Identification of a Common Gene Expression Signature Associated with Immature Clonal Mesenchymal Cell Populations Derived from Bone Marrow and Dental Tissues

Abstract

Mesenchymal stem/stromal cell-like populations derived from adult bone marrow (BMSC), dental pulp (DPSC), and periodontal ligament (PDLSC) have the ability to differentiate into cells of mesenchymal and non-mesenchymal tissues in vitro and in vivo. However, culture-expanded MSC-like populations are a heterogeneous mix of stem/committed progenitor cells that exhibit altered growth and developmental potentials. In the present study we isolated and characterized clonal populations of BMSCs, DPSCs, and PDLSCs to identify potential biomarkers associated with long-lived multipotential stem cells. Microarray analysis was used to compare the global gene expression profiles of high growth/multipotential clones with low growth potential cell clones derived from 3 stromal tissues. Cross-comparison analyses of genes expressed by high growth/multipotential clones derived from bone marrow, dental pulp, and periodontal ligament identified 24 genes that are differentially up-regulated in all tissues. Notably, the transcription factors, E2F2, PTTG1, TWIST-1, and transcriptional cofactor, LDB2, each with critical roles in cell growth and survival, were highly expressed in all stem cell populations examined. These findings provide a model system for identifying a common molecular fingerprint associated with immature mesenchymal stem-like cells from different organs and implicate a potential role for these genes in MSC growth and development.

Introduction

C lonogenic mesenchymal stem/stromal cells (MSCs) were initially identified from bone marrow aspirates, spleen, and thymus in rodents [1, 2]. A similar clonogenic population was subsequently identified in human bone marrow aspirates (BMSC) [3] with the ability to form skeletal tissues and hematopoietic-supportive stroma, when transplanted with osteoconductive biomaterial carriers into ectopic sites of immunocompromised mice [4 –6].

Recent studies have identified clonogenic MSC-like populations in dental structures, including adult dental pulp, periodontal ligament, and the pulp of exfoliated deciduous teeth [7 –9] with phenotypic/genotypic characteristics and properties similar to those described for BMSC [10,11]. Clonogenic MSC-like cells from bone marrow, dental pulp, and periodontal ligament are all capable of forming mineralized nodules and adipocytes under defined inductive conditions in vitro. In contrast, human dental pulp stem cells (DPSCs) do not form bone and hematopoietic supportive stroma in vivo, but rather exhibit the capacity to regenerate an ectopic dentin-pulp-like microenvironment following transplantation into immunocompromised mice [7]. Similarly, when transplanted under the same conditions, human periodontal ligament stem cells (PDLSCs) are capable of regenerating calcified structures of cementum impregnated with periodontal ligament-like filaments (Sharpe's fibers) that sprout from the surrounding collagen-rich fibrous tissue [8]. Collectively, these studies infer that adult-derived MSC-like cells are genetically programmed to regenerate the microenvironments from which they were originally derived in vivo. The common stem cell-like properties and heterogeneity exhibited within the different BMSC, DPSC, and PDLSC populations provide a model system for comparative genomic profiling as a means of identifying gene expression patterns that are associated with the growth and development of stromal stem cells and their more committed progeny.

The emergence of high-density gene array technology, in combination with the knowledge obtained from the sequencing of the human genome [12,13], allows the assessment of global patterns of gene expression across multiple experimental samples and enables identification of major genomic differences and unique biological markers specific to the target cell populations [14]. These advances in genomic profiling provide rapid and reliable data sets that define vital processes involved in cellular growth, survival, and development that can be readily applied to different MSC-like populations following immunoselection and ex vivo expansion. The aim of our study was to identify differentially expressed genes unique to immature, high-proliferating, multipotential MSC-like populations that are likely to be used in the treatment of various clinical conditions. To achieve this, we compared the growth and differentiation of stem/progenitor cells and their progeny contained within the BMSC, DPSC, and PDLSC populations using a global microarray analysis strategy. Using this approach, we have identified a common gene set commonly expressed by MSC clones from bone marrow, dental pulp, and periodontal ligament that exhibit high growth capacity and multilineage differentiation potential.

