Detection of the optrA Gene Among Polyclonal Linezolid-Susceptible Isolates of Enterococcus faecalis Recovered from Community Patients

Abstract

Dispersion of transferable oxazolidinone resistance genes among enterococci poses a serious problem to human health. Prompt detection of bacteria carrying these genes is crucial to avoid their spread to multidrug-resistant bacteria. The aim of the study was to describe the presence of optrA-positive isolates among enterococci in a Spanish hospital, and to determine their genetic context and location through whole genome sequencing. All enterococci recovered in a Spanish hospital (Hospital El Bierzo; HEB) from February to December 2018 (n = 443), with minimal inhibitory concentrations (MICs) to linezolid (LZD) ≥4 mg/L, were tested by polymerase chain reaction for the presence of cfr, optrA, and poxtA transferable genes. Only four Enterococcus faecalis isolates (0.9%) had LZD MICs ≥4 mg/L and none of them was positive for cfr or poxtA genes. However, the optrA gene was detected in three isolates collected from urine samples of community patients, whose genomes were sequenced and subjected to bioinformatics analysis. These isolates belonged to different clones: ST7, ST480, and ST585. In these three isolates, the optrA gene was located on plasmids, associated with IS1216 in different arrays. In one isolate, the optrA plasmid coexists with a second plasmid, which carried multiple resistance genes for different classes of antibiotics. Detection of optrA-positive E. faecalis isolates in the community is a matter of concern. The spread of these bacteria into hospital settings, particularly in those, such as the HEB, where vancomycin-resistant enterococci are endemic, should be avoided, to preserve the efficacy of the last-resort oxazolidinones.

Introduction

The oxazolidinones, linezolid (LZD) and tedizolid are effective last-resort antimicrobials for treating infections caused by multidrug-resistant (MDR) Gram-positive bacteria, including vancomycin-resistant enterococci (VRE).¹ Oxazolidinones inhibit protein synthesis at the initial stage by binding to the peptidyl transferase center of the bacterial ribosome. Oxazolidinone resistance among Gram-positive bacteria (enterococci and staphylococci) remains low and it is mainly mediated by chromosomal mutations in the V domain of the 23S ribosomal RNA (rRNA) gene.² However, in the latest years three new oxazolidinone resistance genes, which can be horizontally disseminated by plasmids: cfr-like, optrA, and poxtA, have been discovered.^3–6 The cfr-like gene encodes a 23S rRNA methyltransferase, which confers resistance to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A (PhLOPS_A phenotype).^3,6

The original variant of the cfr gene was first reported in a Staphylococcus sciuri isolate and was thereafter found in several Gram-positive and Gram-negative bacteria, being more prevalent in staphylococci.^3,6 New variants of this gene [cfr(B), cfr(C), cfr(D), and cfr(E)] have been already described, two of them [cfr(B) and cfr(D)] also in enterococcal isolates.^6,7 On the other hand, both optrA and poxtA code for ribosomal protection proteins of the ABC-F family, which confer resistance to oxazolidinones, phenicols, and also to tetracyclines in the case of poxtA.^4,5 The optrA gene was first reported in Enterococcus faecalis and E. faecium strains from humans and food-producing animals in China.⁵ Since then, isolates carrying this gene have been recovered from animal, human, and environmental samples, mainly in China but also in other countries of the Asia-Pacific region, Africa, North America, Latin America, and Europe (including Spain).^5,8–11

Lastly, poxtA gene was first reported in a clinical methicillin-resistant S. aureus isolate and subsequently in E. faecalis and E. faecium strains.^4,8 LZD-resistant Enterococcus, although uncommon, are increasingly being detected in Spain as well as in many other countries worldwide, and optrA has become the most prevalent mechanism of oxazolidinone resistance in E. faecalis.^2,6,8,12,13 The potential spread of these genes between MDR Gram-positive bacteria is a cause of concern, so a prompt detection of bacteria carrying them is required. Accordingly, the aim of the present study was to investigate the presence of transferable oxazolidinone-resistance genes among enterococci isolated from clinical samples from “Hospital El Bierzo” (HEB), a 400-bed teaching hospital in Northern Spain, where VRE are endemic.¹⁴ Additionally, the genomes of isolates positive for such genes were sequenced and subsequently analyzed.

