Potential Existence of Stem Cells With Multiple Differentiation Abilities to Three Different Germ Lineages in Mouse Neurospheres

Abstract

Neural stem cells (NSCs) are tissue-specific stem cells with self-renewal potential in brain, and are committed cells of the central nervous system. Recently, some reports have suggested the possibility of the NSCs to differentiate into non-CNS mesodermal derivatives, such as blood cells and skeletal muscle cells. Here we isolated NSCs as neurospheres from a neonatal mouse brain using serum replacement medium, and demonstrated that the stem cell population expressing pluripotent-related genes such as Oct-4, Sox-2, and Nanog possess multiple differentiation potentials to ectodermal, mesodermal, and endodermal lineages, that is, some neural cells, beating cardiomyocytes, adipocytes, and insulin-producing cells. The results of the present study partly provide further evidence for multiple differentiation properties of NSCs and suggest common characteristics between NSCs and other pluripotent stem cells.

Introduction

In multicellular organisms, specific stem cell types with distinct developmental potentials occur during development. Transient pluripotent cells, which can differentiate into derivatives of all three embryonic germ layers, are generated during early embryonic development. Somatic stem cells, which represent more restricted potential, develop at later stages. Somatic stem cells have been identified in many tissues in adult organisms and are important for lifelong tissue homeostasis and repair since they can differentiate into progenitors and mature cell types of only one kind of cell type [1]. They present specific functional properties and gene expression patterns that are distinct from pluripotent embryonic stem (ES) cells or terminally differentiated somatic cells. Pluripotency is a transient status that becomes increasingly restricted with proceedings of development [2].

In the brain, the subventricular zone (SVZ) is a source of proliferating cells that replenish olfactory interneurons and glial cells [3,4]. They contain stem cells of neural lineages, which are defined as neural stem cells (NSCs). The NSCs possess specific capacities to self-renew indefinitely in defined media supplemented with either epidermal growth factor (EGF) or basic fibroblast growth factor (FGF) and to differentiate multiple kinds of cells in a neural lineage in vitro upon cytokine exposure [5,6]. More recently, an intrinsic plasticity permissive to NSCs reprogramming, or transdifferentiation has been suggested. NSCs derivatives can reconstitute the hematopoietic system [7 –10], differentiate into endothelial lineages [11] and skeletal muscle cells [12], or contribute to all three embryonic germ layers following blastocyst injection [13,14]. Therefore, it has been assumed that NSCs might possess pluripotency. However, the detailed analysis of these stem cells has not yet been accomplished and it has not been defined whether NSCs have plasticity [15 –17].

In this study, we demonstrate that the cultured NSCs established from mouse neonatal brain expressed pluripotency-associated genes, such as Oct-4, Nanog, and Sox-2, when they were maintained in knockout SR-based serum replacement medium. Furthermore, the NSCs could derive beating cardiomyocytes, adipocytes, and putative pancreatic β-cells after specific differentiation induction in vitro.

Materials and Methods

All procedures related to animal treating were approved by the Institutional Animal Care and Use Committee at Kinki University.

Establishment and culture of NSCs from mouse neonatal brain

C57BL/6J strain mice were used in this study. The whole brain of C57BL/6J mouse pups on postnatal day zero (P0) were minced by scalpel and extra cell clumps were removed using 40-µm cell strainer (BD Falcon^™, Franklin Lakes, NJ). The single cell fractions were plated onto 100-mm Petri dishes (BD Falcon) and cultured in knockout DMEM including MEM nonessential amino acids, 0.1 mM β-mercaptoethanol, 200 mM l-glutamine, and 20% knockout SR (all were purchased from Invitrogen Corporation, CA) supplemented with 10 ng/mL basic fibroblast growth factor (bFGF; Millipore Corporation, Billerica, MA), and 20 ng/mL EGF (Sigma-Aldrich, Inc., St. Louis, MO). After culture for 7 days, ∼100 µm size cell clumps were selected, disaggregated by 0.25% Trypsin (Invitrogen, Carlsbad, CA) plus 0.04% EDTA (Sigma-Aldrich) in PBS (–) and replated into a Petri dish at 15 × 10⁴ cells per 60-mm dish. Cryostorage of these cells was performed at −80° for 3 months using Cell banker (Mitsubishi Kagaku Iatron, Inc., Tokyo, Japan). Differentiation study to demonstrate the neural commitment capacity of these cells was carried out by plating the cell clumps onto gelatin-coated dishes, and cultured them in 10% FBS-supplemented Iscove’s modified Dulbecco’s medium (IMDM; Invitrogen) for 7 days. Differentiated cells were evaluated by RT-PCR, western blot, and immunofluorescent staining. For the control study, we performed the same procedures using NeuroCult^® Proliferation Kit (STEM CELL technologies, Vancouver, BC, Canada).