Materials and Methods

Subjects

Human bone marrow aspirates were obtained from the posterior iliac crest of normal adult volunteers (20–35 years old) following informed consent, according to procedures approved by the ethics committee of the Royal Adelaide Hospital, South Australia. Bone marrow mononuclear cells (BMMNCs) were prepared by density centrifugation as previously described [6, 15]. Normal human-impacted third molars were collected from healthy volunteers between 15 and 19 years of age with informed consent, according to procedures approved by the ethics committee of the University of Adelaide, South Australia. Dental pulp and periodontal ligament tissue were isolated and enzymatically digested to generate single cell suspensions as previously described [7,8,16].

Cell isolation and culture

Magnetic-activated cell sorting was performed on BMMNC preparations as previously described [6,15]. In brief, 1−3 × 10⁸ BMMNCs were sequentially incubated with mouse anti-human STRO-1 [17] on ice for 1 h. Following washing, the cells were incubated with goat anti-mouse IgM-biotin (Southern Biotechnology Associates, Birmingham, AL) for 30 min on ice, washed, and then incubated with anti-biotin microbeads (Miltenyi Biotec Inc., Auburn, CA) for 15 min on ice. STRO-1-positive cells were then separated on a Mini MACS magnetic column (Miltenyi Biotec Inc.) according to the manufacturer's recommendations.

Dynal bead cell sorting was performed on single cell suspensions of dental pulp and periodontal ligament as previously described [15]. In brief, each cell suspension was incubated with mouse anti-human STRO-1 for 1 h on ice. Following washing, the cells were incubated with rat anti-mouse IgM-conjugated Dynabeads (Dynal Biotech, Oslo, Norway) at 4 beads per cell on a rotary mixer at 4°C for 2 h. STRO-1-positive cells were isolated with Dynal MPC-1 magnetic particle concentrator (Dynal Biotech) according to the manufacturer's recommendations.

Primary BMSC, DPSC, and PDLSC cultures were established in α-minimum essential media (α-MEM; Sigma-Aldrich, St. Louis, MO) supplemented with 20% fetal calf serum (FCS; Thermo Electron, Melbourne, Australia) and 100 μM l-ascorbate-2-phosphate (Wako Pure Chemical Industries, Richmond, VA), 1 mM sodium pyruvate (Sigma-Aldrich Inc., St. Louis, MO), 50 μg/mL streptomycin 50 U/mL penicillin (JRH Biosciences, Lenexa, KS), and 2 mM l-glutamine (Sigma-Aldrich Inc., St. Louis, MO). Cells were plated at 5 × 10³ cells/cm² into 10-cm culture dishes and incubated at 37°C, 5% CO2 for 10–14 days. Individual colonies were isolated using colony rings and expanded into individual vessels for further cultivation, as previously described [5,11].

Assessment of population doublings

Single cell-derived colonies obtained from primary cultures of BMSC, DPSC, and PDLSC populations were seeded at 8 × 10³ cells/cm² and allowed to expand to ∼90% confluency before being harvested by trypsin/EDTA (JRH Biosciences, Lenexa, KS) treatment. Representative cell samples for each clone were passaged at a seeding density of 8 × 10³ cells/cm² into 24-well plates until they had reached in vitro cellular senescence. Cell counts were performed at each passage and population doublings were calculated using the formula (log₂ final cell number/log₂ seeding cell number). The final population doubling value for each colony was represented as the sum of population doubling values obtained at each passage. The population doubling times per cell passage were calculated using the formula: Generation time = (log₂ × days in culture)/(log final cell number—log seeding cell number).

