Abstract
Vibrio harveyi is a significant cause of infection in both marine animals and humans. It has been reported frequently in seafood-borne infections worldwide. This study was conducted to determine the potential health impact of the V. harveyi isolated from marine food fish cultured in Korea concerning their virulence and antimicrobial resistance. A total of 49 V. harveyi samples were isolated by biochemical tests and multiplex PCR. Phenotypic detection of virulence factors resulted DNase activity (81.63%), hemolysis (α = 75.51% and β = 12.25), gelatinase activity (71.43%), protease production (71.43%), phospholipase activity (65.31%), and lipase production (34.69%). Virulence genes, including VPI, tlh, tdh, toxR, VAC, and ctxAB, were detected in 57.14%, 44.90%, 36.73%, 22.45%, 12.24%, and 8.16% of the isolates, respectively. Resistance to ampicillin (77.55%), oxacillin (69.39%), nalidixic acid (53.06%), amoxicillin (46.94%), oxytetracycline (46.94%), colistin sulfate (34.69%), fosfomycin (34.69%), chloramphenicol (32.65%), streptomycin (32.65%), cephalothin (28.57%), oxytetracycline (26.53%), ceftriaxone (20.41%), erythromycin (14.29%), and cefoxitin (12.24%) was detected in disc diffusion assay. Most of the isolates were classified as multidrug resistant as they scored multiple antimicrobial resistance index ≥0.2. Furthermore, antimicrobial resistance genes tetB, qnrA, intI1 (Class 1 integron integrase), aac(6′)-Ib, blaSHV, blaCTX-M, strA-strB, tetA, aphAI-IAB, qnrC, qnrS, and blaTEM were found in 81.63%, 67.35%, 61.22%, 46.94%, 44.90%, 44.90%, 36.73%, 18.37%, 10.20%, 10.20%, 8.16% and 6.12% of the isolates, respectively. In conclusion, the development of antimicrobial resistance among V. harveyi will ultimately reduce the efficacy of antimicrobials used for treating and can favor the development of more virulent V. harveyi strains.
Introduction
Seafood is a valuable source of food that contains some desirable nutrient compounds. There are some health risks associated with seafood. Consumption of seafood in undercooked or raw conditions is the main reason for the health risk. The reason behind this problem is foodborne pathogens associated with seafood. Among those pathogens, the Vibrio spp. witnesses a considerable number of outbreaks all over the world. 1 The source of this pathogenic Vibrio spp. can be identified as cross contaminations in the supply chain or farm. Vibrios are the most important pathogens in cultured aquatic animals and are also frequently reported in supply chains.2,3
Vibrio is a genus composed of 142 species. They are gram-negative rod-shaped halophile bacteria. Most of these bacteria are abundant in marine organisms such as mollusks, fish, and crustaceans. 4 Vibrio spp. can be seen in the intestinal tracts of fish, gills, skin, and chitinous shell of the shellfish. 5 Several Vibrio spp were reported as a causative agent for seafood-borne outbreaks. In infections, Vibrio cholerae, V. parahaemolyticus, V. vulnificus, V. mimicus, V. fluvialis, V. furnissii, and V. alginolyticus are reported as human pathogens. 6 In aquatic animals, V. parahaemolyticus, V. alginolyticus, V. harveyi, V. owensii, and V. campbellii are the mostly reported Vibrio spp. 7
Outbreaks caused by V. harveyi have spread over various geographical areas. It has caused massive mortalities in the aquaculture systems of Japan, Australia, France, Korea, and China. The most prominent global issue is the antimicrobial resistance of these bacteria. As a result of the misuse of antimicrobials to control bacterial infection in aquatic organisms, antimicrobials have become ineffective in Vibrio infections. 8 V. harveyi has gained attention as an opportunistic pathogen to humans since the ongoing global warming will likely lead to a worldwide increase in Vibrio-associated infections. V. harveyi is a heterotrophic gram-negative luminous bacterium that survives in marine environments and shows a preference for tropical and temperate waters. It is known as a causative agent for diseases in humans and animals, including marine organisms. 9
Pathogenic bacteria show different stages in their infectious cycle, including entry of the pathogen, establishment and multiplication, avoidance from the host defenses, producing damage, and finally, exit from the host. Stages of these infectious cycles associated with virulence factors are the chemical products encoded by genes that support the pathogens to infect and damage the host. 10 Protease-, hemolysin-, and cytotoxin-like extracellular products are the major determinants that possess virulence properties in V. harveyi.