Materials and Methods

Identification of LZD-resistant isolates

From February 2018 to December 2018 all enterococci with minimal inhibitory concentrations (MICs) to LZD ≥4 mg/L detected at the HEB were recovered. They were obtained from either clinical samples of inpatients or from samples sent to the hospital by primary health centers. Bacterial identification and antimicrobial susceptibility testing (AST) were performed with the MicroScan System (MicroScan; Beckman Coulter). The antimicrobials tested by broth microdilution with the MicroScan System included ampicillin, ciprofloxacin, daptomycin, gentamicin, levofloxacin, LZD, synercid, teicoplanin, tetracycline, and vancomycin. Enterococci with MICs of LZD ≥4 mg/L were tested for susceptibility to chloramphenicol by disk diffusion, and MICs of tedizolid were determined by E-test strips (Liofilchem s.r.l., Roseto degli Abruzzi, Italy).

All AST results were interpreted according to the Clinical and Laboratory Standards Institute guidelines.¹⁵ For all isolates, screening of cfr (original variant) and optrA genes was performed by polymerase chain reaction (PCR) as previously reported,¹⁶ and PCR detection of poxtA was carried out with primers poxtA-F (TTCCACCTCTAAGGGAACTTGTG) and poxtA-R (TATGCAGAGGAACAGCGGATT).¹⁷

Whole genome sequencing of isolates positive for transferable oxazolidinone resistance genes and bioinformatics analysis

The genomes of three E. faecalis isolates positive for a transferable oxazolidinone resistance gene (Efae-HEB1, Efae-HEB2, and Efae-HEB3) were sequenced using the Illumina platform, and bioinformatic analysis was performed. Genomic DNA was extracted with the GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich), following the manufacturer's instructions. Libraries (ca. 500 bp fragment size) were prepared with the TruSeq PCR-free DNA Sample Preparation Kit at the Plataforma de Genómica y Bioinformática, Centro de Investigación Biomédica, La Rioja (Spain), and sequenced on a HiSeq 2000 (Illumina) to generate 130–150 nt paired-end reads. Assembly of the reads into contigs was achieved with the VelvetOptimiser.pl script of the Velvet assembler implemented in PLACNETw. PLACNETw also distinguishes contigs belonging to the chromosome or to plasmids, hence facilitating plasmid reconstruction.¹⁸ The assembled contigs were annotated by the NCBI Prokaryotic Genome Annotation Pipeline (https://www.ncbi.nlm.nih.gov/genome/annotation_prok).

MultiLocus Sequence Typing (MLST), as well as identification of resistance determinants, comprising chromosomal mutations in the 23S RNA gene and acquired resistance genes, were accomplished in silico, using online tools, including MLST 2.0, LRE-Finder 1.0, ResFinder 4.1 (which identifies genes leading to LZD resistance, including optrA, poxtA, and all variants of cfr reported so far), and PlasmidFinder 2.1 from the Center for Genomic Epidemiology of the Technical University of Denmark,^19–24 in conjunction with PLACNETw.¹⁸ The genetic context of the oxazolidinone resistance genes was determined by detailed analysis of the annotated contigs using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The complete nucleotide sequence of two resistance plasmids found in one of the isolates (Efae-HEB2) was generated by assembling the contigs from each plasmid identified by PLACNET by PCR amplification (using the primers shown in Supplementary Tables S1 and S2), followed by Sanger sequencing of overlapping amplicons (performed at STAB VIDA, Lisbon, Portugal).

Accession numbers

The genomes of Efae-HEB1, Efae-HEB2, and Efae-HEB3, and plasmids pEfae-HEB2-1 and pEfae-HEB2-2, were deposited in the GenBank database under accession numbers JAAOEK000000000, JAAOEL000000000, JAAOEM000000000, OM574792, and OM574793, respectively. This study did not require institutional review board (IRB) approval.

