for the presence of empty integrons in this study. Some of the isolates positive for intl-1 or carrying empty integrons were susceptible to sulfamethoxazole. The possible explanation could be that the relevant integrons were carrying atypical conserved regions or nonfunctional sul genes in their conserved regions. However, the characterization of the 3′ conserved segments was not pursued in this study. Regardless, the empty integrons are available for the acquisition of new resistance genes to adapt to new selective pressure in a different environment. Thus, the limited use of antimicrobials could decrease the spread of resistance genes mediated by class 1 integrons among bacteria. In this study, the prevalence of intI1 in the isolates from pig origin was higher than that from humans, which is in agreement with a previous study,³⁶ indicating that appropriate antimicrobial use must be encouraged in pig production.

The most common resistance gene cassette among the isolates from both countries was aadA1, which was found to be located on a conjugative plasmid. In some E. coli isolates carrying class 1 integrons with dfrA1-aadA1, only intI1 was transferred to the Salmonella recipient. It is unusual that intI1 is located on more than one plasmid in the same bacterial cell. Therefore, the results are likely due to losing resistance gene cassettes when antimicrobial selective pressure is diluted in vitro.

The aadA2-linG gene cassette array was detected in the E. coli isolates from pigs and pork in Thailand (n = 3), similar to a previous study in Salmonella.¹³ Lincomycin is often used in combination with spectinomycin to treat swine dysentery and respiratory infection in pigs in Thailand. This possibly poses selective pressure on lincomycin-resistant bacteria including E. coli. Taken together, the observations suggest the possible sharing of the gene cassettes across bacterial species in this area.

The dfrA17-aadA5 and dfrA12-aadA2 cassette arrays were commonly found among the isolates from humans, pigs, and pork in this study. These gene cassette arrays have been previously reported in many countries (e.g., China, Taiwan, Korea, India, and Australia).³³ The dfrA12-aadA2 gene cassettes were previously identified in Salmonella from companion animals in Thailand.³⁷ These findings support the proposition that the resistance gene cassettes are ubiquitous and AMR is a borderless threat.

The association between class 1 integrons and qnrS has been previously reported.⁹ This is in agreement with this study, where almost half of the class 1 integrons carrying isolates additionally contained qnrS (26.1%) and exhibited MDR phenotype (98.1%). It is possible that class 1 integrons, qnrS, and nonintegrons borne resistance genes coexist on the same plasmid that could be coselected by a single antimicrobial agent.³⁸ However, plasmid characterization was not pursued in this study.

All ciprofloxacin-resistant isolates (n = 38) in this study carried the Ser-83-Leu mutation in GyrA, in agreement with previous studies.^39,40 Previous studies showed that the isolates containing many mutation points or additionally carrying the PMQR gene had a higher MIC level of quinolone drugs,^40,41 which is inconsistent with this study. For example, one isolate with only C-248-T in gyrA leading to Ser-83-Leu in GyrA and one isolate with C-248-T in gyrA leading to Ser-83-Leu, and G-259-A leading to Asp-87-Asn had ciprofloxacin MIC of 4 μg/mL. The isolates with amino acid changes in both GyrA and ParC without qnrS had ciprofloxacin MIC of 8 μg/mL, while those with qnrS had ciprofloxacin MIC of 8–16 μg/mL. Therefore, the contribution of mutations in GyrA and ParC and the presence of PMQR genes to a ciprofloxacin resistance level are dynamic and different from cell to cell.

The qnrS gene was the predominant PMQR gene, which is in agreement with previous studies.⁵ The qnrS gene is usually located on small mobilizable plasmids,⁴² and this may explain the current observation. It was previously shown that the presence of the qnr gene does not always confer fluoroquinolone resistance,³⁸ which is in agreement with this study where a human isolate with qnrA and a pig isolate with qnrB exhibited low ciprofloxacin MIC (0.125 μg/mL). In contrast, the presence of qnr genes was associated with the reduction in ciprofloxacin susceptibility in the E. coli clinical isolates.⁴¹ The latter may be a combination effect with other ciprofloxacin-resistance mechanisms, for example, the presence of porins, multidrug efflux systems, and DNA gyrase or topoisomerase mutations that were not investigated. Regardless, the dissemination of qnr genes plays a role in coselection for the MDR phenotype in bacteria.