RT-PCR analysis for evaluation of the stem cell characteristics

A brain collected from a P0 pups and the established NSCs were treated with TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Single-strand cDNA was prepared from total RNA using an oligo-dT primer under standard conditions with the Superscript III reverse transcriptase (Invitrogen). The cDNA from each sample was diluted and used for RT-PCR assays using objective primers (Table 1). PCR with total cDNA was performed using Ex-Taq (Takara Bio Inc., Shiga, Japan) or Platinum Taq PCRx DNA polymerase (Invitrogen). The reaction profile was 94°C for 2 min followed by 35 cycles of 94°C for 30 s, 56°C for 30 s, and 70°C for 30 s.

Table 1.

Primers for Characteristics of the Neural Stem Cells and Differentiated Cells

	Genes	Forward primers (5′–3′)	Reverse primers (5’–3’)
RT-PCR	Musashi-1	CGAGCTCGACTCCAAAACAATTGACC	TCTACACGGAATTCGGGGAACTGGTA
	Nestin	AGTCTGGAAGTGGCTACATAC	TAAGGAGGTTGGATCATCAG
	Sox-2	TACAACTCCATGACCAGCTC	AGCGCCTAACGTACCACTAG
	Oct-4	TGGAGACTTTGCAGCCTGAG	CATACTCTTCTCGTTGGGAATA
	Nanog	AACTCTCCTCCATTCTGAAC	ATTTCACCTGGTGGAGTCAG
	Pax-4	TGAGGAGTACCAGTGTGAAGC	AAGATAGTCCGATTCCTGTGG
	Gapdh	ACCACAGTCCATGCCATCAC	TCCACCACCCTGTTGCTGTA
Real time PCR	β-actin	TTCCAGCCTTCCTTCTTG	GTCACACTTCATGATGGAATTG
	Oct-4	GCAGAAGAGGATCACCTTGG	GATGGTGGTCTGGCTGAACA
	Musashi-1	GCCATGCTGATGTTCGAG	CTCTCAAACGTGACAAATCCA

Real-time PCR analysis for quantification of Oct-4 expression

Quantitative real-time PCR with total cDNA was performed using Perfect real-time SYBR green II (Takara Bio). PCR amplifications were performed with the 7700 real-time PCR System (Applied Biosystems, Foster City, CA) at 95°C for 10 s followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. To quantify the relative expression of each gene, the C_t (threshold cycle) values were normalized by β-actin (ΔCt = Ct_target − Ct_β-actin) and compared with a calibrator, using the “ΔΔCt method (ΔΔCt = ΔCt_sample − ΔCt_calibrator).” As a calibrator, we used the average Ct value of an undifferentiated ES cell line established from C57BL/6J. Relative expression was calculated (2^−ΔΔCt) using the ΔΔCt value. The target genes in the present experiment were Oct-4 and Musashi-1 (Table 1). All experiments included negative controls consisting of no cDNA for any primer pair. Primers were designed to span exons to distinguish cDNA from genomic DNA products. In this study, we compared the expression quantity of Oct-4 and Musashi-1 between different passage numbers and different culture conditions. Samples were the NSCs at passages 2 and 7, the NSCs maintained in adherent condition with KSR-based medium, and the NSC-derivative cells induced from the NSCs at passages 2 and 7, which was maintained in suspension culture with KSR medium, by transferring it onto gelatin-coated dishes and culturing in IMDM-based differentiation medium. The values are mean ± SD of three experiments. Statistical significance of the differences was evaluated by the Tukey–Kramer HSD test.

