The Association Between Sleep Duration and Sleep-Related Gene Methylation with Osteoporosis in Chinese Postmenopausal Women

Abstract

This study aims to investigate the association between sleep duration and osteoporosis. In addition, sleep-related gene methylation was also detected in this study and we explored its relationship with osteoporosis. The epidemiological investigation section of this study was designed as a retrospective cross-sectional study. We gathered 148 postmenopausal women from two communities and used questionnaires to collect data of sleep duration and other sleep patterns. Biochemical variables were tested, and bone mineral density was measured by dual-energy X-ray absorptiometry. In addition, sleep-related gene (PER2 and PER3) methylation was tested, and the association with osteoporosis was further studied. Twenty-nine of the 148 participants (aged from 65 to 86 years) who suffered from osteoporosis were tested for osteopenia. A significant difference was observed in the association between sleep duration and osteoporosis; the p-value was 0.013. In addition, in our study, we found that short sleep duration (<7 hours) may increase the risk of osteoporosis compared with longer sleep duration. Moreover, sleep-related genes such as PER2 and PER3 and their CpG island methylation were tested, and there was no significant difference between PER2 and PER3 CpG island methylation and osteoporosis. Short sleep duration may increase the risk of osteoporosis. However, the association between sleep-related gene methylation and osteoporosis was not found.

Introduction

Osteoporosis is a global problem, causing severe economic burden, physical disability, and impaired quality of life. The major complication of osteoporosis is fracture, which is associated with an increase in rates of morbidity and mortality, especially in elderly men and women.^1,2 At present, osteoporosis, diabetes, and cardiovascular disease have been listed as the three major causes of the decline in health of the elderly by the World Health Organization (WHO).

Sleep is a fundamental biological process that plays an important role in varieties of metabolic and endocrine functions.³ Long or short sleep duration is likely to cause a series of health problems, such as cardiovascular disease, diabetes, obesity, and even an increase in all-cause mortality.^4

–9 Previous studies focusing on the association between sleep duration and osteoporosis revealed that long sleep duration^2,10

–13 or short sleep duration^10,14 may increase the risk of osteoporosis.

The mechanism remains unknown, but estrogen may be a potential factor between sleep duration and bone health. Estrogen is known as a crucial factor for maintaining bone mineral density.^15
–17 A meta-analysis that collected results from good quality studies demonstrated that the postmenopausal decline in estrogen contributed to sleep disturbance in women and that timely treatment with estrogen therapy improved overall sleep quality.¹⁸ Therefore, we conducted this study to investigate the association between sleep duration and osteoporosis.

Lots of biochemical varieties have been proven to be connected with bone metabolism. 25(OH)D, tropocollagen type 1 N-terminal propeptide (P1NP), β-crosslaps of type I collagen containing cross-linked C-telopeptide (β-CTX), and parathyroid hormone (PTH) are markers of bone turnover. In addition, balance of calcium and phosphorus affects bone metabolism.^19,20 Moreover, many studies have proposed the relationship between uric acid,²¹ alkaline phosphatase,²² creatinine,²³ glucose,²⁴ high-density lipoprotein (HDL),²⁵ and low-density lipoprotein (LDL).²⁶

The circadian clock has been shown to regulate many important physiological processes such as the sleep–wake cycle, hormone release, and even bone metabolism in recent research.^27
–29 Many studies have presented that the genes, PER2 and PER3, play a role in primary circadian rhythm maintenance in the brain, and the relationship between sleep problems and genotypic and genetic diversity of PER2 and PER3 was studied.^30

–34

Moreover, one study indicated that polymorphisms in period genes of PER2 and PER3 seemed to relate to bone health.³⁵ In addition, PER2 inhibits the Wnt/β-catenin signaling pathway and shows synergistic effects on proliferation and differentiation of bone marrow mesenchymal stem cells (BMSCs)³⁶ and other pathways as well.^37
–39 In addition, one study showed that knocking down endogenous miR-181a expression in immortalized bone marrow derived stromal cell (iBMSC) has a profound inhibitory effect on iBMSC adipogenesis through its regulation of PER3.⁴⁰

On the other hand, gene methylation of m6A,^41,42 BMP2,⁴³ TBC1D8,⁴⁴ and even lncRNA-AK137033⁴⁵ was found to be associated with osteoporosis, as studied previously. However, few studies have investigated the relevance between circadian gene methylation and sleep problems and the relationship with osteoporosis.

Thus, we conducted a study on the association between sleep duration and osteoporosis, and we detected biochemical varieties and PER2 and PER3 gene CpG island methylation. We studied whether there is a correlation between sleep duration and osteoporosis and verified the correlation at the genetic aspect.

Methods

Sample collection

We used questionnaires to collect data from Han Chinese postmenopausal women aged >50 years in two communities (Zhen-Ming community and Ying-Feng community, Haishu District, Ningbo). The questionnaire contained questions on age, sleep duration, nap time, insomnia, age at menopause, hypertension history, diabetes history, fracture history, regular use of calcium, and history of smoking and drinking.