Differentiation assays

Mineralization was induced as previously described [6,18]. In brief, BMSCs, DPSCs, and PDLSCs at passage 6 were seeded at 8 × 10³ per cm² in 24-well plates and cells were cultured in α-MEM supplemented with 5% FCS, 100 μM l-ascorbate-2-phosphate, 1 mM sodium pyruvate, 50 μg/mL streptomycin, 50 U/mL penicillin, and 2 mM l-glutamine, dexamethasone 10⁻⁷ M (Mayne Pharma, Mulgrave, VIC, Australia), and 1.8 mM inorganic phosphate (KH₂PO₄, BDH Chemicals, Poole, UK) for 28 days with media changes twice weekly. Mineral deposit formation was identified by Alizarin Red (Alizarin Red S; Sigma-Aldrich Inc., St. Louis, MO) staining. Replicate plates were treated with 0.6 N HCl and extracellular calcium deposits were measured in the presence of o-cresolphthalein complexone (Sigma-Aldrich Inc.) with an absorbance read at 570 nm as previously described [6]. Adipogenesis was induced as previously described [6,19,20]. In brief, BMSCs, DPSCs, and PDLSCs at passage 6 were seeded at 8 × 10³ per cm² in 24-well plates and were cultured for 28 days in the presence of 0.5 μM hydrocortisone (Sigma-Aldrich Inc.), 60 μM indomethacin (Sigma-Aldrich Inc.), and 0.5 mM IBMX (3-isobutyl-1-methylxanthine; Sigma-Aldrich Inc.) with media changes twice a week. Formation of lipid-laden fat cells was determined by Oil Red O (MP Biomedicals, Solon, OH) staining. Chondrogenesis was induced as previously described [21]. Quantitation of Oil Red O was performed in replicate wells following treatment with 100% isopropanol and absorbance read at 510 nm. Chondrogenic cell pellets were prepared from 1 × 10⁶ cells, and cultured for 28 days in induction media ± TGF-β1. Pellet cultures were fixed with 4% paraformaldehyde, and sectioned for hematoxylin and eosin staining and immunohistochemical staining with mouse anti-human collagen type II monoclonal antibody (MAB1330; Chemicon International, Temecula, CA) used at 1 in 100 dilution. Glycosaminoglycan synthesis was measured in replicate high density (1 × 10⁵ cells per well in 96-well plates) cultures by ³⁵SO₄ incorporation using a TopCount NXT Microplate Scintillation & Luminescence counter (Perkin Elmer Life and Analytical Sciences, Downers Grove, IL). Values for GAG synthesis, calcium levels, and lipid accumulation were normalized to DNA content per well.

Gene expression profiling (microarray analysis)

Total cellular RNA from 5 × 10⁵ cells of 3 highly proliferative/bipotential clones and 3 less proliferative clones of BMSCs, DPSCs, and PDLSCs at passage 6 was isolated using phenol–chloroform (TRIzol; Invitrogen, Carlsbad, CA) extraction and purified using column chromatography (RNeasy^® MinElute Cleanup Kit; Qiagen, Doncaster, Victoria, Australia) according to the manufacturer's instructions. Microarray analysis was performed on a commercial Illumina WG-6 platform, containing bead chips targeting 48,000 human transcripts. Samples of 1 pg of total RNA at a concentration of 100 ng/μL were provided for labeling, hybridization, scanning, and analysis that were performed by Dr. Stephen Wilcox, at the Australian Genome Research Facility (AGRF), VIC, Australia. The results obtained were normalized by quantile normalization method using lumi package in R statistical software and were subsequently imported into GeneSpring GX for further statistical analysis.

Real-time PCR analysis

Total RNA isolated from subpopulations submitted for microarray analysis (5 × 10⁵ cells of 3 high proliferative/multipotential clones and 3 low proliferative clones of BMSCs, DPSCs, and PDLSCs at passage 6) was used as a template for cDNA synthesis and the expression of 24 transcripts (primer sets outlined in Table 1)was assessed by polymerase chain reaction (PCR) amplification as previously described [22]. In order to identify the differences present in cells of varying differentiation and proliferation potential, comparative genomic analysis was performed on 3 biological replicates of cell clones exhibiting low proliferation potential and high proliferation/differentiation potentials, for each tissue type.

Table 1.

Primers Designed to Selected Genes Identified by Gene Expression Profiling and Used in Confirmation of Microarray Results by RT-PCR