Immunofluorescent staining for characterization of the NSCs

The NSCs were fixed in 4% paraformaldehyde in PBS (4% PFA; pH 7.4). For immunofluorescent staining of Musahi-1, Nestin, TuJ, GFAP, O4, and Oct-4, fixed NSCs were then permeabilized in 0.5% Triton-X (Sigma-Aldrich) diluted in PBS (0.5% PBT) for 5 min, blocked by incubation in 5% skim milk (Sigma-Aldrich) diluted in PBS for 1 h, and then incubated with primary antibody overnight at 4°C. The antibodies were anti-Musashi-1 rabbit IgG polyclonal antibody (Abcam, Cambridge, UK), anti-Nestin goat polyclonal antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-neuronal class III β-tubulin mouse monoclonal IgG antibody (TuJ; Abcam), anti-glial fibrillary acidic protein mouse monoclonal IgG antibody (GFAP; Ylem S.r.l., Roma, Italia), anti-O4 mouse monoclonal IgM antibody (R&D Systems, Minneapolis, MN), and anti-Oct-4 rabbit IgG polyclonal antibody (Santa Cruz Biotechnology) diluted 1/100 in 0.1% PBT. For immunofluorescent staining of SSEA-1, fixed cells were washed with 0.5% BSA (Sigma-Aldrich) in PBS and blocked by incubation in 5% skim milk for 1 h. The antibodies were anti-SSEA-1 mouse monoclonal IgM antibody (Santa Cruz Biotechnology) diluted 1/100 in 0.5% BSA/PBS. For immunofluorescent observation, the samples were incubated for 1 h at room temperature with FITC-conjugated bovine anti-mouse IgG antibody (Santa Cruz Biotechnology) diluted 1/1,000 in 0.1% PBT to detect Nestin or TuJ, rhodamine-conjugated donkey anti-mouse IgG antibody (Santa Cruz Biotechnology) diluted 1/1,000 in 0.1% PBT to detect GFAP, Cy3-conjugated goat anti-mouse IgM antibody (Millipore) diluted 1/1,000 in 0.1% PBT to detect O4, rhodamine-conjugated bovine anti-rabbit IgG antibody (Santa Cruz Biotechnology) diluted 1/1,000 in 0.1% PBT to detect Oct-4 and Musashi-1. For the detection of SSEA-1, we used Cy3-conjugated goat anti-mouse IgM antibody as the secondary antibody.

Samples were then washed three times for 10 min each in PBS, and incubated in DAPI (Vector Laboratories, Ltd., Peterborough, England) for counterstaining. These samples were mounted with VECTASHIELD mounting medium (Vector Laboratories) to avoid signal reduction.

For flow cytometry, cells were fixed in 10% formaldehyde in phosphate-buffered saline (PBS) for 15 min, washed, and permeabilized with 0.1% PBT for 5 min. The cells were washed again with PBS and incubated with 10% FCS–PBS for 30 min at room temperature. After washing, an indirect immunofluorescence assay was performed by incubating the permeabilized cells for 12 h at 4°C with anti-Oct-4 goat IgG polyclonal antibody diluted 1/100 in 0.1% PBT. After washing, an FITC-conjugated secondary antibody was added for 30 min. The cells were then washed twice with PBS supplemented with FCS, and immunofluorescence was analyzed by flow cytometry with FACSCalibur cytometer (Becton Dickinson, Franklin Lakes, NJ). Fibroblast cells prepared from C57BL/6J mouse pups (negative control) or ES cells of C57BL/6J (positive control) were treated by the same procedure and used as control groups.