Results and Discussion

Screening of transferable oxazolidinone resistance genes in clinical isolates of E. faecalis from community patients

During the period of study, a total of 443 enterococci were isolated and assigned to E. faecalis (n = 367) or E. faecium (n = 76). Only four isolates (0.9%) had LZD MICs ≥4 mg/L, and they were identified as E. faecalis resistant to chloramphenicol. Three of them (Efae-HEB1, Efae-HEB2, and Efae-HEB3), proved to be positive for the optrA gene, while neither poxtA nor any of the reported cfr variants were detected (Table 1). The fourth isolate, which did not contain any of the transferable oxazolidinone resistance genes tested, could not be further characterized because it was not kept in the strain collection of the hospital.

Table 1.

Clinical, Microbiological, and Molecular Features of optrA-Positive Enterococcus faecalis Isolates Detected During 2018 in a Spanish Hospital

Isolate	Isolation date	Sample	Sex/age	MLST	MICs (mg/L)											Resistance determinants	OptrA variant
Isolate	Isolation date	Sample	Sex/age	MLST	AMP	CIP	LVX	HLGR	SYN	TET	VAN	TEC	LZD	TZD	DAP	Resistance determinants	OptrA variant
Efae-HEB1	February 14	Urine	Female/57	ST480	≤1	>2	>4	≤500	>2	>8	≤1	≤1	4	1.5	≤0.5	erm(B), lsa(A), lnuB, ant(6)-Ib, tet(L), tet(M), dfrG, optrA , fexA	Tyr176Asp Thr481Pro
Efae-HEB2	June 4	Urine	Male/67	ST585	≤1	>2	>4	>500	>2	>8	≤1	≤1	4	2	1	erm(B), lsa(A), lsa(E), lnuB , aac(6′)-aph(2 " ) , ant(6)-Ia , aph(3′)-IIIa , aadE , apt , spw , sat4 , tet(L), tet(M), dfrG , optrA , fexA , cat	wt
Efae-HEB3	June 15	Urine	Male/69	ST7	≤1	1	≤1	≤500	>2	>8	≤1	≤1	4	1	2	erm(A), erm(B) lsa(A), Isa(E), lnuB , aph(3 ′ )-IIIa, tet(L), tet(M), optrA , fexA	Tyr176Asp Thr481Pro

Resistance determinants located in plasmids are highlighted in bold.

AMP, ampicillin; CIP, ciprofloxacin; DAP, daptomycin; HEB, Hospital el Bierzo; HLGR, high-level gentamicin resistance; LVX, levofloxacin; LZD, linezolid; MIC, minimal inhibitory concentration; MLST, multilocus sequence typing; SYN, synercid; TEC, teicoplanin; TET, tetracycline; TZD, tedizolid; VAN, vancomycin; wt, wild type.

According to the last results published by the SENTRY Antimicrobial Surveillance Program, the worldwide prevalence of LZD resistance in enterococci is very low, with only 26 optrA-positive E. faecalis isolates detected among a total of 26,648 enterococci (ca. 0.1%).⁸ This frequency is lower than the obtained in the present study (0.7% of the total enterococci), with three optrA-positive isolates obtained from urine samples of unrelated patients in the community suspected to suffer urinary tract infections (Table 1). The samples were sent to the HEB Microbiology laboratory from primary health centers to confirm the diagnosis and identify the etiological agent. None of the patients had antecedents of recent therapy with oxazolidinones, although two had received other antimicrobials, like quinolones, cefuroxime, or azithromycin in the last 3 months.

The isolates studied belonged to different clones, revealing a polyclonal spread of optrA-positive E. faecalis in the community. Efae-HEB1 and Efae-HEB-2, belonged to clones previously shown to carry the optrA gene, that is, ST480 and ST585, respectively.^{6,8–10,13,25–29} The remaining isolate (Efae-HEB3) was assigned to the new ST7, which is a single locus variant (affecting the pstS gene) of ST317.