Gene	Gene accession number	Forward 5′–3′	Reverse 5′–3′
ASPM	NM_018136	CAGACTACGTCGTGCAGCAT	ACCAATTCGAAGCCACAAAG
AURKB	NM_004217	GGGAGAGCTGAAGATTGCTG	GGCGATAGGTCTCGTTGTGT
CCNB2	NM_004701	TTGCAGTCCATAAACCCACA	ACTTGGAAGCCAAGAGCAGA
CDC2	NM_001786	CTTTTCCATGGGGATTCAGA	CCATTTTGCCAGAAATTCGT
CDC20	NM_001255	CCTCTGGTCTCCCCATTACA	CAACTCAAAACAGCGCCATA
CENPF	NM_016343	GTCAGCGACAAAATGCAGAA	TGCATATTCTTGGCTTGCTG
CEP55	NM_018131	CAGTTGTCTGCTGCAACCTC	GAGCAGCTGTTTCCGTTTTC
CHEK1	NM_001274	CAGGGGTGGTTTATCTGCAT	TCCACAGGACCAAACATCAA
CIT	NM_007174	AAGTCTCAGCCCAGCACCTA	CCAGGGATCTGATCTTGGAA
CKS2	NM_001827	CACTACGAGTACCGGCATGTT	ATGTGGTTCTGGCTCATGAAT
DLG7	NM_014750	GTCTCACTACTGAATGCCACCTT	GTCTGGCATGTTCTTGATGTCT
E2F2	NM_004091	AGGCCAAGAACAACATCCAGT	CACATAGGCCAGCCTCTTGTT
GINS2	NM_016095	AGACAGAAATGTCGCCTGCT	AGCAGACACTCGGAGTTTGG
LDB2	NM_001290	AAGGCAACCAACAACCAAAC	TTGGCTCTCCTACCACCATC
MAD2L1	NM_002358	CTTCTCATTCGGCATCAACA	TCCAGGACCTCACCACTTTC
NCAPG	NM_022346	TACCGCACGATGGATGATAA	CACTGCATTGCTGTTTGCTT
PBK	NM_018492	CAGCCAAGATCCTTTTCCAG	TGCCAATGTAACAAGCCTCA
POLQ	NM_199420	GGCACAGATGGAGGAGAGAG	CTGCAATGCTCCTGAAAACA
PTTG1	NM_004219	GGGTCTGGACCTTCAATCAA	GGCAGGAACAGAGCTTTTTG
RPA3	NM_002847	AAGCCTGTCTGCTTCGTAGG	TTGGCGGTTACTCTTCCAAC
RRM2	NM_001034	ACAGAAGCCCGCTGTTTCTA	CCCAGTCTGCCTTCTTCTTG
TOP2A	NM_001067	AATCTCAGAGCTTCCCGTCA	TGCCTCTGCCAGTTTTTCTT
TWIST-1	NM_000474	TCTTACGAGGAGCTGCAGACGCA	ATCTTGGAGTCCAGCTCGTCGCT
UBE2C	NM_007019	CTCGCTAGAGTTCCCCAGTG	AAAAGCTGTGGGGTTTTTCC

Results

Differential growth potential of BMSC, DPSC, and PDLSC clones in vitro

To determine the proportion of high growth/multipotential clones within each of the cell populations, individual plastic-adherent, MSC-like colonies derived from human bone marrow, dental pulp, and periodontal ligament were isolated using cloning rings as previously described [6,11]. A total of 260 colonies obtained from 9 BM donors were expanded in continuous culture until cellular senescence was achieved. A small proportion of clones (31/260; 12%) exhibited high growth potential that exceeded 20 population doublings (mean generation time of 0.48 PD per day ± 0.05 SD). However, the majority of clones (179/260; 69%) exhibited a limited to moderate proliferation potential and were unable to expand beyond 20 population doublings with a mean generation time of 0.29 PD per day ± 0.03 SD (Fig. 1).

FIG. 1.

Differential growth potential of mesenchymal stem/stromal cell (MSC)-like clonal populations. Individual clonal cell populations of adult bone marrow stem cell (BMSC), dental pulp stem cell (DPSC), and periodontal ligament stem cell (PDLSC) exhibit varying growth potentials as determined by the total number of population doublings for each clone. The BMSC population contained a smaller proportion of long-lived clones in comparison with DPSC and PDLSC populations.

Similar studies were performed for clonogenic DPSC and PDLSC, previously reported to have higher proliferative potentials and life spans compared with their bone marrow counterparts [8,10]. A total of 24 clones obtained from 4 dental pulp donors were serially passaged until they had reached cellular senescence as described earlier. The majority of clones (16/24; 67%) exhibited high growth potential, ranging from 25 to 45 population doublings (mean generation time 1.07 PD per day ± 0.25 SD). However, the remainder of the colonies (8/24; 33%) were found to possess a low growth potential with a mean generation time of 0.29 PD per day ± 0.01 standard deviation (SD) (Fig. 1). Similarly, a total of 31 clones obtained from 3 periodontal ligament donors were expanded in culture to the point of senescence. Approximately 58% (18/31) of the clones exhibited high levels of growth ranging from 21 to 37 population doublings (mean generation time 0.69 PD per day ± 0.13 SD), while the remaining clones demonstrated low growth potential (13/31; 42%) with a mean generation time of 0.30 PD per day ± 0.01 SD (Fig. 1).