Western blot analysis

The tissues and the appropriate number of cells (2 × 10⁴ cells/well) were collected and homogenized in SDS buffer (4% SDS, 125 mM Tris–glycine, 10% β-mercaptoethanol, 2% bromophenol blue in 30% glycerol) then centrifuged at 10,000 rpm for 10 min at 4°C to remove any debris. Aliquots were subjected to polyacrylamide gel electrophoresis in the presence of SDS (SDS/PAGE) followed by electrotransfer onto a PVDF membrane (Hybond-P; Amersham Pharmacia Biotech, Buckinghamshire, UK). Molecular size was calibrated with Precision plus protein^™ all blue standards (Bio-Rad; Mississauga, ON, Canada). The blotted membranes were blocked overnight with Block ace (Dainippon Sumitomo Pharma, Osaka, Japan), then proved with objective primary antibody overnight at 4°C. Antibody incubation and wash were performed in 0.1% Tween-20/PBS. Detection was performed with an ECL plus western blotting detection system (Amersham Pharmacia Biotech) and horseradish peroxidase (HRP)-conjugated secondary antibodies (Santa Cruz Biotechnology). The lumino-labeled membranes were developed using an X-ray film processor. The antibodies were anti-Musashi-1 rabbit IgG polyclonal antibody (Abcam), anti-Oct-4 mouse monoclonal antibody (Santa Cruz Biotechnology) diluted at 1/3,000 and anti-Actin goat IgG polyclonal antibody (Santa Cruz Biotechnology) diluted at 1/10,000 in PBS containing 0.1% Tween-20 and 10% Block ace.

Induction of cardiomyocytes

Trypsin-treated and dispersed NSCs were cultured under nonadherent conditions in Knockout DMEM supplemented with 20% knockout SR, 0.1% DMSO (Wako Pure Chemical Industries, Tokyo, Japan), and 0.1 nM H₂O₂ (Sigma-Aldrich). After 21 days of suspension culture, these cells were analyzed by immunofluorescent staining. Immunofluorescence was performed using anti-cardiac troponin-T mouse monoclonal IgG antibody (cardiac-specific troponin-T [cTnT]; Abcam). Samples were observed after reacting with FITC-conjugated anti-mouse IgG secondary antibody (Santa Cruz Biotechnology).

Induction of adipocytes

The NSCs at passage 3 were plated onto mitomycin C (Sigma-Aldrich)-treated mouse embryonic fibroblasts. Then, these cells were cultured in 20% FBS DMEM supplemented with 1 mM sodium octanoate (Sigma-Aldrich) and 1 mM dexamethasone (Sigma-Aldrich). The medium was changed every 3 days. After 2 weeks culture, adipogenic differentiation was confirmed by staining with Oil-Red O (Primary cell Co., Ltd. Hokkaido, Japan) diluted with isopropanol.

Induction of pancreatic β-cells

Method for inducing pancreatic β-cells has been previously reported [18]. The NSCs at passage 3 were plated onto a gelatin-coated dish and cultured in 20% FCS contained IMDM medium supplemented with 10 nM nicotinamide (Invitrogen) and 10 ng/mL bFGF for 21 days. Terminally differentiated samples were collected for RT-PCR or fixed for immunofluorescent staining. RT-PCR analysis was performed using primers for Pax-4 (Table 1). Immunofluorescent study was performed using anti-C-peptide rabbit IgG polyclonal antibody (Yanaihara Institute Inc, Shizuoka Japan.) and FITC-conjugated anti-rabbit IgG secondary antibody (Santa Cruz Biotechnology).

Results and Discussion

Expression of pluripotent-related genes in spheres of NSCs

Recently, some researchers have taken notice of the brain and NSCs as a potential source for multipotent stem cells [7 –14]. However, isolation of the cells still has not been performed and it is still a subject for scientific debate as to whether or not these cells exist [15 –17]. In the present study, we partly demonstrated that the NSCs maintained in KSR-based medium expressed some pluripotent cell markers and could differentiate to multiple lineages in vitro.

Knockout SR is a suitable supplement for culture of pluripotent stem cells such as ES cells or EG cells, and now it is mainly used for the maintenance of undifferentiated condition of pluripotent cells [19]. We found that the culture condition of 20% knockout SR medium supplemented with bFGF and EGF was effective for obtaining the NSCs. In the culture condition, the cells proliferated well and formed spheres with average sizes of 100 µm within 7 days of culture (Fig. 1A–1D). The NSCs expressed neural stem cell markers such as Nestin and Musashi-1 (Fig. 1E and 1F). After adhesion, these cells derived neuraxis-like structure, exhibited neuron marker β-tubulin class III, astrocyte marker GFAP, and oligodendrocyte maker O4 (Fig. 1G–1I). Interestingly, the NSCs isolated in the present systems expressed pluripotent state-related genes Oct-4 and Nanog (Fig. 2A) in addition to NSC markers Sox-2 and Musashi-1. Oct-4 expression in the NSCs was also confirmed in the post-transcriptional level (Fig. 2B). When the NSCs were observed by immunofluorescent staining, almost all of the cells expressed SSEA-1, which is an important marker for pluripotent stem cells in the mouse. On the other hand, Oct-4 expressions were seen in more limited number of cells, the Oct-4 expressing cells were observed as a mosaic pattern in the spheres (Fig. 2C). FACS analysis revealed that ∼20% of total cells expressed Oct-4 (Fig. 2D).