The strong association between PMQR and ESBL genes has been previously reported due to their colocalization on the same plasmid,⁵ in agreement with this study. As most ESBL-producing isolates carried qnrS (19/30), all ESBL producers carrying qnrS exhibited the MDR phenotype. The results support the notion that ESBL genes are frequently located on large plasmids containing many resistance genes,⁴³ even though plasmids were not characterized in this study.

In this study, the ESBL-producing E. coli were more commonly found in humans (8.7%) than in the pig origin (2.3%), which is consistent with a previous study in China.⁴⁴ This could be a result of the limited use of cephalosporins in pig production in this area. The latter is mainly due to the high price of the antibiotics, which will affect the investment cost. In addition, bla_TEM-1, a β-lactamase gene, was commonly found, which is in agreement with a previous study in Thailand.⁴⁵

The bla_CTX-M55 gene was the most common ESBL gene detected in the isolates from pig origin and humans (58.6%), which is consistent with studies in other Asian countries, including Taiwan, Japan, and China.⁴⁶ However, these results are inconsistent with previous reports in European countries, where CTX-M1 was predominant among livestock.⁴⁷ In our study, all the E. coli isolates carrying bla_CTX-M-55 in Thailand harbored a non-ESBL TEM1, in agreement with a previous study in humans in Thailand.⁴⁸ The bla_CTX-M-14 gene was found at a lower rate (31%), which differs from a previous study reporting that bla_CTX-M-14 was most frequently identified in pigs.⁵ The bla_CTX-M55, bla_CTX-M14, and bla_TEM-1 genes were found to be located on transferable plasmids, supporting the dissemination of the genes in humans, pigs, pig carcasses, and pork in this area.

It is important to note that bla_CTX-M-55 and bla_CTX-M-14 were horizontally transferred by using ampicillin as a selective pressure in the conjugation experiment. A similar phenomenon was observed for the ESBL-producing isolates carrying both bla_CTX-M-55 and qnrS on the same plasmid (Table 5). This highlights the role of the old-generation antibiotic that has been widely used for a long time as a selective pressure for the new generation of clinically important antibiotics. The strategic actions in antimicrobial distribution and usage as a whole are essential.

In this study, IncF_repB plasmid was commonly identified in the isolates with resistance determinants, which is consistent with a study in China.⁴⁹ Replicon IncF_repB belonging to the IncF class has been previously identified as the most common Inc group in Enterobacteriaceae from different sources.⁵⁰ These plasmids have been associated with MDR bacteria, and shown to commonly confer resistance to β-lactams and quinolones.⁴⁹ In contrast, bla_CTX-M-1 that was the most common ESBL gene in European countries was usually located on IncI1.⁵¹ Therefore, it is likely that different variants of bla _CTX-M are related to different replicon type plasmids in different geographic regions.⁴²

In addition, the qnrS-positive isolates mostly carried IncF_repB plasmid (35.4%), in agreement with a previous study.⁴¹ As the E. coli isolates carrying both bla_CTX-M and qnrS were positive for only the IncF_repB class of plasmid replicon, it suggests that colocalization on the same plasmid and cotransfer of the genes contribute to the emergence and spread of MDR E. coli in this area. The results in this study revealed the high prevalence of MDR E. coli isolates in pigs, pig carcasses, pork, and humans. These isolates harbored a variety of AMR determinants, including class 1 integrons with resistance gene cassettes, PMQR genes, and ESBL genes. IncF_repB plasmid was commonly identified in intI, bla_CTX-M, and/or qnrS-carrying isolates. Cotransfer of the genes on the same transmissible plasmid was observed and contributed to the spread of MDR E. coli. The monitoring of AMR at the phenotype and genotype levels needs to be encouraged to allow epidemiological tracing of resistance patterns. The One Health approach to national AMR surveillance tracking in human and animal populations is required to strengthen the understanding and support control and prevention strategic actions of AMR.