Ethics approval was obtained from the Ethics Committee of Ningbo University-Affiliated First Hospital, China. The methods in the study were in accordance with relevant guidelines and the Declaration of Helsinki. All participants gave informed consent.

Biochemical measurements

We obtained fasting blood samples from the individuals after 30 minutes of rest in the morning. Serum calcium (Ca), serum phosphorus (P), serum uric acid, serum alkaline phosphatase, serum creatinine, and glucose (Glu) levels were all measured using kits from Roche Diagnostics. HDL and LDL levels were tested using kits from Olympus Co., Ltd.

We also detected bone turnover markers, such as PTH, P1NP, and β-CTX, using kits from Roche Diagnostics. 25-Hydroxyvitamin D₃ [25(OH)D] was measured using kits from Meikang Biological Tech.

Bone mineral density testing

Bone mineral density (BMD) measurement by dual-energy X-ray absorptiometry (DXA) is an internationally accepted standard-of-care screening tool used to assess fragility-fracture risk. And in our study, BMD was tested by dual-energy X-ray absorptiometry on a Lunar Prodigy GE densitometer (Lunar Corp., Madison, WI). Lumbar spine (L1–L4), left femoral neck, and total hip were all assessed in the tests.

Diagnosis of osteoporosis was made based on the criteria followed by WHO (1994): participants with a T-score <−2.5 SD were classified as having osteoporosis; those with a T-score <−1.0 SD, but >−2.5 SD, were classified as having low bone mass; and those with a T-score >−1.0 SD were classified as normal. Besides, body–mass index (BMI) was calculated as height divided by the square of weight.

DNA extraction and methylation sequencing

DNA was extracted from peripheral blood samples following routine methods (DNeasy Blood & Tissue, Qiagen). We measured the DNA concentration using a NanoDrop 100 spectrophotometer (Aosheng, Hangzhou city, China). Extracted DNA was combined with sodium bisulfate DNA conversion (EpiTect, Bisulfite Kits, Qiagen). DNA sequencing primers were designed using Methyl Primer Express (version 1.0), as shown in Table 1.

Table 1.

Primers Used for the DNA Methylation Assay

	Primer sequences
PER2-1F	GTGGTTTTAAAAATAAGAAAGG
PER2-1R	CCCRAAACAACCCAAAAAAAAA
PER2-2F	GGAAGTGGATGAGATTATTA
PER2-2R	RCACATAAAACTCCATATTC
PER2-3F	GTGTTTTTGGTTTTGTTTTAGGT
PER2-3R	RCTAACCCTTAATTTCCTTA
PER3-1F	GGTTGTTTTATGGTTYGGTTTTT
PER3-1R	GGTTGTTTTATGGTTYGGTTTTT
PER3-2F	AGAAATYGGTGTTTGTTATTGATTG
PER3-2R	AGAAATYGGTGTTTGTTATTGATTG

The polymerase chain reaction (PCR instrument; Thermal Scientific Co., Ltd., Wilmington) was applied to achieve amplification of objective strips. DNA methylation was evaluated by applying capture sequencing (Illumina Co., Ltd., San Diego).

Statistical analyses

All statistical analyses were performed using the SPSS package (version 23.0) or GraphPad software (version 6.0). The chi-square test was performed to compare rates in different groups and sleep duration in different bone mass groups. Analysis of variance was used to test for differences in means across multiple samples, contrasting biochemical variables and bone mineral density levels in different sleep duration groups.

A two-sample independent t-test was used to investigate differences in PER2 and PER3 CpG island methylation levels between cases and controls. Besides, a linear regression was applied to evaluate the association between PER2 and PER3 CpG island methylation levels and biochemical variables in cases and controls, respectively. All p-values were two-sided, and the level of significance was set at <0.05, unless explicitly stated otherwise.

Result

We collected 148 samples (aged from 65 to 86 years) from the communities of Zhen-Ming and Ying-Feng. Among the participants, we discovered 29 osteoporosis patients, and the prevalence rate of osteoporosis was 19.6%. In addition, osteopenia was detected in 65 participants.

There was no significant difference for sleep time, afternoon nap, insomnia, and osteoporosis, but sleep duration showed a significant difference, between groups.

The contrast of clinical characteristics between different sleep duration groups is shown in Table 2. We used the chi-square test to calculate differences in daily habits, and analysis of variance was performed to compare differences in age, BMI, and menopause rates in different sleep groups. There was no statistically significant difference in age, BMI, menopause age, history of fracture, taking calcium tablets regularly, smoking, alcohol drinking, whether there was diabetes or hypertension, and exercise time.

Table 2.