Recent statistics show that seafood consumption in Korea has been increased continuously. The seafood industry was used as a healthy alternative to red meat. 9 Marine finfish culture in Korea is dominated by Korean rockfish (Sebastes schlegelii), bastard halibut (Paralichthys olivaceus), yellowtail (Seriola quinqueradiata), mullet (Mugil cephalus), seabass (Lateolabrax latus), black seabream (Acanthopagrus schlegelii), red seabream (Pagrus major), puffer (Takifugu xanthopterus), and brown croaker (Michtys miiuy). 11 According to individual preference, Koreans consume fish in fresh, chilled, and frozen states. Koreans prefer to eat raw fish items. The reason is they assume fresh fish taste delicious than frozen or cooked fish. 12
V. harveyi is one of the causative agents of fish disease as well as seafood spoilage. It can cause gastrointestinal diseases, such as the presence of enterocele, abdominal swelling, and gastroenteritis. These bacteria have long been considered nonpathogenic to humans. However, several case reports about V. harveyi infections. Some cases were reported in the United States and Taiwan. In 1999, there were some reported cases in Korea. 13 The purpose of this study was to evaluate the virulence and antimicrobial resistance of V. harveyi isolated from the marine food fish cultured in Korea to increase alertness in the aquaculture and seafood industries.
Materials and Methods
Isolation and identification of V. harveyi
Fish samples were collected from fish farms in the southern coast of Korea (Yeosu, Wando, and Sacheon areas, Fig. 1) from 2017 to 2019 under a routine pathological examination. Each fish was individually packed in polythene bags and transported to the laboratory under chilled conditions. Bacteria were isolated from the kidney and liver tissues by direct streaking on the Thiosulfate Citrate Bile Salt Sucrose (TCBS) agar (MB Cell, LA, CA) plates and incubated for 24 hr at 37°C. Characteristic yellowish or greenish colonies on TCBS agar were stabbed and streaked onto triple sugar iron agar (TSI; MB Cell) tubes. Isolates that showed an alkaline or acidic slant with the acidic butt (positive result for TSI test) were subjected to an oxidase test. Oxidase-positive isolates were checked for sensitivity with a vibriostatic disc diffusion test using DD15 0129 (150 μg) discs (Oxoid, Hampshire, United Kingdom).

Sample collection areas of Vibrio harveyi.
Presumptively identified colonies were further identified by using PCR assays. Briefly, genomic DNA (gDNA) was extracted from isolates using the AccuPrep® genomic DNA extraction kit (Bioneer, Korea) according to the manufacturer's protocol. Initial PCR assay was performed to identify samples at the Vibrio genus level by detecting the partial recombinase A (recA) gene according to the previous study. 14 Finally, species-level identification was performed using the V. harveyi-specific primer pair VHT2-F3 (CTTGTTGCGCAGAAAGATGG) and VHT2-B3 (CCCGCTTCGTATAGACGC) (GenBank accession no: HQ449863.1) targeting topoisomerase I (topA) gene in V. harveyi.
The PCR assay was carried out in a 20 μL reaction mixture containing AccuPower® multiplex PCR premix (Bioneer), 0.5 μM of each primer, and 100 ng of template DNA. PCR conditions are as follows: initial denaturing at 94°C for 5 min, denaturing at 94°C for 45 sec, annealing at 65°C for 30 sec, extension at 72°C for 45 sec (35 cycles), and final extension at 72°C for 5 min. PCR products were electrophoresed on a 1.5% (W/V) agarose gel with RedSafe™ (Intron Biotechnology) and visualized under UV light.
Phenotypic pathogenicity tests for virulence properties
Identified V. harveyi isolates were tested with seven phenotypic pathogenicity tests. All test sample strains were inoculated in tryptic soy agar (TSA) (MB Cell) with 2% (wt/vol) NaCl. TSA supplemented with 0.5% (wt/vol) skim milk was used to detect caseinase production. 15 The positive results for the caseinase activity were identified with the presence of clear opaque halos around the grown bacterial colonies. Gelatin medium with 15% (wt/vol) gelatin, 3% (wt/vol) beef extract, and 5% (wt/vol) peptone was used to detect gelatinase. 16 Gelatin medium with bacteria was incubated, and the positive results were detected by the inability of solidifying the gelatin media. Phospholipase and lipase activity was detected using TSA supplemented with 5% (vol/vol) egg yolk emulsion and TSA supplemented with 1% (vol/vol) Tween 80.
Positive results of the test were detected with the presence of opaque halos around the bacterial growth. 16 For detecting DNase activity, DNase (MB Cell) test agar was used. After inoculation and incubation of bacteria, a 1 N HCl solution was added to well-grown colonies. Positive results were indicated by clear halos around the colonies. TSA with 0.08% (wt/vol) Congo red and 5% (wt/vol) sucrose was used to detect slime production. 17 The transformation of bacterial colonies to the black color was a proven formation of slime production. To detect hemolysin production, sheep blood was added to the TSA medium.