The optrA genes and encoded proteins

After sequencing the genomes of the three isolates, the analysis of the amino acid sequences translated from the optrA genes identified two variants of the OptrA proteins (Table 1). The protein of Efae-HEB2 coincided with OptrA_E349, considered as wild-type since it is encoded by plasmid pE349, where the optrA gene was originally detected.⁵ In contrast, the OptrA proteins of Efae-HEB1 and Efae-HEB3 contain the Tyr176Asp and Thr481Pro substitutions corresponding to the DP variant previously reported in clinical isolates from hospitals in China^12,26,30 and recently found in Spain.⁶ Regardless of the variant, the three optrA-positive E. faecalis isolates had the same LZD MIC of 4 mg/L, which was previously associated with some but not all of the isolates producing either the wild-type protein or the DP variant in China. In fact, it has been already noticed that the number and type of amino acid substitutions reported so far in OptrA has little effect on the level of LZD resistance.³¹

It is noteworthy that both CLSI and EUCAST consider MICs >4 mg/L as “resistant,” while a MIC equal to 4 mg/L is regarded as “intermediate” by CLSI and “susceptible” by EUCAST.^15,32 According to this, the dispersal of the optrA gene among enterococci may well be underestimated if present in isolates with MIC of 4 mg/L, particularly if EUCAST breakpoints are used. The recent introduction of chloramphenicol in the AST panels for enterococci could aid the detection of transferable oxazolidinone resistance genes. Expert alert messages can be created in the automated AST systems if a Gram-positive bacterium shows MICs to LZD ≥4 mg/L together with chloramphenicol resistance. Bacteria, which fulfill these criteria, can be analyzed by multiplex-PCR for simultaneous detection of transferable oxazolidinone resistance genes.³³

Genetic context of the optrA genes

The optrA genes of the three isolates were located on plasmids, named pEfae-HEB1, pEfae-HEB2-1, and pEfae-HEB3. In the three plasmids, the fexA gene, encoding a chloramphenicol/florfenicol efflux protein of the major facilitator superfamily (MFS), was located upstream of optrA (Fig. 1). In pEfae-HEB1 and pEfae-HEB3, the optrA region was flanked by IS1216 elements placed in the same orientation, although in the latter plasmid the second copy was truncated. The DNA comprised between the two copies of the IS differed by the erm(A)-like gene, deleted and intact in pEfae-HEB1 and pEfae-HEB3, respectively, and by the ubiE gene (for ubiquinone/menaquinone C-methyltransferase), present in pEfae-HEB3 but not in pEfae-HEB1. The organization of the pEfae-HEB3 optrA region roughly coincides with that reported for p10-2-2, a plasmid carried by a pig isolate of E. faecalis ST59 from China in which two entire copies of IS1216 are nevertheless present (Fig. 1).²⁵

FIG. 1.

Comparison of the genetic environments of the optrA gene in plasmids pEfae-HEB1, pEfae-HEB2-1, and pEfae-HEB3 found in oxazolidinone-resistant Enterococcus faecalis isolates recovered from community patients in Spain. Plasmid pEfae-HEB2-1, which was fully sequenced, is shown in the upper part of the figure. Plasmid pEF10748 (accession No. MK993385) and the genetic environment of the optrA gene in plasmid p10-2-2 (accession No. KT862775) were included for comparison (Section: “Genetic context of the optrA genes”). The gray shading between regions reflects nucleotide sequence identities according to the scales shown at the right lower corner of the figure. Open reading frames are represented by arrows indicating the direction of transcription, and drawn to scale in different colors depending on their function: red, resistance; blue, DNA metabolism, including transposition, with the transposase of IS1216 highlighted by blue arrows with white filling; orange, conjugative transfer; green, other roles; gray, hypothetical proteins. HEB, Hospital El Bierzo.

In contrast, the structure of the pEfae-HEB1 optrA region does not exactly match that of any other published so far. Finally, in the case of pEfae-HEB2-1, a single copy of IS1216 was detected downstream of the optrA gene, but not at the opposite end, and neither erm(A) nor ubiE were found. The entire nucleotide sequence of pEfae-HEB2-1, which coexists with pEfae-HEB2-2 (Section: “Sequence analysis of pEfae-HEB2-2, a second plasmid of Efae-HEB2 carrying multiple antibiotic resistance genes”) in the same isolate, was determined (Fig. 1). pEfae-HEB2-1 consists of ca. 53.3 kb with a GC content of 35%, slightly lower than that of the E. faecalis chromosome (37.4%). It appears to be a sex pheromone-responsive plasmid closely related to pEF10748 (Fig. 1), a conjugative optrA plasmid with a high transfer frequency.²⁷ PlasmidFinder failed to identify the pEfae-HEB2-1 replicon, but a BLASTn search of its repA gene yielded 100% identity (with 100% coverage) with the repA gene of pEF10748 previously assigned to rep₉.²⁷