Footnotes

Disclosure Statement

No competing financial interests exist.

Funding Information

This study was supported by Thailand Research Fund (TRF) Basic Research Grant BRG6080014, cofunded by the TRF, the Faculty of Veterinary Science, and Chulalongkorn University. It was partially supported by the 90th anniversary of the Chulalongkorn University fund (Ratchadaphiseksomphot Endowment Fund). C.P. is a recipient of a Royal Golden Jubilee PhD program PHD/0054/2558, cofunded by the TRF and Chulalongkorn University.

References

Awosile

, McClure

, Sanchez

, Rodriguez-Lecompte

J.C

, Keefe

, and Heider

L.C

. 2018. Salmonella enterica and extended-spectrum cephalosporin-resistant Escherichia coli recovered from Holstein dairy calves from 8 farms in New Brunswick, Canada. J. Dairy Sci. 101:3271–3284.

Marc

, Antonio

, Rene

, Isabelle

, Christopher

, Bernd-Alois

, Kees

, Dariusz

, Beatriz

, Ernesto

, Daniel

T.L

, and Pierre-Alexandre

. 2019. Technical specifications on harmonised monitoring of antimicrobial resistance in zoonotic and indicator bacteria from food-producing animals and food. EFSA J. 17:5709.

Al-Mayahie

S.M.G.

, and Al Kuriashy

J.J.H

. 2016. Distribution of ESBLs among Escherichia coli isolates from outpatients with recurrent UTIs and their antimicrobial resistance. J. Infect. Dev. Countr. 10:575–583.

Rozwandowicz

, Brouwer

M.S.M

, Fischer

, Wagenaar

J.A

, Gonzalez-Zorn

., Guerra

, Mevius

D.J

, and Hordijk

. 2018. Plasmids carrying antimicrobial resistance genes in Enterobacteriaceae. J. Antimicrob. Chemother. 73:1121–1137.

Liu

, Liu

, Wang

, Peng

, Li

, Zhou

, and Li

. 2018. Molecular characterization of extended-spectrum beta-lactamase-producing multidrug resistant Escherichia coli from swine in Northwest China. Front. Microbiol. 9:1756.

Rehman

M.U.

, Zhang

, Huang

, Iqbal

M.K

, Mehmood

, Luo

, and Li

. 2017. Characteristics of integrons and associated gene cassettes in antibiotic-resistant Escherichia coli isolated from free-ranging food animals in China. J. Food Sci. 82:1902–1907.

Shaheen

B.W.

, Nayak

, Foley

S.L

, and Boothe

D.M

. 2013. Chromosomal and plasmid-mediated fluoroquinolone resistance mechanisms among broad-spectrum-cephalosporin-resistant Escherichia coli isolates recovered from companion animals in the USA. J. Antimicrob. Chemother. 68:1019–1024.

Hong

, Hongbin

, Qiwen

, Minjun

, and Hui

. 2008. High prevalence of plasmid-mediated quinolone resistance genes qnr and aac(6)-Ib-cr in clinical isolates of Enterobacteriaceae from nine teaching hospitals in China. Antimicrob. Agents Chemother. 52:4268–4273.

Tomova

, Ivanova

, Buschmann

A.H

, Godfrey

H.P

, and Cabello

F.C.

. 2018. Plasmid-mediated quinolone resistance (PMQR) genes and class 1 integrons in quinolone-resistant marine bacteria and clinical isolates of Escherichia coli from an aquacultural area. Microb. Ecol. 75:104–112.

10.

Velhner

, Todorovic

, Grego

, Jovcic

, Prunic

, Stojanov

, and Kehrenberg

. 2018. Fluoroquinolone-resistant and extended-spectrum beta-lactamase producing Escherichia coli isolates from free-living wild animals. Vet. Microbiol. 223:168–172.

11.

Lalruatdiki

, Dutta

T.K

, Roychoudhury

, and Subudhi

P.K.

. 2018. Extended-spectrum beta-lactamases producing multidrug resistance Escherichia coli, Salmonella and Klebsiella pneumoniae in pig population of Assam and Meghalaya, India. Vet. World, 11:868–873.