FIG. 1.

Neurosphere cultures of neural stem cells (NSCs) derived from P0 mouse pups. Sphere formation from the newborn mouse brain (A–D). Scale bars = 200 µm. Immunofluorescence observation of isolated NSCs using anti-Nestin antibody (E), anti-Musashi-1 antibody (F). The NSCs derived some neural cells expressing neural cell marker TuJ (G), glial cell marker GFAP (H), and oligodendrocyte marker O4 (I). Scale bars = 100 µm.

FIG. 2.

Observation of pluripotent state-related genes in cultured neural stem cells (NSCs) and brains. (A) RT-PCR-based characterization of the NSCs. The NSCs used in this study were passaged three times in KSR-based medium. Muscular tissue was used as a negative control and ES cells as a positive control. (B) Western blot analysis for neural stem cell marker Musashi-1 and pluripotent cell marker Oct-4. NC means negative control (muscular tissue of adult mouse). (C) Immunofluorescent observation for pluripotent cell markers SSEA-1- and Oct-4 (scale bars = 200 µm) expressing cells in neurospheres and magnified image of the merged picture (scale bars = 40 µm). (D) Detection of Oct-4 by flow cytometry. Oct-4 expressions were analyzed by overlaying and comparing the FITC histograms of Oct-4 expressing cells (ES cells) and negative control samples (fibroblast). Oct-4 expressing cells were determined by comparison with the fluorescence profile of negative control samples (black open histogram) where the gate was set so that background fluorescence was no higher than 0.1%. As shown in the red open histogram, ∼20% of NSCs expressed Oct-4.

Interestingly, expressions of Oct-4 and Nanog were not detected when the NSCs are established in ordinary NSC-specified medium (Fig. 3). Furthermore, we could not observe the expressions of Oct-4 by western blot and immunofluorescent staining in the P0 brain (see Supplementary Fig. 1; Supplementary materials are available online at http://www.liebertpub.com), although a very weak expression was detected by RT-PCR analysis. These results suggest that the culture in KSR-supplemented medium may function as a key factor to enhance the pluripotent-related gene expression of NSCs or expand the limited stem cell population originally expressing pluripotent cell markers. Then, we examined the effect of the culture condition to expression of the pluripotent markers. Although Oct-4 expression was significantly decreased from passage 2 to passage 7, more drastic down-regulation of the Oct-4 was observed only after transferring the NSCs to adherent condition (Fig. 4). This marked depression of Oct-4 expression was observed even though the NSCs at passage 2 were used for the experiment. It was suggested that the suspension culture was also an important factor to maintain the expression of pluripotent state. On the other hand, expression of a NSC-specific marker Musashi-1 did not alter when the cells were transferred to adherent condition (Fig. 4).

FIG. 3.

Characterization of the neural stem cells (NSCs) obtained by a standard condition with NeuroCult^® medium. (A) Neural stem cell marker expressions were determined by RT-PCR. (B) Expression of pluripotent state-related genes were also observed by RT-PCR. (C) Evaluation of the differentiation properties to neural lineage for the NSCs obtained from the control experiment (a–c). Scale bars = 200 µm. The NSCs differentiated and expressed neuronal marker TuJ (d), glial cell marker GFAP (e), and oligodendrocyte marker O4 (f). These results evidenced that the NSCs possess ordinal characteristics as stem cells of a neural lineage. Scale bars = 100 µm.

FIG. 4.

Real-time PCR-based quantification of pluripotent marker Oct-4 and neural stem cell marker Musashi-1. The y-axis of real-time PCR assay represents ΔΔCt values, which were obtained using average scores of three undifferentiated ES cell samples as calibrators (mean ± SD). Different characters indicate statistically significant difference (P < 0.05) determined by the Tukey–Kramer HSD tests.