Contrast of Clinical Characteristics in Different Sleep Duration Groups

	All participants (n = 148)	<6 Hours (n = 65)	6–7 Hours (n = 46)	7–8 Hours (n = 32)	>8 Hours (n = 5)	p
Age (years)	66.26 ± 8.83	67.69 ± 8.53	65.70 ± 9.09	65.28 ± 8.84	59.00 ± 3.90	0.111
Body–mass index (kg/m²)	23.30 ± 3.05	22.97 ± 3.23	23.17 ± 2.94	23.86 ± 2.78	25.22 ± 1.57	0.062
Age at menopause (years)	50.33 ± 2.36	50.57 ± 4.30	49.63 ± 3.31	51.09 ± 4.00	48.67 ± 1.89	0.052
History of fracture	36/148	19/65	8/46	8/32	1/5	0.541
Taking calcium tablets regularly	50/148	20/65	15/46	13/32	2/5	0.744
Smoking	12/148	7/65	3/46	1/32	1/5	0.312
Alcohol drinking	39/148	16/65	13/46	8/32	2/5	0.829
Hypertension	68/148	31/65	18/46	16/32	3/5	0.678
Diabetes	37/148	18/65	8/46	10/32	1/5	0.470
Exercise time (minutes/day)
<30	67/148	27/65	19/46	19/32	2/5
30–60	62/148	31/65	21/46	9/32	1/5	0.270
>60	19/148	7/65	6/46	4/32	2/5

In addition, for biochemical variables, contrasts of biochemical variables and bone mineral density levels in different sleep duration groups are shown in Table 3. In addition, the statistical analysis was performed using analysis of variance. Different sleep groups had significant differences in HDL and LDL levels, and a further statistical analysis showed that individuals in the group with 6–7 hours of sleep per night had a higher HDL level.

Table 3.

Contrast of Biochemical Variables and Bone Mineral Density Levels in Different Sleep Duration Groups

	All participants (n = 148)	<6 Hours (n = 65)	6–7 Hours (n = 46)	7–8 Hours (n = 32)	>8 Hours (n = 5)	p
BMD (T-score)
L1–L4	0.98 ± 0.17	0.95 ± 0.15	1.03 ± 0.17	0.98 ± 0.18	0.90 ± 0.11	0.098
Total hip	0.85 ± 0.14	0.82 ± 0.13	0.88 ± 0.13	0.85 ± 0.17	0.85 ± 0.17	0.326
Femur neck	0.79 ± 0.14	0.77 ± 0.13	0.80 ± 0.14	0.80 ± 0.18	0.82 ± 0.16	0.517
Biochemical variables
Calcium (mmol/L)	2.33 ± 0.08	2.33 ± 0.08	2.32 ± 0.08	2.34 ± 0.08	2.37 ± 0.11	0.570
Phosphorus (mmol/L)	1.18 ± 0.17	1.20 ± 0.16	1.16 ± 0.17	1.19 ± 0.18	1.11 ± 0.12	0.405
Uric acid (mol/L)	307.07 ± 76.83	309.32 ± 79.13	300.33 ± 72.16	318.29 ± 78.15	270.2 ± 61.47	0.535
Alkaline phosphatase (U/L)	70.01 ± 16.99	72.34 ± 16.87	68.41 ± 15.57	75.90 ± 18.94	76.80 ± 9.70	0.254
Creatinine (mol/L)	60.12 ± 16.31	59.55 ± 14.25	62.30 ± 20.68	57.74 ± 12.83	62.00 ± 11.15	0.660
Glucose (mmol/L)	6.37 ± 2.45	6.62 ± 2.48	5.73 ± 1.29	6.67 ± 2.95	7.18 ± 4.65	0.186
High-density lipoprotein (mmol/L)	1.38 ± 0.35	1.29 ± 0.27	1.50 ± 0.43	1.43 ± 0.30	1.16 ± 0.29	0.005^{^*}
Low-density lipoprotein (mmol/L)	3.32 ± 0.83	3.49 ± 0.75	3.14 ± 0.82	3.15 ± 0.88	3.89 ± 0.95	0.039^{^*}
25(OH)D (ng/mL)	17.46 ± 6.44	16.21 ± 4.35	18.08 ± 7.34	18.92 ± 7.87	15.30 ± 5.37	0.444
β-Crosslaps of type I collagen containing cross-linked C-telopeptide (ng/mL)	0.38 ± 0.16	0.37 ± 0.16	0.41 ± 0.18	0.36 ± 0.16	0.44 ± 0.28	0.708
Tropocollagen type 1 N-terminal propeptide (ng/mL)	38.03 ± 15.54	40.07 ± 16.30	35.18 ± 12.61	37.10 ± 16.64	48.77 ± 18.34	0.607
Parathyroid hormone (pg/mL)	32.36 ± 14.04	32.88 ± 12.71	32.54 ± 13.97	32.16 ± 15.88	31.86 ± 16.46	0.983

p < 0.05, it is significant statistical difference.