Detection of virulence-related genes
The PCR method was used to identify virulence genes. Genes were tested using 20 μL of mixture consisting of 0.2 μL of AmpONE Taq DNA polymerase (GeneAll, Seoul, Korea), 2 μL of Taq reaction buffer, 2 μL of dNTP mix, 1 μL of reverse and forward primer (Table 1), 1 μL of each template DNA, and 12.8 μL of PCR water. Amplified PCR gene mixtures were screened using 1.5% (wt/vol) agarose gel electrophoresis.
Oligo Sequences and PCR Conditions Used in the Study to Detect Virulence Genes
Antimicrobial susceptibility test
Different types of antimicrobial agents were used to assay the antimicrobial susceptibility of vibrios. A disc diffusion test was the method used to conduct an assay. Antimicrobial agent types were ampicillin (10 μg), amoxicillin (15 μg), tetracycline (30 μg), oxytetracycline (30 μg), colistin sulfate (10 μg), chloramphenicol (30 μg), streptomycin (10 μg), gentamycin (10 μg), kanamycin (30 μg), amikacin (30 μg), erythromycin (15 μg), nalidixic acid (30 μg), ciprofloxacin (50 μg), rifampicin (5 μg), trimethoprim (25 μg), ceftriaxone (30 μg), cephalothin (30 μg), oxacillin (5 μg), cefoxitin (30 μg), ticarcillin (75 μg), and fosfomycin (50 μg). The assay was conducted under the Clinical and Laboratory Standards Institute standard method. 24 Finally, the multiple antimicrobial resistance (MAR) index was calculated. 25
Detection of antimicrobial resistance genes
The PCR method was used to identify antimicrobial resistance-related genes. Genes were tested using 20 μL of mixture consisting of 0.2 μL of AmpONE Taq DNA polymerase (GeneAll), 2 μL of Taq reaction buffer, 2 μL of dNTP mix, 1 μL of reverse and forward primer (Table 2), 1 μL of each template DNA, and 12.8 μL of PCR water. Amplified PCR gene mixtures were screened using 1.5% (wt/vol) agarose gel electrophoresis.
Oligo Sequences and PCR Conditions Used in the Study to Detect Antimicrobial-Resistant Genes
Results
Identification of V. harveyi by PCR
From the samples, 49 V. harveyi strains were identified and used in this study. Table 3 summarizes the data related to every strain from the collected samples. It has presented in several fish species collected from the Yeosu, Wando, and Sacheon areas.
Sample Collection Data of Isolated Vibrio harveyi Strains
Phenotypic analysis for the virulence properties
The results of the seven phenotypic virulence tests are presented in Table 4. The highest number of positive isolates was reported in the DNase test (81.63%). Both protease and gelatinase activities were found in 71.43% of the isolates. From the tested isolates, 65.31% and 34.69% of the isolates demonstrated the production of phospholipase and lipase, respectively. α hemolysis was detected in 75.51% of the isolates, while complete β hemolysis was detected in 12.25% of the isolates. Slime production was not detected in any isolate.
Phenotypic Pathogenicity Profile of Vibrio harveyi
Prevalence of virulence genes
PCR assay for virulence gene screening is summarized in Table 5. Virulence-related genes VPI, tlh, tdh, toxR, VAC, and ctxAB were detected in 57.14%, 44.90%, 36.73%, 22.45%, 12.24%, and 8.16% of the isolates, respectively.
Virulence-Related Genes of Vibrio harveyi
Antimicrobial susceptibility
Antimicrobial susceptibility was determined using 21 different antimicrobial agents. V. harveyi isolates demonstrated a different level of resistance to different antimicrobial agents. The results are shown in Table 6. Resistance to ampicillin, oxacillin, nalidixic acid, amoxicillin, oxytetracycline, colistin sulfate, fosfomycin, streptomycin, cephalothin, oxytetracycline, ceftriaxone, erythromycin, cefoxitin, kanamycin, rifampicin, amikacin, tetracycline, and ciprofloxacin was observed in 77.55%, 69.39%, 53.06%, 46.94%, 46.94%, 34.69%, 34.69%, 32.65%, 32.65%, 28.57%, 26.53%, 20.41% 14.29%, 12.24%, 6.12%, 4.08%, 4.08%, and 2.04% of the isolates, respectively. All isolates were susceptible to gentamycin. According to the number of resisted antimicrobials by each isolate, 37 were identified as multidrug resistant (MAR index value ≥0.2).