Differential potential of long-lived BMSC, DPSC, and PDLSC clones in vitro

BMSC, DPSC, and PDLSC clones that exhibited high levels of growth were subsequently assessed for their potential to differentiate into cells of osteogenic, adipogenic, and chondrogenic lineages. After 4 weeks of osteoinduction, all of the BMSC clones assessed (31/31, 100%) produced Alizarin Red staining mineralized nodules [6, 18]. Furthermore, 90% of the clones (28/31) also exhibited adipogenic differentiation potential, indicated by the formation of Oil Red O-positive lipid clusters (Fig. 2).

FIG. 2.

Developmental potential of long-lived mesenchymal stem/stromal cell (MSC)-like populations. Individual clonal cell populations of long-lived adult bone marrow stem cell (BMSC), dental pulp stem cell (DPSC), and periodontal ligament stem cell (PDLSC) exhibit varying levels of mineralization, adipogenic, and chondrogenic differentiation potential. (i) Alizarin Red (scale bar = 200 μm) and (ii) Oil Red O (scale bar = 50 μm) staining of clonal (A) BMSC, (B) DPSC, and (C) PDLSC populations cultured under inductive osteogenic and adipogenic conditions, identified the presence of mineral nodules and lipid globules, respectively. Chondrogenic differentiation potential was assessed by immunohistochemical staining of chondrocyte pellets with anti-collagen type II antibody (iii) (scale bar = 500 μm), and (iv) (scale bar = 50 μm). (v) Hematoxylin and eosin (H&E) staining was performed to assess cellular morphology (scale bar = 50 μm). (A) Majority (28 out of 31) of BMSC clones tested showed the potential to form mineral and lipid, whereas a smaller proportion (B) (8 out of 17) of DPSC clones and (C) (5 out of 16) of PDLSC clones exhibited bipotentiality. All of the selected BMSC, DPSC, and PDLSC clones showed the capacity to differentiate into cells of chondrogenic lineage.

In parallel studies, 16 high proliferative DPSC clones exhibited the capacity to form Alizarin Red-positive mineralized nodules, while 31% (5/16) also displayed the ability to form Oil Red O-positive lipid-laden globules (Fig. 2). All of the PDLSC clones (18/18; 100%) demonstrated potential to form mineralized deposits, while 37% (7/18) of these clonal lines also formed adipocytes (Fig. 2).

Upon identification of their differentiation potential into cells of osteogenic and adipogenic lineages, 3 bipotential clones were selected from each of the 3 tissue types and assessed for their chondrogenic differentiation potential. The selected cell clones showed capacity to differentiate into cells of the chondrogenic lineage, indicated by immunohis-tochemical staining of cell pellets with anti-collagen type II antibody (Fig. 2). Quantitative analyses demonstrated similar multipotentials between different MSC clones for each tissue type (Supplementary Fig. 1; Supplementary materials are available online at http://www.liebertpub.com/). These clones were designated as high growth and multidifferentiation potential.

Genomic profiling of BMSC, DPSC, and PDLSC clonal lines exhibiting differential growth and developmental potentials

To identify genes involved in MSC maintenance, growth, and development, we used large-scale gene expression profiling of different clonal lines of varying differentiation and proliferation potentials. Comparative genomic analysis was performed using a commercial Illumina WG-6 platform on 3 biological replicates of clonal cell lines exhibiting low growth potential compared with 3 clones exhibiting high growth/multidifferentiation potentials, for BMSC, DPSC, and PDLSC populations (Fig. 3). The microarray analyses were based on 3 biological replicate clones for each tissue that displayed similar differentiation potentials as shown in Figure 3.

FIG. 3.

Hierarchical sample clustering of BMSC, dental pulp stem cell (DPSC), and periodontal ligament stem cell (PDLSC) clones. Representative dendrograms illustrate patterns of gene expression levels, of significant differentially expressed genes within the samples analyzed for (A) BMSC, (B) DPSC, and (C) PDLSC populations. Clones 1 to 3 represent clones of low growth potential (<20 population doublings), while clones 4 to 6 represent clones of high growth potential (>20 population doublings). Lumi package in R statistical software and GeneSpring GX were used for statistical analysis and a P value of 0.05 was used as a cutoff point to identify statistically significant differentially expressed genes with greater than 2-fold difference.