Multiple differentiation potentials of the NSCs

To confirm multilineage differentiation potential of the NSCs, we induced the NSCs to cardiomyocytes, adipocytes, and insulin-producing cells in each specific condition. In cardiomyocyte-inducing culture, some cells contained in the spheres exhibited consecutive beating 3 weeks after differentiation (see Supplementary Video). Cardiomyocyte differentiation was confirmed by observing the expression of cardiac-specific troponin-T (Fig. 5). About 0.5% of total spheres formed in the differentiation conditions contained cTnT-positive cardiomyocytes. Adipocyte differentiation was more often observed than cardiomyocyte. The NSCs maintained in our system differentiated to adipocytes well, many spheres showed an abundance of Oil Red-O-stained lipid droplets after 2 weeks differentiation. The frequency of the cells stained by the Oil Red-O was 3%–5% of all adherent cells (Fig. 5).

FIG. 5.

Induction of differentiation to the mesodermal tissues. Cardiac troponin T expressing cardiomyocytes were observed 3 weeks after differentiation (scale bars = 100 µm). Adipocytes were observed in adhesion culture at 2 weeks after differentiation induction (scale bars = 100 µm; scale bar of magnified image = 25 µm).

Furthermore, insulin-producing cells were also developed although it occurred at extremely low rates. Three weeks after induction, C-peptide expressing cells were derived from NSC colonies (Fig. 6A). C-peptide is a byproduct of proinsulin when it is split, and is considered as a reliable marker of β-cell function. These cell clusters expressed pancreatic β-cell development-related genes Pax-4 as an additional marker (Fig. 6B). We think the cells differentiated to mesodermal or endodermal lineages were not derived from other origins such as neural crest cells or vascular endothelial cells since the NSCs remained in suspension cultures using KSR-contained medium, which was not a suitable condition for mesenchymal cell proliferation [14], and repeated bottleneck passages under the above conditions might result in fitness losses of other lineages. Furthermore, beating cardiomyocytes were observed in almost all areas of differentiated spheres, though the spheres were dissociated to single cells by enzymatic treatment in passage.

FIG. 6.

Induction of differentiation to putative insulin-producing β-cells from the NSCs. (A) C-peptide expression was observed by immunofluorescent staining with anti-C-peptide antibody (Scale bars = 100 µm). (B) Insulin-producing/progenitor cell marker Pax-4 was also detected in the differentiated cells at 3 weeks after differentiation. Abbreviations: NSCs, neural stem cells; NSCs-Dif, differentiated cells from NSCs; NC, negative control (muscular tissue); PC, positive control (embryonic pancreas).

In this study, we observed that the spheres of NSCs contain stem cell populations expressing pluripotent cell markers and were able to differentiate into three different germ layers in vitro. As for the wide range differentiation properties of somatic stem cells, it has been reported that somatic stem cells were originally estimated to have broader range of differentiation potentials than conventionally defined. For example, the bone marrow stem cells were shown to differentiate into skeletal muscular cells, epidermal cells and nerve cells, hepatocytes and intestinal cells [20 –23]. Moreover, pluripotent somatic stem cells were established in a similar way to that of ES cells from human bone marrow cells [24]. These cells exhibit a high potential of differentiation to three germ layers in vivo and in vitro, and expressed the ES cell marker genes of Oct-4 and Rex-1. Pluripotent cells were also reported in the testis. The spermatogonial stem cells producing the sperm are also found in the testis [25]. These stem cells have potential to transdifferentiate into pluripotent stem cells called multipotent germ-line stem cells (mGS cells) in specific culture conditions [26,27].