Antimicrobial Susceptibility and Multiple Antimicrobial Resistance Index Values of Vibrio harveyi
antimicrobials = AMP, ampicillin; AMOX, amoxicillin; TET, tetracycline; COL, colistin sulfate; CMP, chloramphenicol; STR, streptomycin; FOS, fosfomycin; GEN, gentamycin; KAN, kanamycin; AMK, amikacin; ERY, erythromycin; NAL, nalidixic acid; CIP, ciprofloxacin; RD, rifampicin; TIC, ticarcillin; FOX, cefoxitin; OX, oxacillin; KF, cephalothin; CRO, ceftriaxone; TM, trimethoprim; OT, oxytetracycline. MAR, multiple antimicrobial resistance.
Ampicillin, oxacillin, nalidixic acid, amoxicillin, oxytetracycline, colistin sulfate, fosfomycin, streptomycin, cephalothin, oxytetracycline, ceftriaxone, erythromycin, and cefoxitin were observed as the most resisted antimicrobials by V. harveyi.
Prevalence of antimicrobial-resistant genes
Antimicrobial-resistant genes were detected as follows in PCR assays: tetB, qnrA, intI1 (Class 1 integron integrase), aac(6′)-Ib, blaSHV, blaCTX-M, strA-strB, tetA, aphAI-IAB, qnrC, qnrS, and blaTEM genes were detected in 81.63%, 67.35%, 61.22%, 46.94%, 44.90%, 44.90%, 36.73%, 18.37%, 10.20%, 10.20%, 8.16%, and 6.12% of the isolates, respectively (Table 7).
Prevalence of Antimicrobial Resistance Genes of Vibrio harveyi
Discussion
V. harveyi has been recognized as a common pathogen of many cultured aquatic animal species in the world. 35 In this study, 49 isolates of V. harveyi were isolated from three areas of South Korea and its pathogenic factors were examined to emphasize the possible risk associated with marine food fish and its consumer's health. V. harveyi is a pathogenic bacterium that possesses a series of virulence factors and multidrug-resistant properties. Generally, pathogenic bacteria inherit an infection cycle that has different steps with the help of virulence factors initiated by different gene translations to engage in the infection process. 10
Here, the production of protease, gelatinase, lipase, phospholipase, DNase, slime, and hemolysis activity (Table 3) is reported as extracellular products, which are the virulence factors of V. harveyi.36,37 DNase production and α hemolysis were the most prevalent. DNase is an extracellular endonuclease that aids in DNA hydrolysis reported in previous studies of Vibrio spp. of marine isolates.38,39 Hemolysin is recorded as a common exotoxin among pathogenic Vibrio spp. and it matched with prior studies of V. harveyi.16,40 Protease activity linked to severe bacterial toxicity was also detected. 41 Liu et al. reported protease activity in V. harveyi isolates. 16 Gelatinase can hydrolyze collagen, hemoglobin, and other biologically active peptides. 42 It was detected validating the results in a similar study from the past. 15
Lipolytic activities, including phospholipase and lipase, were reported as in previous V. harveyi studies. 43 It involves nutrition acquisition via membrane lipid breakdown. 44 Slime production involved in biofilm formation was not detected as Chari et al. observed a relatively low level of biofilm formation in V. harveyi. 45
Several virulence-related genes were screened as genotypic evidence for the phenotypic virulence factors. VAC, VPI, toxR, tdh, tlh, and ctxAB genes were detected as the genotypic virulence markers. The tdh gene is responsible for encoding thermostable direct hemolysin, which is used as a diagnostic indicator of Vibrio pathogenicity.46,47 Vibrio spp. isolated from fish samples detected VPI, ctxA, and tdh genes in another survey. 48 Recently, tdh, trh, and tlh genes were found in Vibrio spp. from fish. 49 The membrane-localized regulatory protein-encoding toxR gene plays an essential role in virulence and bacterial persistence. 50 It has been reported in V. parahaemolyticus and V. harveyi.51,52 Also, it can be a regulon to many other virulence-related genes. As a regulon, toxR can increase the production of ctxAB toxin.53,54
The VPI is an essential gene cluster that encodes special proteins connected with virulence properties. 55 Collagenase producing VAC gene involved in fish infections was detected slightly. 56 This gene was reported in shellfish-originated Vibrio spp. 57 We have identified all these virulence-related genes in different combinations. Hence, V. harveyi isolates in this study demonstrated the presence of both phenotypic and genotypic virulence markers.