Like the former plasmid, pEfae-HEB2-1 contains multiple sex pheromone response genes, including traB, prgA, prgB, prgC, prgU, prgR, prgS, and prgT. Apart from pEF10748, pEfae-HEB2-1 has a high percentage of identity (more than 99.5%) with plasmids of E. faecalis collected from raw/frozen dog food in Portugal (pAPT110; accession No. MW012677)³⁴ and from a human urine sample in the United Kingdom (strain TM6249; contig 000003; accession No, OD940433). Taken together, the results obtained are consistent with the previously observed variation in the genetic context of the optrA gene,^25,27 and with the involvement of IS1216 in the evolution of antimicrobial drug resistance/generation of resistance regions in Gram-positive bacteria.³⁵

Sequence analysis of pEfae-HEB2-2, a second plasmid of Efae-HEB2 carrying multiple antibiotic resistance genes

Apart from optrA and fexA, additional genes conferring resistance to aminoglycosides, trimethoprim, fenicols (other than optrA and fexA), and antibiotics of the MLS_B (macrolides–lincosamides–streptogramin B), LS_AP (lincosamides, streptogramin A, and pleuromutilins), and L (lincosamide) groups, were identified on plasmids or the chromosome of the analyzed isolates (Table 1). In Efae-HEB2, many resistance genes were carried by plasmid pEfae-HEB2-2, whose entire nucleotide sequence was determined (Fig. 2). This plasmid comprises 75.4 kb with a GC content of 34.6%, similar to that of pEfae-HEB2-1. According to PlasmidFinder it contains three different replicons, rep_7a, rep_9a, and rep_US43, showing 100%, 95.3%, and 99.9% identity with genes of the prototype plasmids for each of these rep families (pS194, pAD1, and pDOP1 plasmids, respectively). Most of the resistance genes carried by pEfae-HEB2-2 (Table 1) were distributed into two clusters (Fig. 2).

FIG. 2.

Genetic organization of the resistance plasmid pEfae-HEB2-2, found in Enterococcus faecalis Efae-HEB2. Open reading frames are represented by arrows indicating the direction of transcription and having different fillings according to their function: yellow, plasmid replication, maintenance, and segregation; orange, conjugative transfer; blue, DNA metabolism, including transposition, with the transposase of IS1216 highlighted by blue arrows with white filling; red, resistance; green, other roles; gray, unknown. A chromosomal region from Erysipelothrix rhusiopathiae strain Ery-11 (accession No. KP339868), and regions from plasmids pEF418, pV7037 and pXD4 (accession No. AF408195, JX560992 and KF421157, respectively) were included for comparison.

The largest cluster, located between rep_9a and rep_7a, contains genes conferring resistance to aminoglycosides [aacA-aphD, aadE (three copies), apt, spw, sat4, and aphA3], trimethoprim (dfrG), or involved in the MLS [three copies of erm(B)], LS_AP [lsa(E)], and L [lnu(B)] phenotypes. This entire complex resistance region was only detected in unpublished plasmids of E. faecalis, which are identical: contig 000002 of strain TM6294 (accession No. OD940432) or nearly identical: p508-2 and pEFS17 (MK465702 and CP085290) to pEfae-HEB2-2, as well as in plasmid p505-1 of E. faecium (MK465703).

However, an internal subcluster comprising lsa(E) and lnu(B), together with a number of additional resistance genes, is widely distributed in Gram-positive bacteria.³⁶ For instance, it was found in the chromosome of Erysipelothrix rhusiopathiae Ery-11 (accession No. KP339868), as well as in plasmids of pEf418, pXD4, and pV7037 (AF408195, KF421157, and JX560992) of E. faecalis, E. faecium, and S. aureus, respectively (Fig. 2). The lsa(E) and lnu(B) genes encode an ABC-F-type ribosomal protection protein and a lincosamide nucleotidyltransferase, responsible for the LS_AP and L phenotypes, respectively.