We changed the culture condition using the serum-deprived medium optimized for pluripotent stem cell cultures to obtain stem cells from the mouse brain. It is presumed that fully artificial culture conditions alter original gene expressions of NSCs, or stimulate cell proliferation of more primitive stem cells in NSCs, and it brings out multipotent stem cells. As an interesting character, these cells did not generate teratomas nor contribute to chimera mouse when injected in kidney capsules or blastocysts of the mouse. Furthermore, even if the NSCs were cultured on MEF feeder cells in the presence of leukemia inhibitory factor, which is an essential factor for mouse pluripotent stem cells to maintain undifferentiated state and to perform self-renewal, they did not form dome-shaped colony that was a common characteristic in mouse pluripotent cell lines such as ES cells, EG cells, and mGS cells (data not shown). This might indicate that they did not possess intact pluripotency as ES cells. Recently, it has been shown that TSA/AZA-treated neurospheres express the pluripotent-associated genes such as Oct-4, Nanog, and Sox-2 [28]. However, they were not able to maintain to the undifferentiated state such as ES cells. This fact might mean that the activation of pluripotency-associated genes is a transient phenomenon.

It is necessary to elucidate whether pluripotent stem cells originally exist in brain, or were established by stimulation from our culture condition. Furthermore, we have not yet determined whether the Oct-4 and Nanog expressing cells correspond to the cells representing multiple differentiation potency. However, the fact that the various cells could be derived from the cultures of NSCs might suggest a possibility of existence of the pluripotent stem cell lines, which possess potential application in cell transplantation therapies. Furthermore, our results and the culture system used in the present study might include one key to understanding pluripotent states and dedifferentiation processes of stem cells.

Footnotes

Acknowledgments

This study was supported by grants from the Wakayama Prefecture Collaboration of Regional Entities for the Advancement of Technological Excellence of the JST and the Grant-in-Aid for Young Scientists (start-up) to T. Teramura from the JSPS. We gratefully acknowledge Ms. Naomi Backes Kamimura and Ms. Julia Walhelm, Department of Biology-Oriented Science and Technology, Kinki University, for English editing.

References

Weissman

. (2000). Stem cells: units of development, units of regeneration, and units in evolution. Cell, 100:157–168.

Boiani

and Schöler

. (2005). Regulatory networks in embryo-derived pluripotent stem cells. Nat Rev Mol Cell Biol, 6:872–884.

Peretto

, Merighi

, Fasolo

and Bonfanti

. (1999). The subependymal layer in rodents: a site of structural plasticity and cell migration in the adult mammalian brain. Brain Res Bull, 49:221–243.

Brazel

, Romanko

, Rothstein

and Levison

. (2003). Roles of the mammalian subventricular zone in brain development. Prog Neurobiol, 69:49–69.

Reynolds

, Tetzlaff

and Weiss

. (1992). A multipotent EGF-responsive striatal embryonic progenitor cell produces neurons and astrocytes. J Neurosci, 12:4565–4574.

Reynolds

and Weiss

. (1996). Clonal and population analyses demonstrate that an EGF-responsive mammalian embryonic CNS precursor is a stem cell. Dev Biol, 175:1–13.

Almeida-Porada

, Crapnell

, Porada

, Benoit

, Nakauchi

, Quesenberry

and Zanjani

. (2005). In vivo haematopoietic potential of human neural stem cells. Br J Haematol, 130:276–283.

Shih

, Weng

, Mamelak

, LeBon

, Hu

and Forman

. (2001). Identification of a candidate human neurohematopoietic stem-cell population. Blood, 98:2412–2422.

Bjornson

, Rietze

, Reynolds

, Magli

and Vescovi

. (1999). Turning brain into blood: a hematopoietic fate adopted by adult neural stem cells in vivo. Science, 283:534–537.

10.

Schmittwolf

, Kirchhof

, Jauch

, Dürr

, Harder

, Zenke

and Müller

. (2005). In vivo haematopoietic activity is induced in neurosphere cells by chromatin-modifying agents. EMBO J, 24:554–566.

11.

Wurmser

, Nakashima

, Summers

, Toni

, D'Amour

, Lie

and Gage

. (2004). Cell fusion-independent differentiation of neural stem cells to the endothelial lineage. Nature, 430:350–356.

12.

Galli

, Borello

, Gritti

, Minasi

, Bjornson

, Coletta

, Mora

, De Angelis

, Fiocco

, Cossu

and Vescovi

. (2000). Skeletal myogenic potential of human and mouse neural stem cells. Nat Neurosci, 3:986–991.

13.

Clarke

, Johansson

, Wilbertz

, Veress

, Nilsson

, Karlström

, Lendahl

and Frisén

. (2000). Generalized potential of adult neural stem cells. Science, 288:1660–1663.