Lumi package in R statistical software and GeneSpring GX software were used for statistical analysis, where a cutoff point with a P value of 0.05 was used to identify statistically significant differentially expressed genes with greater than 2-fold differences in expression. These bioinformatic analyses identified 968, 603, and 842 differentially expressed genes between low growing clones and high growth/multidifferentiation potential clones for BMSC, DPSC, and PDLSC, respectively (Fig. 3).

Identification of common gene sets expressed by long-lived, multipotent BMSC, DPSC, and PDLSC clonal lines

Further cross-comparison analyses were performed to identify differentially expressed genes that were commonly expressed amongst long-lived, multipotent cell populations derived from the 3 different stromal tissues. Interrogation of the data resulted in the identification of 24 common differentially up-regulated genes that could be grouped into categories based on their involvement in different cellular processes, including cell cycle, mitosis, and cell division, as well as DNA repair and replication and cellular differentiation (Table 2).Within this gene data set, the transcription factors, E2F2, PTTG1, TWIST-1, and transcriptional cofactor, LDB2, were found to be commonly up-regulated in long-lived, multipotent cells derived from all 3 tissues. Confirmatory studies using real-time PCR analysis were performed to validate the microarray findings for those genes involved in transcriptional regulation (Fig. 4). However, comparative studies found that the expression of LDB2, PTTG1, and TWIST-1 was higher in multipotential BMSC, DPSC, and PDLSC, while E2F2 was lower in comparison with highly proliferating human foreskin fibroblasts (Supplementary Fig. 2). RT-PCR analysis was also performed to verify the differential gene expression patterns observed for the other 20 highly expressed stem cell-associated genes (Supplementary Fig. 3).

FIG. 4.

Confirmation of microarray data for genes associated with transcription by RT-PCR. Representative graphs of real-time PCR analysis of expression levels of regulators of transcription, E2F2, LDB2, PTTG1, and TWIST-1, confirm up-regulation of these genes in high growth/multidifferentiation potential clones (solid histograms) in comparison with low growth potential clones (open histograms), as primarily identified in microarray analysis. The data represent the mean values ± standard deviations of triplicate experiments normalized to the housekeeping gene, β-actin. Statistical significance of (∆) P < 0.001 and (*) P < 0.0001 was determined using the unpaired Student's t-test.

Table 2.

A List of Genes Up-Regulated in Cell Clones of High Potential, Common to BMSC, DPSC, and PDLSC Populations

Gene	Gene name	BMSCs	DPSCs	PDLSCs
Genes involved in cell cycle, mitosis, cell division
ASPM	asp (abnormal spindle) homolog	18.08	6.049	5.834
AURKB	Aurora kinase B	9.895	5.145	6.953
CCNB2	Cyclin B2	34.09	7.838	6.39
CDC2	Cell division cycle 2, G1 to S and G2 to M	11.61	5.883	2.537
CDC20	Cell division cycle 20 homolog (Saccharomyces cerevisiae)	44.6	13.65	7.844
CENPF	Centromere protein F, 350/400 kDa (mitosin)	17.5	6.135	6.539
CEP55	Centrosomal protein 55 kDa	17.48	7.228	5.436
CIT	Citron (rho-interacting, serine/threonine kinase 21)	6.154	2.512	2.728
CKS2	CDC28 protein kinase regulatory subunit 2	12.78	4.736	4.311
DLG7	Discs, large (Drosophila) homolog-associated protein 5	22.57	7.546	6.32
MAD2L1	MAD2 mitotic arrest deficient-like 1 (yeast)	7.696	4.89	5.263
NCAPG	Non-SMC condensin I complex, subunit G	15.86	6.747	7.558
PBK	PDZ-binding kinase	37.95	10.62	12.09
PTTG1	Pituitary tumor-transforming 1	18.06	6.098	5.537
UBE2C	Ubiquitin-conjugating enzyme E2C	27.73	7.399	7.936
Genes involved in DNA repair and replication
CHEK1	CHK1 checkpoint homolog (Schizosaccharomyces pombe)	4.744	3.09	3.187
E2F2	E2F transcription factor 2	5.999	5.594	6.07
GINS2	GINS complex subunit 2 (Psf2 homolog)	14.44	5.737	6.466
POLQ	Polymerase (DNA-directed), theta	7.984	3.397	5.398
PTTG1	Pituitary tumor-transforming 1	18.06	6.098	5.537
RPA3	Replication protein A3, 14 kDa	2.335	2.173	2.036
RRM2	Ribonucleotide reductase M2 polypeptide	7.035	5.318	7.749
TOP2A	Topoisomerase (DNA) IIa 170 kDa	44.64	10.38	10.32
Genes involved in regulation of transcription
CENPF	Centromere protein F, 350/400 kDa (mitosin)	17.5	6.135	6.539
E2F2	E2F transcription factor 2	5.999	5.594	6.07
LDB2	LIM domain-binding 2	3.313	3.066	4.981
PTTG1	Pituitary tumor-transforming 1	18.06	6.098	5.537
TWIST-1	Twist homolog 1 (Drosophila)	2.064	3.151	2.297
Genes involved in cell proliferation and differentiation
CENPF	Centromere protein F, 350/400 kDa (mitosin)	17.5	6.135	6.539
CHEK1	CHK1 checkpoint homolog (S. pombe)	4.744	3.09	3.187
CIT	Citron (rho-interacting, serine/threonine kinase 21)	6.154	2.512	2.728
CKS2	CDC28 protein kinase regulatory subunit 2	12.78	4.736	4.311
TWIST-1	Twist homolog 1 (Drosophila)	2.064	3.151	2.297