BMD, bone mineral density.

Other groups had lower HDL levels, and there was a significant difference between the groups with more than 8 hours and less than 6 hours of sleep; the statistical p-values were 0.001 and 0.033, respectively. For LDL testing, participants who sleep for 6–7 and 7–8 hours had lower LDL levels, and the difference was significant between groups with 6–7 hours of sleep and less than 6 hours of sleep.

Furthermore, we divided participants into three groups according to BMD testing: osteoporosis, osteopenia, and normal bone mass subgroups. The details are shown in Table 4. The chi-square test was used to compare the different sleep patterns in different bone mass groups. In the three groups, we found that individuals with different bone mass levels had different sleep duration, and the difference was statistically significant. Short sleep duration was more likely to be associated with an increased risk of osteoporosis.

Table 4.

Contrast of Different Sleep Patterns of Individuals in Osteoporosis, Osteopenia, and Normal Bone Mass Groups

	All participants (n = 148)	Osteoporosis (n = 29)	Osteopenia (n = 65)	Normal bone mass (n = 54)	p
Sleep condition
Sleep duration (hours/day)
< 6	65/148	16/29	29/65	20/54
6–7	46/148	4/29	28/65	14/54	0.013^*
7–8	32/148	8/29	6/65	18/54
>8	5/148	1/29	2/65	2/54
Sleep timing
Before 8 pm	9/148	2/29	4/65	3/54
Before 9 pm	32/148	7/29	15/65	10/54
Before 10 pm	79/148	14/29	33/65	32/54	0.895
Before 11 pm	23/148	4/29	12/65	7/54
Before 12 pm	5/148	2/29	1/65	2/54
Afternoon nap	87/148	18/29	36/65	33/54	0.781
Insomnia	82/148	16/29	39/65	27/54	0.559

p < 0.05, it is significant statistical difference.

In addition, individuals with osteopenia were more likely to report sleep duration of between 6–7 and 7–8 hours. In addition, further variance analysis showed that the group with less than 6 hours of sleep had lower BMD levels in 1–4 lumbar vertebrae. The difference was statistically significant. Sleep time ranged from before 8 pm to before 12 pm, and majority of the participants went to bed before 10 pm. We also performed a further comparison between the three groups, and no statistical difference was found. The same conclusion was found for whether to take a nap and insomnia.

PER2 and PER3 CpG island methylation levels were tested. Distributions of CpG island methylation in the promoter regions of PER2 and PER3 genes in osteoporosis, osteopenia, and normal bone mass groups are shown in Figures 1 –3. In addition, we analyzed the connection between PER2 and PER3 gene methylation and osteoporosis.

FIG. 1.

Distribution of CpG island methylation in the promoter regions of PER2 and PER3 genes in the osteoporosis group (taking sample S1 as an example).

FIG. 2.

Distribution of CpG island methylation in the promoter regions of PER2 and PER3 genes in the osteopenia group (taking sample S2 as an example).

FIG. 3.

Distribution of CpG island methylation in the promoter regions of PER2 and PER3 genes in the normal bone mass group (taking sample S3 as an example).

In the three groups of osteoporosis, osteopenia, and normal bone mass, we performed a further comparison of PER2 and PER3 gene CpG island methylation. We found that in the pairwise comparisons of groups, no statistical significances were found. In the analysis of PER2 gene methylation, the p-values compared between the two groups were 0.345, 0.176, and 0.052, respectively. And the p-values were 0.147, 0.678 and 0.579 respectively, in the analysis of PER3 gene methylation.

Furthermore, we detected an association between BMD of different regions and CpG island methylation of PER2 and PER3. For the association between lumbar 1–4 BMD and methylation of the genes, PER2 and PER3, correlation coefficients were 0.037 and 0.154 and p-values were 0.780 and 0.240. For the BMD of the neck of femur, correlation coefficients were 0.141 and 0.027 and p-values were 0.282 and 0.836. In addition, for the BMD of the total hip part, correlation coefficients were 0.107 and 0.034 and p-values were 0.416 and 0.798.

There was no significant difference between all the different bone regions and methylation of the genes, PER2 and PER3.

Discussion

The present study showed that sleep duration was associated with osteoporosis. In addition, longer sleep duration was associated with a higher incidence rate of osteopenia. Other sleep disorders such as insomnia, sleep timing, and afternoon nap were not found to be statistically related to osteoporosis. In multitudinous literature, sleep disorders, including insomnia,⁴⁶ taking a daytime nap,^11,47 and early sleep timing, were found to affect bone metabolism.¹³ The relationship was controversial between different sleep patterns and osteoporosis.