In some cases, the lsa(E)-lnu(B) cluster was flanked by one (pXD4 and pV7037) or two (pEf418) copies of IS1216. In pEfae-HEB2-2, a single copy of this insertion sequence was found downstream of dfrG, outside the cluster. Apart from the abovementioned resistance genes, the tet(M) and tet(L) genes, which encode a ribosome-protective protein and an efflux protein of the MFS conferring resistance to tetracycline, and the cat gene encoding a chloramphenicol acetyltransferase, were also carried by pEfae-HEB2-2. In Gram-positive bacteria, tet(M) is often mobilized by conjugative transposons of the Tn916 family, which can also harbor additional antimicrobial resistance genes.³⁷ For instance, tet(L) and cat have been shown to coreside with tet(M) in Tn6248 (25,963 bp; accession No. KP834592), which shares a large part of its sequence (18,032 bp) with Tn916.

In pEfae-HEB2-2, these genes are carried by a truncated version of Tn6248 (18,727 bp) that lacks the genes for insertion and excision of the transposon. As indicated above, pEfae-HEB2-2 is closely related to E. faecalis plasmids pE508-2 carried by a ST256 isolate from a fecal swine sample in China,³⁰ pEFS17 of unknown origin, and a plasmid (contig 000002) found in strain TM6294, which also harbors an optrA plasmid related to pEfae-HEB2-1 (contig 000003; accession No. OD940433). Interestingly, both Efae-HEB2 and TM6294, for which the ST is not available, were derived from urine samples. These results provide evidence that the newly detected plasmid carrying multiple resistance genes has already been established in different E. faecalis clones (at least ST585 and ST256), from different environments (isolates derived from swine and human samples), and geographical regions (Europe and China).

Conclusions

E. faecalis, including optrA-positive isolates, are usually susceptible to aminopenicillins, which are the first-line antimicrobials to treat the infections they cause. In fact, this is the case of the isolates reported in the present study. However, these isolates could serve as a reservoir of the optrA gene, which is mainly located in plasmids and could be horizontally disseminated, not only between members of this species but also to other MDR pathogens such as E. faecium, including vancomycin-resistant isolates. This would mimic the transfer of the cfr gene from coagulase-negative staphylococci into methicillin-resistant S. aureus.^8,38 Prompt detection and surveillance of transferable oxazolidinone resistance genes among enterococci are crucial to avoid their spread in hospital settings, to preserve the efficacy of these last-resort antibiotics. This is particularly true in the context of MDR as well as in hospitals, such as the HEB, where VRE are endemic.

Footnotes

Acknowledgment

The authors are grateful to Regional Ministry of Science of Asturias (IDI/2021/000033), Spain, for supporting this work.

Authors' Contributions

All authors certify that they have participated sufficiently to take public responsibility for the content, including in the manuscript's concept, design, analysis, writing, or revision. All authors have read and approved this article.

Disclosure Statement

No competing financial interest exist.

Funding Information

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Supplementary Material

References

Bozdogan

, and Appelbaum

P.C.

. 2004. Oxazolidinones: activity, mode of action, and mechanism of resistance. Int. J. Antimicrob. Agents, 23:113–119.

Mendes

R.E.

, Deshpande

, Streit

J.M

, et al. 2018. ZAAPS programme results for 2016: an activity and spectrum analysis of linezolid using clinical isolates from medical centres in 42 countries. J. Antimicrob. Chemother. 73:1880–1887.

Schwarz

, Werckenthin

, and Kehrenberg

. 2000. Identification of a plasmid-borne chloramphenicol-florfenicol resistance gene in Staphylococcus sciuri. Antimicrob. Agents Chemother. 44:2530–2533.

Antonelli

, Andrea

M.M.D

, Brenciani

, et al. 2018. Characterization of poxtA, a novel phenicol–oxazolidinone–tetracycline resistance gene from an MRSA of clinical origin. J. Antimicrob. Chemother. 73:1763–1769.

Wang

, Lv

, Cai

, et al. 2015. A novel gene, optrA, that confers transferable resistance to oxazolidinones and phenicols and its presence in Enterococcus faecalis and Enterococcus faecium of human and animal origin. J. Antimicrob. Chemother. 70:2182–2190.

Ruiz-Ripa

, Feßler

A.T

, Hanke

, et al. 2020. Mechanisms of linezolid resistance among enterococci of clinical origin in Spain—detection of optrA-and cfr(D)-carrying E. faecalis. Microorganisms, 8:1–17.