12.

Thu

W.P.

, Sinwat

, Bitrus

A.A

, Angkittitrakul

, Prathan

, and Chuanchuen

. 2019. Prevalence, antimicrobial resistance, virulence gene, and class 1 integrons of Enterococcus faecium and Enterococcus faecalis from pigs, pork and humans in Thai-Laos border provinces. J. Glob. Antimicrob. Resist. 18:130–138.

13.

Sinwat

, Angkittitrakul

, Coulson

K.F

, Pilapil

F.M

, Meunsene

, and Chuanchuen

. 2016. High prevalence and molecular characteristics of multidrug-resistant Salmonella in pigs, pork and humans in Thailand and Laos provinces. J. Med. Microbiol. 65:1182–1193.

14.

Bacteriological Analytical Manual (BAM). 2017. Chapter 4: Enumeration of Escherichia coli and the Coliform Bacteria. 8th ed. Available at www.fda. gov/food/laboratory-methods-food/bam-4-enumeration-escherichia-coli-and-coliform-bacteria (accessed April 25, 2020).

15.

Clinical and Laboratory Standards Institute (CLSI). 2015. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Test for Bacteria Isolated from Animals; 3rd VET01-S3. Clinical and Laboratory Standards Institute, Wayne, PA.

16.

Chuanchuen

, Khemtong

, and Padungtod

. 2007. Occurrence of qacE/qacEDelta1 genes and their correlation with class 1 integrons in Salmonella enterica isolates from poultry and swine. Southeast Asian J. Trop. Med. Public Health, 38:855–862.

17.

Levesque

, Piche

, Larose

, and Roy

P.H.

. 1995. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 39:185–191.

18.

Chuanchuen

, and Padungtod

. 2009. Antimicrobial resistance genes in Salmonella enterica isolates from poultry and swine in Thailand. J. Vet. Med. Sci. 71:1349–1355.

19.

Park

C.H.

, Robicsek

, Jacoby

G.A

, Sahm

, and Hooper

D.C.

. 2006. Prevalence in the United States of aac(6’)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob. Agents Chemother. 50:3953–3955.

20.

Stephenson

, Brown

P.D

, Holness

, and Wilks

. 2010. The emergence of qnr-mediated quinolone resistance among Enterobacteriaceae in Jamaica. West Indian Med. J. 59:241–244.

21.

Yamane

, Wachino

J.I

, Suzuki

, and Arakawa

. 2008. Plasmid-mediated qepA gene among Escherichia coli clinical isolates from Japan. Antimicrob. Agents Chemother. 52:1564–1566.

22.

Hasman

, Mevius

, Veldman

, Olesen

, and Aarestrup

F.M.

. 2005. beta-Lactamases among extended-spectrum beta-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 56:115–121.

23.

Batchelor

, Hopkins

, Threlfall

E.J

, Clifton-Hadley

F.A

, Stallwood

A.D

, Davies

R.H

, and Liebana

. 2005. bla(CTX-M) genes in clinical Salmonella isolates recovered from humans in England and Wales from 1992 to 2003. Antimicrob. Agents Chemother. 49:1319–1322.

24.

Dallenne

, Da Costa

, Decre

, Favier

, and Arlet

. 2010. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 65:490–495.

25.

Sabate

, Tarrago

, Navarro

, Miro

, Verges

, Barbe

, and Prats

. 2000. Cloning and sequence of the gene encoding a novel cefotaxime-hydrolyzing beta-lactamase (CTX-M-9) from Escherichia coli in Spain. Antimicrob. Agents Chemother. 44:1970–1973.

26.

Muzaheed, Doi

, Adams-Haduch

J.M

, Endimiani

, Sidjabat

H.E

, S. Gaddad

, and Paterson

D.L

. 2008. High prevalence of CTX-M-15-producing Klebsiella pneumoniae among inpatients and outpatients with urinary tract infection in Southern India. J. Antimicrob. Chemother. 61:1393–1394.

27.

Khemtong

, and Chuanchuen

. 2008. Class 1 integrons and Salmonella genomic island 1 among Salmonella enterica isolated from poultry and swine. Microb. Drug Resist. 14:65–70.