The exact mechanisms have not yet been explained, especially in the association between sleep duration and osteoporosis. Three, Chinese, cross-sectional cohort studies, with participants from Henan, Fujian, and Hubei provinces, reported that longer nocturnal sleep duration was associated with a higher risk of osteoporosis.^11,13,48 In a Japanese study, those individuals with self-reported sleep duration of more than 8 h (long sleepers) appeared to have higher odds of osteoporosis compared to the progressively shorter sleepers.¹²

On the contrary, data from National Health and Nutrition Examination Survey^49,50 and a cohort study in Asians⁴⁷ demonstrated that short sleep duration may lead to an increased risk of osteoporosis, which was similar to our results. There are several hypotheses that may explain why shorter sleep duration leads to osteoporosis.

First, sleep duration was associated with endocrine disturbance, which was found to be associated with osteoporosis. It was proven that sleep restriction may increase endogenous glucocorticoid secretion and inhibit release of growth hormone.^51,52 In addition, longer sleep duration may have a positive influence on regulation of insulin metabolism. The mechanisms to reduce insulin resistance, improve insulin sensitivity, and regulate glucose metabolism were found in several studies,^53
–55 all of which proposed a benefit to bone health.^56,57

Second, a network meta-analysis of 43 randomized controlled trials in menopausal women supported combined estrogen–progesterone therapy for menopausal sleep disturbance.⁵⁸ Another randomized, double-blind crossover trial in postmenopausal women was performed, which showed that estrogen replacement therapy improved objective sleep quality by alleviating the frequency of nocturnal movement arousals.⁵⁹ It also reflected that estrogen may be an important factor affecting sleep.

Similar conclusions on declining estrogen and sleep disruption reciprocal causation were drawn in two other studies.^60,61 Thus, shorter sleep duration would decrease estrogen, especially in postmenopausal women. As is known, estrogen played an important role in bone metabolism. Estrogen inhibited differentiation of osteoclasts and decreased their number, reducing the number of active remodeling units at the cellular level.⁶² A previous study demonstrated that the estrogen level had a contrary association with osteoporosis and fracture of the hip and vertebra.⁶³ The mechanism remains unclear.

One study showed that estrogens binded to estrogen receptor ERα and ERβ, and the roles of each of these receptors were beginning to be elucidated through whole body and tissue-specific knockouts of the receptors. In vitro and in vivo experiments showed that ERα and ERβ antagonized each other in bones.⁶⁴ Another review showed that estrogen reduction contributed to a decline in bone and skeletal muscle function, thereby resulting in osteoporosis and sarcopenia.⁶⁵

A previous study showed that the PER2 gene may regulate aging of mouse BMSCs through the Wnt/β-catenin pathway.³⁶ In addition, a study on postmenopausal women in Korea showed that the PER2 and PER3 gene polymorphisms studied were not associated with bone mineral density.⁶⁶ There are few studies that show the association between PER2 and PER3 gene methylation and osteoporosis.

As previously mentioned, PER2 is a primary canonical clock gene that shows synergistic effects on proliferation and differentiation of mouse BMSCs by modulating the Wnt/β-catenin pathway.³⁶ In addition, another literature showed that PER1 gene polymorphism may be associated with the risk of nonresponse to hormone therapy and it may be the genetic factor affecting the lumbar spine BMD in postmenopausal women in Korea, but the same conclusion was not drawn for PER2 and PER3.^35,66 On the other hand, the PER3 allele status had an effect on mood states and thereby interacts with sleep duration.⁶⁷

Other studies mentioned that the genes, PER2 and PER3, were associated with sleep quality and sleep structure,^32,34,68,69 and one study showed that the PER2 gene methylation level was associated with shorter sleep duration.⁷⁰ There are few studies that investigate the association of PER2 and PER3 gene methylation with osteoporosis. In our study, the findings did not show an association between methylation of PER2 or PER3 and osteoporosis.

Nevertheless, some limitations existed in our study. First, we had a limited number of researchers. We collected more than 148 participants, but some participants gave up in the part of BMD tests or blood drawing. Therefore, we lost the complete data of some participants. Second, the sleep duration of all participants was self-reported, so there could be some statistical errors.

Third, we selected two genes and tested the CpG island methylation of these genes. Even though the two genes were associated with sleep duration and sleep patterns, as reported in many studies before, we found no statistical association between methylation of these genes and osteoporosis. However, we couldn't explain that gene methylation is not related to osteoporosis. We could only say that our research suggested that methylation of these two genes does not seem to be associated with osteoporosis.

In conclusion, our study showed that a significant association exists between sleep duration and osteoporosis. The present evidence indicated that short sleep duration (less than 7 hours) increased the risk of osteoporosis compared with sleep duration of more than 7 hours. In addition, we detected CpG island methylation of genes (PER2 and PER3), which was associated with sleep duration. Furthermore, we found no relationship between methylation of PER2 and PER3 genes and osteoporosis.