BMSC, adult bone marrow stem cell; DPSC, dental pulp stem cell; PDLSC, periodontal ligament stem cell.

Discussion

In the present study we analyzed the genetic profiles of clonally expanded colony-forming unit-fibroblast (CFU-F) populations derived from 3 different human stromal tissues including bone marrow, dental pulp, and periodontal ligament. Our preliminary experiments focused on characterizing the differentiation and proliferation potentials of the clonally expanded cell lines isolated from each of the 3 tissue types. Proliferation studies clearly showed heterogeneity in the proliferation potentials of clonal MSC-like cells residing within bone marrow, dental pulp, and periodontal ligament tissues in accord with previous findings [5,6,8,10]. Our data suggests that only a small fraction of BMSC exhibits high proliferative potential and can undergo >20 population doublings. In contrast, approximately two-third of the DPSCs and PDLSCs exhibited an extensive proliferation capacity and an ability to exceed 20 population doublings. Essentially all the BMSC clonal lines that showed evidence of high growth potential exhibited a capacity to differentiate into cells of osteogenic, chondrogenic, and adipogenic lineages. This frequency of multipotential BMSC clones was higher than that observed for DPSCs and PDLSCs, where only 50% of the highly proliferative DPSC and PDLSC clones also exhibited multipotential differentiation potential. Data obtained from functional analysis performed on clonal populations isolated from the bone marrow, dental pulp, and periodontal ligament confirm the general hypothesis that ex vivo-expanded CFU-F from different tissues contain a heterogeneous mix of cells with varying differentiation and proliferation potentials and support previous assumptions of the hierarchical nature of stromal populations from different tissues [23]. These investigations provide a model system for identifying a common molecular fingerprint associated with immature mesenchymal stem-like cells from different organs.

Assessment of gene expression profiles comparing cells of low and high growth capacity and varied differentiation potential within the BMSC, DPSC, and PDLSC populations resulted in the identification of differentially expressed gene sets for each of the tissue types. Bioinformatic interrogation of the microarray data sets identified several hundred differentially expressed genes associated with high growth/multidifferentiation potential clonal populations. Further cross-comparative analyses of the differential gene expression patterns across all 3 stromal tissues identified 24 differentially expressed genes common to high growth/multidifferentiation potential BMSC, DPSC, and PDLSC, which were confirmed by real-time PCR. As anticipated, a large proportion of these genes have been reported to be involved in cell cycle, cell division, and mitosis, as well as in other cellular processes including DNA repair and replication and cellular differentiation. Interestingly, a small subset of the common MSC-like genes was found to be well-characterized transcription factors (E2F2, PTTG1, and TWIST-1) and a transcriptional cofactor (LDB2). As E2F family members play a major role in regulating cellular proliferation, we expected and confirmed high expression of E2F2 in high proliferative human foreskin fibroblasts that lack the capacity to differentiate into bone, fat, and cartilage. In contrast, PTTG1, TWIST-1, and LDB2 were more highly expressed by MSC-like cells in comparison with human foreskin fibroblasts. Although the role played by these transcriptional regulators in the maintenance of high growth/multidifferentiation potential MSC remains to be determined, recent studies suggest that E2F2, PTTG1, and TWIST-1 may play critical roles in BMSC growth and development.