14.

Murrell

, Féron

, Wetzig

, Cameron

, Splatt

, Bellette

, Bianco

, Perry

, Lee

and Mackay-Sim

. (2005). Multipotent stem cells from adult olfactory mucosa. Dev Dyn, 233:496–515.

15.

Kennea

and Mehmet

. (2002). Transdifferentiation of neural stem cells, or not?. Pediatr Res, 52:320–321.

16.

Vogel

. (2002). Stem cell research. Studies cast doubt on plasticity of adult cells. Science, 295:1989–1991.

17.

Foroni

, Galli

, Cipelletti

, Caumo

, Alberti

, Fiocco

and Vescovi

. (2007). Resilience to transformation and inherent genetic and functional stability of adult neural stem cells ex vivo. Cancer Res, 67:3725–3533.

18.

Blyszczuk

, Czyz

, Kania

, Wagner

, Roll

, St-Onge

and Wobus

. (2003). Expression of Pax-4 in embryonic stem cells promotes differentiation of nestin-positive progenitor and insulin-producing cells. Proc Natl Acad Sci USA, 100:998–1003.

19.

Bryja

, Bonilla

, Cajánek

, Parish

, Schwartz

, Luo

, Rao

and Arenas

. (2006). An efficient method for the derivation of mouse embryonic stem cells. Stem Cells, 24:844–849.

20.

Chun-mao

, Su-yi

, Ping-ping

and Hang-hui

. (2007). Human bone marrow-derived mesenchymal stem cells differentiate into epidermal-like cells in vitro. Differentiation, 75:292–298.

21.

Jiang

, Jahagirdar

, Reinhardt

, Schwartz

, Keene

, Ortiz-Gonzalez

, Reyes

, Lenvik

, Lund

, Blackstad

, Du

, Aldrich

, Lisberg

, Low

, Largaespada

and Verfaillie

. (2002). Pluripotency of mesenchymal stem cells derived from adult marrow. Nature, 418:41–49.

22.

Sémont

, François

, Mouiseddine

, François

, Saché

, Frick

, Thierry

and Chapel

. (2006). Mesenchymal stem cells increase self-renewal of small intestinal epithelium and accelerate structural recovery after radiation injury. Adv Exp Med Biol, 585:19–30.

23.

Lagasse

, Connors

, Al-Dhalimy

, Reitsma

, Dohse

, Osborne

, Wang

, Finegold

, Weissman

and Grompe

. (2000). Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat Med, 6:1229–1234.

24.

Beltrami

, Cesselli

, Bergamin

, Marcon

, Rigo

, Puppato

, D'Aurizio

, Verardo

, Piazza

, Pignatelli

, Poz

, Baccarani

, Damiani

, Fanin

, Mariuzzi

, Finato

, Masolini

, Burelli

, Belluzzi

, Schneider

and Beltrami

. (2007). Multipotent cells can be generated in vitro from several adult human organs (heart, liver, and bone marrow). Blood, 110:3438–3446.

25.

de Rooij

. (1998). Stem cells in the testis. Int J Exp Pathol, 79:67–80.

26.

Kanatsu-Shinohara

, Inoue

, Lee

, Yoshimoto

, Ogonuki

, Miki

, Baba

, Kato

, Kazuki

, Toyokuni

, Toyoshima

, Niwa

, Oshimura

, Heike

, Nakahata

, Ishino

, Ogura

and Shinohara

. (2004). Generation of pluripotent stem cells from neonatal mouse testis. Cell, 119:1001–1012.

27.

Guan

, Nayernia

, Maier

, Wagner

, Dressel

, Lee

, Nolte

, Wolf

, Li

, Engel

and Hasenfuss

. (2006). Pluripotency of spermatogonial stem cells from adult mouse testis. Nature, 440:1199–1203.

28.

Ruau

, Ensenat-Waser

, Dinger

, Vallabhapurapu

, Rolletschek

, Hacker

, Hieronymus

, Wobus

, Müller

and Zenke

. (2008). Pluripotency associated genes are reactivated by chromatin-modifying agents in neurosphere cells. Stem Cells, 26:920–926.