Stojković

, Ulate

M.F

, Hidalgo-villeda

, et al. 2019. cfr(B), cfr(C), and a new cfr-Like gene, cfr(E), in Clostridium difficile strains recovered across Latin America. Antimicrob. Agents Chemother. 64:e01074-19.

Deshpande

L.M.

, Castanheira

, Flamm

R.K

, and Mendes

R.E.

. 2018. Evolving oxazolidinone resistance mechanisms in a worldwide collection of enterococcal clinical isolates: results from the SENTRY Antimicrobial Surveillance Program. J. Antimicrob. Chemother. 73:2314–2322.

Argudín

M.A.

, Youzaga

, Dodémont

, et al. 2019. Detection of optrA-positive enterococci clinical isolates in Belgium. Eur. J. Clin. Microbiol. Infect. Dis. 38:985–987.

10.

Càmara

, Camoez

, Tubau

, et al. 2019. Detection of the novel optrA gene among linezolid-resistant Enterococci in Barcelona, Spain. Microb. Drug Resist. 25:87–93.

11.

Elghaieb

, Freitas

A.R

, Abbassi

M.S

, et al. 2019. Dispersal of linezolid-resistant enterococci carrying poxtA or optrA in retail meat and food-producing animals from Tunisia. J. Antimicrob. Chemother. 74:2865–2869.

12.

Cui

, Wang

, Lv

, et al. 2016. Nationwide surveillance of novel oxazolidinone resistance gene optrA in Enterococcus spp. isolates in China from 2004–2014. Antimicrob. Agents Chemother. 60:7490–7493.

13.

Moure

, Lara

, Marin

, et al. 2020. Interregional spread in Spain of linezolid-resistant Enterococcus spp. isolates carrying the optrA and poxtA genes. Int. J. Antimicrob Agents, 55:105977.

14.

Rodríguez-Lucas

, Fernández

, Raya

, et al. 2021. Establishment and persistence of glycopeptide-resistant Enterococcus faecium ST80 and ST117 clones within a health care facility located in a low-prevalence geographical region. Microb. Drug Resist. 28:217–221.

15.

Clinical and Laboratory Standards Institute (CLSI). 2019. Performance Standards for Antimicrobial Susceptibility Testing. 29th ed. CLSI Supplement M100. Clinical and Laboratory Standards Institute, Wayne, PA.

16.

Rodríguez-Lucas

, Fernández

, Boga

J.A

, et al. 2018. Nosocomial ventriculitis caused by a meticillin- and linezolid-resistant clone of Staphylococcus epidermidis in neurosurgical patients. J. Hosp. Infect. 100:406–410.

17.

Rodríguez-Lucas

, Rodicio

M.R

, Càmara

, M.Á. Domínguez, Alaguero

, and Fernández

. 2020. Long-term endemic situation caused by a linezolid- and methicillin-resistant clone of Staphylococcus epidermidis in a tertiary hospital. J. Hosp. Infect. 105:64–69.

18.

Vielva

, de Toro

, Lanza

V.F

, and De Cruz

. 2017. PLACNETw: a web-based tool for plasmid reconstruction from bacterial genomes. Bioinformatics, 33:3796–3798.

19.

Larsen

M.V.

, Cosentino

, Rasmussen

, et al. 2012. Multilocus sequence typing of total-genome-sequenced bacteria. J. Clin. Microbiol. 50:1355–1361.

20.

Clausen, P.T.L.C., Aarestrup

F.M

, and Lund

. 2018. Rapid and precise alignment of raw reads against redundant databases with KMA. BMC Bioinformatics, 19:1–8.

21.

Hasman

, P. Clausen

T.L.C

, Kaya

, et al. 2019. LRE-Finder, a web tool for detection of the 23S rRNA mutations and the optrA, cfr, cfr (B) and poxtA genes encoding linezolid resistance in enterococci from whole-genome sequences. J. Antimicrob. Chemother. 74:1473–1476.

22.

Bortolaia

, Kaas

R.S

, Ruppe

, et al. 2020. ResFinder 4.0 for predictions of phenotypes from genotypes. J. Antimicrob. Chemother. 75:3491–3500.

23.

Zankari

, Allesøe

, Joensen

K.G

, Cavaco

L.M

, Lund

, and Aarestrup

F.M.