Antimicrobial agents are the first solution in fish farming to get rid of bacterial infection. Antimicrobials can perform therapeutic and prophylactic reactions to prevent bacterial growth. 58 It was used excessively in shrimp culture systems to avoid diseases and production loss. However, this leads to several adverse effects in farm animals, humans, and ecosystems unknowingly. 59 The global trend of antimicrobial agent usage has shown an upcoming trend and increases the occurrence of antibiotic resistance among aquaculture systems. 60 As a result, the usage of antimicrobials in treatments for pathogenic bacterial infections is becoming an ineffective method in the medical field. Also, it can be a major threat to the seafood industry.61,62
Most of the V. harveyi isolates in this study showed resistance to the tested antimicrobials in different levels (Fig. 2). Resisted and intermediately resisted antimicrobials shown in Table 6 reveal that those antibiotic agents will be ineffective in the treatments of bacterial infections with V. harveyi. Most of the isolates can be classified as multidrug-resistant bacteria. Those isolates can be originated from fish samples subjected to frequent antibiotic treatments. 63

Antimicrobial susceptibility profile of Vibrio harveyi isolated from marine food fish cultured in Korea. Resistance, intermediate resistance, susceptible.
Antimicrobial-resistant V. harveyi has been reported from South Korea for cephalothin, streptomycin, and ampicillin. 64 Mohamad et al. identified antimicrobial-resistant V. harveyi from marine fish in Malaysia. 65 Moreover, V. harveyi isolates in Thailand and the Philippines have demonstrated a high level of resistance to ampicillin and oxytetracycline 66 Similarly, V. harveyi has demonstrated resistance to amikacin, ciprofloxacin, erythromycin, nalidixic, streptomycin, rifampicin, tetracycline, sulfamethoxazole, vancomycin, doxycycline, trimethoprim, streptomycin, kanamycin, sulfamethoxazole, furazolidone, cefixime, and chloramphenicol in different percentages previously.63,67 None of the isolates in this study reported resistance to gentamycin. This could be due to the lack of exposure to gentamycin as gentamycin may not have been used frequently in the places where the bacterial sample was taken. 68
Screening of antimicrobial resistance genes was done using 14 oligonucleotide primer pairs. The most abundant tetB gene belongs to tetracycline efflux genes and it encodes a protein that can transport tetracycline molecules outside of the cell. Hence, bacteria become resistant to tetracycline. 67 The tetA gene presented in few samples. This type of gene was reported in several other studies on Vibrio spp. by validating our results.69,70 The second-most identified qnrA gene confers the resistance to quinoline drug. Quinoline-resistant genes can reduce the concentration of drugs by using the efflux pump mechanism. 71 Among them, qnrC and qnrS genes were also presented in low prevalence. These genes were detected in an earlier study as antimicrobial-resistant genes in fish samples. 72
Class 1 integron integrase gene intl1 was also detected in a high frequency. This gene can perform horizontal gene transfer by facilitating antimicrobial resistance gene mobilization in bacteria. 73 Streptomycin resistance gene strA-strB is a plasmid-mediated gene pair that supports bacterial gene transfer. Zhao and Dang have reported a high prevalence of the strA-strB gene in V. harveyi. 74 Almost half of the bacterial isolates could amplify the aac(6′)-Ib gene belonging to aminoglycoside N-acetyltransferase encoding genes, which can transfer between bacteria. 75
β-lactamase producing genes, also called β-lactam resistance genes, are plasmid-mediated genes. Under this type, blaSHV and blaCTX-M were the most prevalent, while blaTEM was less detected. Similarly, it was presented in V. parahaemolyticus isolated from several fish samples. 76 It can alter the permeability of cell walls to antimicrobials and it facilitates the degradation of antimicrobials.77,78 The presence of antimicrobial resistance genes confirms that the antimicrobial resistance in V. harveyi is a possible challenge in the medical and seafood industries. Antimicrobial resistance genes are the units that can spread and develop antimicrobial resistance in other bacteria.
In the future, upcoming bacterial infections will not be able to overcome using antimicrobials if the emerging antimicrobial resistance is not controlled. Therefore, it is necessary to establish good preventive measures to avoid overusage and mishandling of antimicrobial agents in aquaculture. The prevalence of virulence and antimicrobial resistance determinants in bacteria isolated from farmed fish needs to be assumed as a major threat in the seafood industry. Our study reveals the importance of preventing V. harveyi colonization from controlling the possible risk of infection.
Footnotes
Acknowledgment
The authors wish to acknowledge Professor Shin Gee-Wook, Bio-Safety Research Institute and College of Veterinary Medicine, Chonbuk National University, Korea, for supplying the bacterial isolates used in this study.
Disclosure Statement
No competing financial interests exist.
Funding Information
No funding was received.