28.

Carattoli

, Bertini

, Villa

, Falbo

, Hopkins

K.L

, and Threlfall

E.J.

. 2005. Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods, 63:219–228.

29.

Strom

, Halje

, Karlsson

, Jiwakanon

, Pringle

, Fernstrom

L.L

, and Magnusson

. 2017. Antimicrobial use and antimicrobial susceptibility in Escherichia coli on small-and medium-scale pig farms in north-eastern Thailand. Antimicrob. Resist. Infect. Control, 6:75.

30.

Tseng

S.P.

, Wang

S.F

, Kuo

C.Y

, Huang

J.W

, Hung

W.C

, Ke

G.M

, and Lu

P.L.

. 2015. Characterization of fosfomycin resistant extended-spectrum beta-lactamase-producing Escherichia coli isolates from human and pig in Taiwan. PLoS One, 10:e0135864.

31.

Whistler

, Sapchookul

, McCormick

D.W

, Sangwichian

, Jorakate

, Makprasert

, Jatapai

, Naorat

, Surin

, Koosakunwat

, Supcharassaeng

, Piralam

, Mikoleit

, Baggett

H.C

, Rhodes

, and Gregory

C.J.

. 2018. Epidemiology and antimicrobial resistance of invasive non-typhoidal Salmonellosis in rural Thailand from 2006–2014. PLoS Negl. Trop. Dis. 12:e0006718.

32.

Varga

, Rajic

, McFall

M.E

, Reid-Smith

R.J

, Deckert

A.E

, Pearl

D.L

, Avery

B.P

, Checkley

S.L

, and McEwen

S.A.

. 2008. Comparison of antimicrobial resistance in generic Escherichia coil and Salmonella spp. cultured from identical fecal samples in finishing swine. Can. J. Vet. Res. 72:181–187.

33.

Oliveira-Pinto

, Diamantino

, Oliveira

P.L

, Reis

M.P

, Costa

P.S

, Paiva

M.C

, Nardi

R.M.D

, Magalhaes

P.P

, Chartone-Souza

, and Nascimento

A.M.A

. 2017. Occurrence and characterization of class 1 integrons in Escherichia coli from healthy individuals and those with urinary infection. J. Med. Microbiol. 66:577–583.

34.

Clarisse

O.P.

, Cristiane

, Patrícia

L.O

, Mariana

P.R

, Patrícia

S.C

, Magna

C.P

, Regina

M.D.N

, Paula

P.M

, Edmar

C.S

, and Andrea

M.A.N

. 2017. Occurrence and characterization of class 1 integrons in Escherichia coli from healthy individuals and those with urinary infection. J. Med. Microbiol. 66:577–583.

35.

Mujeeb

U.R.

, Hui

, Shucheng

, Muhammad

K.I

, Khalid

, Houqiang

, and Jiakui

. 2017. Characteristics of integrons and associated gene cassettes in antibiotic-resistant Escherichia coli isolated from free-ranging food animals in China. J. Food Sci. 82:1902–1907.

36.

Phongpaichit

, Liamthong

, Mathew

A.G

, and Chethanond

. 2007. Prevalence of class 1 integrons in commensal Escherichia coli from pigs and pig farmers in Thailand. J. Food Prot. 70:292–299.

37.

Srisanga

, Angkititrakul

, Sringam

, Le Ho

P.T

, Vo

A.T.T

, and Chuanchuen

. 2017. Phenotypic and genotypic antimicrobial resistance and virulence genes of Salmonella enterica isolated from pet dogs and cats. J. Vet. Sci. 18:273–281.

38.

Ferreira

J.C.

, Penha Filho

R.A.C

, Kuaye

A.P.Y

, Andrade

L.N

, Berchieri Junior

, and Darini

. 2018. Identification and characterization of plasmid-mediated quinolone resistance determinants in Enterobacteriaceae isolated from healthy poultry in Brazil. Infect. Genet. Evol. 60:66–70.

39.