Footnotes

Authors' Contributions

Q.M. and T.L. wrote the main manuscript text. Y.L. and Q.X. collected the samples from the community. H.X. and Q.Y. performed the experiments. All authors reviewed the manuscript.

Author Disclosure Statement

The authors declare that we have no conflict of interest.

Funding Information

This study was supported by the Zhejiang Medical and Health Technology Project (grant 2021KY985).

References

Burge

, Dawson-Hughes

, Solomon

, et al. Incidence and economic burden of osteoporosis-related fractures in the United States, 2005–2025. J Bone Miner Res, 2007; 22(3):465–475.

Kim

, Choi

, Kim

, et al. Association between bone mineral density and sleep duration in the Korean elderly population. Korean J Fam Med, 2014; 35(2):90–97.

Van Cauter

, Plat

, Leproult

, et al. Alterations of circadian rhythmicity and sleep in aging: Endocrine consequences. Horm Res, 1998; 49(3–4):147–152.

Bayon

, Leger

, Gomez-Merino

, et al. Sleep debt and obesity. Ann Med, 2014; 46(5):264–272.

Knutson

KL.

Sleep duration and cardiometabolic risk: A review of the epidemiologic evidence. Best Pract Res Clin Endocrinol Metab, 2010; 24(5):731–743.

Taheri

, Lin

, Austin

, et al. Short sleep duration is associated with reduced leptin, elevated ghrelin, and increased body mass index. PLoS Med, 2004; 1(3):e62.

Gottlieb

, Punjabi

, Newman

, et al. Association of sleep time with diabetes mellitus and impaired glucose tolerance. Arch Intern Med, 2005; 165(8):863–867.

Magee

, Kritharides

, Attia

, et al. Short and long sleep duration are associated with prevalent cardiovascular disease in Australian adults. J Sleep Res, 2012; 21(4):441–447.

Cappuccio

, D'Elia

, Strazzullo

, et al. Sleep duration and all-cause mortality: A systematic review and meta-analysis of prospective studies. Sleep, 2010; 33(5):585–592.

10.

Wang

, Ruan

, Peng

, et al. Sleep duration and the risk of osteoporosis among middle-aged and elderly adults: A dose-response meta-analysis. Osteoporos Int, 2018; 29(8):1689–1695.

11.

Chen

, Chen

, Wen

, et al. Associations between sleep duration, daytime nap duration, and osteoporosis vary by sex, menopause, and sleep quality. J Clin Endocrinol Metab, 2014; 99(8):2869–2877.

12.

Kobayashi

, Takahashi

, Deshpande

, et al. Association between osteoporosis and sleep duration in healthy middle-aged and elderly adults: A large-scale, cross-sectional study in Japan. Sleep Breath, 2012; 16(2):579–583.

13.

Tian

, Shen

, Wu

, et al. Sleep duration and timing in relation to osteoporosis in an elderly Chinese population: A cross-sectional analysis in the Dongfeng-Tongji cohort study. Osteoporos Int, 2015; 26(11):2641–2648.

14.

Ochs-Balcom

, Hovey

, Andrews

, et al. Short sleep is associated with low bone mineral density and osteoporosis in the women's health initiative. J Bone Miner Res, 2020; 35(2):261–268.

15.

Krum

, Brown

. Unraveling estrogen action in osteoporosis. Cell Cycle, 2008; 7(10):1348–1352.

16.

Krum

SA.

Direct transcriptional targets of sex steroid hormones in bone. J Cell Biochem, 2011; 112(2):401–408.

17.

Khosla

Update on estrogens and the skeleton. J Clin Endocrinol Metab, 2010; 95(8):3569–3577.

18.

Haufe

, Baker

, Leeners

. The role of ovarian hormones in the pathophysiology of perimenopausal sleep disturbances: A systematic review. Sleep Med Rev, 2022; 66:101710.

19.

Chew

, Clarke

. Biochemical testing relevant to bone. Endocrinol Metab Clin North Am, 2017; 46(3):649–667.

20.

Xiong

, Yao

, He

, et al. No causal effect of serum urate on bone-related outcomes among a population of postmenopausal women and elderly men of Chinese Han ethnicity—A Mendelian randomization study. Osteoporos Int, 2016; 27(3):1031–1039.

21.

Lee

, Song

. Uric acid level, gout and bone mineral density: A Mendelian randomization study. Eur J Clin Invest, 2019; 49(9):e13156.

22.

Chavassieux

, Portero-Muzy

, Roux

, et al. Are biochemical markers of bone turnover representative of bone histomorphometry in 370 postmenopausal women?. J Clin Endocrinol Metab, 2015; 100(12):4662–4668.

23.

Fang

, Kong

, Wang

, et al. Association between serum creatinine level within normal range and bone mineral density in adolescents. Arch Pediatr, 2022; 29(5):364–369.

24.

Cipriani

, Colangelo

, Santori

, et al. The interplay between bone and glucose metabolism. Front Endocrinol (Lausanne), 2020; 11:122.