. 2017. PointFinder: a novel web tool for WGS-based detection of antimicrobial resistance associated with chromosomal point mutations in bacterial pathogens. J. Antimicrob. Chemother. 72:2764–2768.

24.

Carattoli

, Zankari

, Garciá-Fernández

, et al. 2014. In silico detection and typing of plasmids using plasmidfinder and plasmid multilocus sequence typing. Antimicrob. Agents Chemother. 58:3895–3903.

25.

, Shen

, Schwarz

, et al. 2016. Genetic environment of the transferable oxazolidinone/phenicol resistance gene optrA in Enterococcus faecalis isolates of human and animal origin. J. Antimicrob. Chemother. 71:1466–1473.

26.

Cai

, Wang

, Schwarz

, et al. 2015. Enterococcal isolates carrying the novel oxazolidinone resistance gene optrA from hospitals in Zhejiang, Guangdong, and Henan, China, 2010–2014. Clin. Microbiol. Infect. 21:1095.e1–1095.e4.

27.

Zou

, Tang

, Yan

, et al. 2020. Dissemination of linezolid resistance through sex pheromone plasmid transfer in Enterococcus faecalis. Front. Microbiol. 11:1185.

28.

Freitas

A.R.

, Tedim

A.P

, Novais

, Lanza

V.F

, and Peixe

. 2020. Comparative genomics of global optrA-carrying Enterococcus faecalis uncovers a common chromosomal hotspot for optrA acquisition within a diversity of core and accessory genomes. Microb. Genom. 6:1–17.

29.

Sassi

, Guérin

, Zouari

, et al. 2019. Emergence of optrA-mediated linezolid resistance in enterococci from France, 2006–2016. J. Antimicrob. Chemother. 74:1469–1472.

30.

Shang

, Li

, Shan

, et al. 2019. Analysis of two pheromone-responsive conjugative multiresistance plasmids carrying the novel mobile optrA locus from Enterococcus faecalis. Infect. Drug Resist. 12:2355–2362.

31.

Morroni

, Brenciani

, Simoni

, Vignaroli

, Mingoia

, and Giovanetti

. 2017. Commentary: nationwide surveillance of novel oxazolidinone resistance gene optrA in Enterococcus isolates in China from 2004 to 2014. Front. Microbiol. 8:1–5.

32.

The European Committee on Antimicrobial Susceptibility Testing (EUCAST). 2019. The European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of MICs and zone diameters. Version 9.0, 2019. Available at www.eucast.org (accessed October 1, 2021).

33.

Bender

J.K.

, Fleige

, Klare

, and Werner

. 2019. Development of a multiplex-PCR to simultaneously detect acquired linezolid resistance genes cfr, optrA and poxtA in enterococci of clinical origin. J. Microbiol. Methods, 160:101–103.

34.

Freitas

A.R.

, Finisterra

, Tedim

A.P

, Duarte

, Novais

, and Peixe

. 2021. Linezolid- and multidrug-resistant enterococci in raw commercial dog food, Europe, 2019–2020. Emerg. Infect. Dis. 27:2221–2224.

35.

Partridge

S.R.

, Kwong

S.M

, Firth

, and Jensen

S.O.

. 2018. Mobile genetic elements associated with antimicrobial resistance. Clin. Microbiol. Rev. 31:e00088-17.

36.

Schwarz

, Shen

, Kadlec

, et al. 2016. Lincosamides, streptogramins, phenicols, and pleuromutilins: mode of action and mechanisms of resistance. Cold Spring Harb. Perspect. Med. 6:a027037.

37.

Roberts

A.P.

, and Mullany

. 2011. Tn916-like genetic elements: a diverse group of modular mobile elements conferring antibiotic resistance. FEMS Microbiol. Rev. 35:856–871.

38.

Lazaris

, Coleman

D.C

, Kearns

A.M

, et al. 2018. Novel multiresistance cfr plasmids in linezolid-resistant methicillin- resistant Staphylococcus epidermidis and vancomycin-resistant Enterococcus faecium (VRE) from a hospital outbreak: co-location of cfr and optrA in VRE. J. Antimicrob. Chemother. 72:3252–3257.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.02 MB