Johnning

, Kristiansson

, Fick

, Weijdegard

, and Larsson

D.G

. 2015. Resistance mutations in gyrA and parC are common in Escherichia communities of both fluoroquinolone-polluted and uncontaminated aquatic environments. Front. Microbiol. 6:1355.

40.

, Tian

, Zhang

, Jiang

, Dong

, Li

, Mao

, and Peng

. 2016. Prevalence and quinolone resistance of fecal carriage of extended-spectrum beta-lactamase-producing Escherichia coli in 6 communities and 2 physical examination center populations in Shanghai, China. Diagn. Microbiol. Infect. Dis. 86:428–433.

41.

Rezazadeh

, Baghchesaraei

, and Peymani

. 2016. Plasmid-mediated quinolone-resistance (qnr) genes in clinical isolates of Escherichia coli collected from several hospitals of Qazvin and Zanjan Provinces, Iran. Osong Public Health Res. Perspect. 7:307–312.

42.

Carattoli

2009. Resistance plasmid families in Enterobacteriaceae. Antimicrob. Agents Chemother. 53:2227–2238.

43.

Paterson, D.L. 2000. Recommendation for treatment of severe infections caused by Enterobacteriaceae producing extended-spectrum beta-lactamases (ESBLs). Clin. Microbiol. Infect. 6:460–463.

44.

Y.Y.

, Cai

J.C

, Zhou

H.W

, Chi

, Zhang

X.F

, Chen

W.L

, Zhang

, and Chen

G.X.

. 2013. Molecular typing of CTX-M-producing Escherichia coli isolates from environmental water, swine feces, specimens from healthy humans, and human patients. Appl. Environ. Microbiol. 79:5988–5996.

45.

Trongjit

, Angkititrakul

, Tuttle

R.E

, Poungseree

, Padungtod

, and Chuanchuen

. 2017. Prevalence and antimicrobial resistance in Salmonella enterica isolated from broiler chickens, pigs and meat products in Thailand-Cambodia border provinces. Microbiol. Immunol. 61:23–33.

46.

Norizuki

, Kawamura

, Wachino

J.I

, Suzuki

, Nagano

, Kondo

, and Arakawa

. 2018. Detection of Escherichia coli producing CTX-M-1-group extended-spectrum beta-lactamases from pigs in Aichi Prefecture, Japan, between 2015 and 2016. Jpn. J. Infect. Dis. 71:33–38.

47.

Hammerum

A.M.

, Larsen

, Andersen

V.D

, Lester

C.H

, Skovgaard Skytte

T.S

, Hansen

, Olsen

S.S

, Mordhorst

, Skov

R.L

, Aarestrup

F.M

, and Agersø

. 2014. Characterization of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli obtained from Danish pigs, pig farmers and their families from farms with high or no consumption of third- or fourth-generation cephalosporins. J. Antimicrob. Chemother. 69:2650–2657.

48.

Kiratisin

, Apisarnthanarak

, Saifon

, Laesripa

, Kitphati

, and Mundy

L.M.

. 2007. The emergence of a novel ceftazidime-resistant CTX-M extended-spectrum beta-lactamase, CTX-M-55, in both community-onset and hospital-acquired infections in Thailand. Diagn. Microbiol. Infect. Dis. 58:349–355.

49.

Yang

Q.E.

, Sun

, Li

, Deng

, Liu

B.T

, Fang

L.X

, Liao

X.P

, and Liu

Y.H.

. 2015. IncF plasmid diversity in multi-drug resistant Escherichia coli strains from animals in China. Front. Microbiol. 6:964.

50.

Odetoyin

B.W.

, Labar

A.S

, Lamikanra

, Aboderin

A.O

, and Okeke

I.N.

. 2017. Classes 1 and 2 integrons in faecal Escherichia coli strains isolated from mother-child pairs in Nigeria. PLoS One, 12:e0183383.

51.

Zurfluh

, Wang

, Klumpp

, Nuesch-Inderbinen

, Fanning

, and Stephan

. 2014. Vertical transmission of highly similar bla CTX-M-1-harboring IncI1 plasmids in Escherichia coli with different MLST types in the poultry production pyramid. Front. Microbiol. 5:519.