25.

Papachristou

, Blair

, Kypreos

, et al. High-density lipoprotein (HDL) metabolism and bone mass. J Endocrinol, 2017; 233(2):R95–R107.

26.

Tan

, Shu

, Huang

, et al. The correlation between the serum LDL-C/Apo B ratio and lumbar bone mineral density in young adults. BMC Musculoskelet Disord, 2023; 24(1):213.

27.

Jones

, Chaturvedi

, Granados-Fuentes

, et al. Circadian neurons in the paraventricular nucleus entrain and sustain daily rhythms in glucocorticoids. Nat Commun, 2021; 12(1):5763.

28.

Qin

, Chen

, Wu

, et al. Circadian clock genes as promising therapeutic targets for bone loss. Biomed Pharmacother, 2023; 157:114019.

29.

, Zhang

, Yang

, et al. Co-regulation of circadian clock genes and microRNAs in bone metabolism. J Zhejiang Univ Sci B, 2022; 23(7):529–546.

30.

Hoang

, Yuen

RKC

, Howe

, et al. Sleep phenotype of individuals with autism spectrum disorder bearing mutations in the PER2 circadian rhythm gene. Am J Med Genet A, 2021; 185(4):1120–1130.

31.

Comasco

, Nordquist

, Gokturk

, et al. The clock gene PER2 and sleep problems: Association with alcohol consumption among Swedish adolescents. Ups J Med Sci, 2010; 115(1):41–48.

32.

Weedon

, Jones

, Lane

, et al. The impact of Mendelian sleep and circadian genetic variants in a population setting. PLoS Genet, 2022; 18(9):e1010356.

33.

Archer

, Schmidt

, Vandewalle

, et al. Phenotyping of PER3 variants reveals widespread effects on circadian preference, sleep regulation, and health. Sleep Med Rev, 2018; 40:109–126.

34.

Weiss

, Woods

, Filipowicz

, et al. Sleep quality, sleep structure, and PER3 genotype mediate chronotype effects on depressive symptoms in young adults. Front Psychol, 2020; 11:2028.

35.

Kim

, Kim

, Ku

, et al. Polymorphisms in period genes and bone response to hormone therapy in postmenopausal Korean women. Climacteric, 2016; 19(1):85–90.

36.

Zheng

, Zhang

, Tan

, et al. Bmal1- and Per2-mediated regulation of the osteogenic differentiation and proliferation of mouse bone marrow mesenchymal stem cells by modulating the Wnt/beta-catenin pathway. Mol Biol Rep, 2022; 49(6):4485–4501.

37.

Yoo

, Lee

, Park

, et al. Decreased bone volume and bone mineral density in the tibial trabecular bone is associated with Per2 gene by 405 nm laser stimulation. Int J Mol Sci, 2015; 16(11):27401–27410.

38.

Bhatwadekar

, Yan

, Qi

, et al. Per2 mutation recapitulates the vascular phenotype of diabetes in the retina and bone marrow. Diabetes, 2013; 62(1):273–282.

39.

Maronde

, Schilling

, Seitz

, et al. The clock genes Period 2 and Cryptochrome 2 differentially balance bone formation. PLoS One, 2010; 5(7):e11527.

40.

Knarr

, Nagaraj

, Kwiatkowski

, et al. miR-181a modulates circadian rhythm in immortalized bone marrow and adipose derived stromal cells and promotes differentiation through the regulation of PER3. Sci Rep, 2019; 9(1):307.

41.

Huang

, Xu

, Liu

, et al. m6A methylation regulates osteoblastic differentiation and bone remodeling. Front Cell Dev Biol, 2021; 9:783322.

42.

, Xie

, Wang

, et al. Mettl3-mediated m(6)A RNA methylation regulates the fate of bone marrow mesenchymal stem cells and osteoporosis. Nat Commun, 2018; 9(1):4772.

43.

Raje

, Ashma

. Epigenetic regulation of BMP2 gene in osteoporosis: A DNA methylation study. Mol Biol Rep, 2019; 46(2):1667–1674.

44.

, Lin

, Yao

, et al. Reduced CpG island methylation of the TBC1D8 gene may predict risk for osteoporosis in Chinese postmenopausal women. Oncotarget, 2020; 11(47):4448–4456.

45.

Peng

, Gao

, Shi

, et al. LncRNA-AK137033 inhibits the osteogenic potential of adipose-derived stem cells in diabetic osteoporosis by regulating Wnt signaling pathway via DNA methylation. Cell Prolif, 2022; 55(1):e13174.

46.

, Chung

, Kim

. Sharing pathological mechanisms of insomnia and osteoporosis, and a new perspective on safe drug choice. J Menopausal Med, 2018; 24(3):143–149.

47.

, Wang

, Guo

, et al. The associations between different sleep patterns and osteoporosis based on the osteoporosis self-assessment tool for Asians. Arch Osteoporos, 2020; 15(1):164.

48.

Zhao

, Zhu

, Fan

, et al. Association of nocturnal sleep duration and sleep midpoint with osteoporosis risk in rural adults: A large-scale cross-sectional study. Sleep Breath, 2023; doi: 10.1007/s11325-023-02818-z

49.

Cunningham

, Di Pace

. Is self-reported sleep duration associated with osteoporosis? Data from a 4-year aggregated analysis from the National Health and Nutrition Examination Survey. J Am Geriatr Soc, 2015; 63(7):1401–1406.

50.

Lee

, Tzeng

, Liu

, et al. A cross-sectional analysis of the association between sleep duration and osteoporosis risk in adults using 2005–2010 NHANES. Sci Rep, 2021; 11(1):9090.

51.

Van Cauter

, Holmback

, Knutson

, et al. Impact of sleep and sleep loss on neuroendocrine and metabolic function. Horm Res, 2007; 67 Suppl 1:2–9.

52.

Leproult

, Van Cauter

. Role of sleep and sleep loss in hormonal release and metabolism. Endocr Dev, 2010; 17:11–21.

53.

Ohkuma

, Fujii

, Iwase

, et al. U-shaped association of sleep duration with metabolic syndrome and insulin resistance in patients with type 2 diabetes: The Fukuoka Diabetes Registry. Metabolism, 2014; 63(4):484–491.

54.

Pyykkonen

, Isomaa

, Pesonen

, et al. Sleep duration and insulin resistance in individuals without type 2 diabetes: The PPP-Botnia study. Ann Med, 2014; 46(5):324–329.

55.

Javaheri

, Storfer-Isser

, Rosen

, et al. Association of short and long sleep durations with insulin sensitivity in adolescents. J Pediatr, 2011; 158(4):617–623.

56.

Carcamo-Orive

, Gaztelumendi

, Delgado

, et al. Regulation of human bone marrow stromal cell proliferation and differentiation capacity by glucocorticoid receptor and AP-1 crosstalk. J Bone Miner Res, 2010; 25(10):2115–2125.

57.

Hardy

, Zhou

, Seibel

, et al. Glucocorticoids and bone: Consequences of endogenous and exogenous excess and replacement therapy. Endocr Rev, 2018; 39(5):519–548.

58.

Cheng

, Tseng

, Wu

, et al. Pharmacologic and hormonal treatments for menopausal sleep disturbances: A network meta-analysis of 43 randomized controlled trials and 32,271 menopausal women. Sleep Med Rev, 2021; 57:101469.

59.

Polo-Kantola

, Erkkola

, Irjala

, et al. Effect of short-term transdermal estrogen replacement therapy on sleep: A randomized, double-blind crossover trial in postmenopausal women. Fertil Steril, 1999; 71(5):873–880.

60.

Schaedel

, Holloway

, Bruce

, et al. Management of sleep disorders in the menopausal transition. Post Reprod Health, 2021; 27(4):209–214.

61.

Dolsen

, Crosswell

, Prather

. Links between stress, sleep, and inflammation: Are there sex differences?. Curr Psychiatry Rep, 2019; 21(2):8.

62.

Vaananen

, Harkonen

. Estrogen and bone metabolism. Maturitas, 1996; 23 Suppl:S65–S69.

63.

Cummings

, Browner

, Bauer

, et al. Endogenous hormones and the risk of hip and vertebral fractures among older women. Study of Osteoporotic Fractures Research Group. N Engl J Med, 1998; 339(11):733–738.

64.

Khalid

, Krum

. Estrogen receptors alpha and beta in bone. Bone, 2016; 87:130–135.

65.

, Tian

Postmenopausal osteoporosis coexisting with sarcopenia: The role and mechanisms of estrogen. J Endocrinol, 2023; 259(1).

66.

Kim

, Koh

, Ku

, et al. Association between polymorphisms in period genes and bone density in postmenopausal Korean women. Climacteric, 2014; 17(5):605–612.

67.

Viena

, Gobin

, Fins

, et al. A PER3 polymorphism interacts with sleep duration to influence transient mood states in women. J Circadian Rhythms, 2016; 14:3.

68.

Jones

, Tyrrell

, Wood

, et al. Genome-wide association analyses in 128,266 individuals identifies new morningness and sleep duration loci. PLoS Genet, 2016; 12(8):e1006125.

69.

Peng

, Li

, Han

, et al. Association of occupational stress, period circadian regulator 3 (PER3) gene polymorphism and their interaction with poor sleep quality. J Sleep Res, 2022; 31(1):e13390.

70.

Bukowska-Damska

, Reszka

, Kaluzny

, et al. Sleep quality and methylation status of core circadian rhythm genes among nurses and midwives. Chronobiol Int, 2017; 34(9):1211–1223.