Previous studies have shown that the transcription factors of the E2F family regulate cellular proliferation by controlling the transcription of numerous genes involved in DNA replication, DNA repair, mitosis, and cell cycle progression [24 –29]. Interestingly, studies from Won and colleagues [30] suggest that E2F1, E2F2, and E2F3 activate hTERT in normal somatic cells suggesting that activation of E2F2 in high proliferative MSC clones may maintain expression levels of hTERT and, hence telomerase activity, previously shown to greatly prolong the lifespan of culture-expanded BMSC [31 –33].

Pituitary tumor-transforming gene 1(PTTG1) was originally isolated from rat pituitary cells [34] and was termed Securin upon its latter discovery in human [35]. This transcription factor is involved in many cellular processes including mitosis, cell cycle progression, DNA repair, and maintenance of chromosome stability [35 –38]. Due to its role in chromosomal aggregation, the up-regulation of PTTG1 leads to chromosomal misaggregation and hence genomic imbalance. These events account for the oncogenic potential of up-regulated PTTG1 expression and has been associated with a variety of endocrine-related tumors and non-endocrine-related cancers [39 –46]. While the role of PTTG1 does not appear to be critical for normal fetal development, mouse embryonic fibroblasts that lack PTTG1 expression grow abnormally in culture, even though PTTG1 null mice are essentially normal [47]. However, a role for this gene in postnatal BMSC maintenance and proliferation has recently been proposed in studies describing PTTG1 deletion reduces BMSC proliferation in vitro, associated with an increased sensitivity to hypoxia and cellular senescence [48].

TWIST-1 is a basic helix-loop-helix (bHLH)-containing transcription factor [49 –52] found to be crucial for correct patterning of the skeleton [50,52 –54], where it is down-regulated during endochondral and intramembranous fetal bone development [55]. The expression of TWIST-1 appears greatest at sites of immature bone cells and decreases in more mature bone cell populations during calvaria and suture development [56,57]. The importance of TWIST-1 in bone development is highlighted in both mice and human where TWIST-1 heterozygosity leads to premature osteoblast differentiation and cranial suture fusion in the skull. These abnormalities result in craniosynostosis (Saethre-Chotzen syndrome), a condition that is often associated with dysmorphic facial findings and various limb abnormalities [58 –60]. Studies using double murine heterozygotes containing TWIST-1/Runx2 or DERMO-1/Runx2 deletions showed that both TWIST-1 and DERMO-1 (TWIST-2) negatively regulate Runx2-induced bone formation during murine development [58]. Previous studies have reported that TWIST-1 expression can be identified in different murine osteoblastic cell lines, and that this bHLH gene is down-regulated during osteogenic differentiation in vitro [55,58,61 –63]. Furthermore, work by Glackin and colleagues has shown a reduced capacity of osteosarcoma cell lines to undergo osteoblastic maturation as a result of enforced expression of either TWIST-1 or DERMO-1, whereas an increase in bone cell maturation was observed due to overexpression of TWIST-1 or DERMO-1 antisense, in these cell lines [50,52]. Recent work in our laboratory has identified a potential role for both TWIST-1 and DERMO-1 in BMSC proliferation potential and adipogenic commitment while inhibiting osteogenic/chondrogenic development [21]. Collectively, these findings implicate E2F2, PTTG1, and TWIST-1 as potential key molecules that mediate maintenance, growth, and development of mesenchymal stem-like cells derived from different anatomical sites.

A comprehensive knowledge of the genes that regulate stem cell self-renewal and differentiation potential will assist in the development of stem cell-based cell therapies. In this study, we have isolated clonal populations of BMSCs, DPSCs, and PDLSCs with high growth/multidifferentiation potential that exhibited unique genomic profiles. Among these gene data sets was a cohort of genes associated with stem cell-like characteristics. Ongoing investigations seek to examine the significance of this gene set as a signature of early mesenchymal stem cell populations derived from different tissues. This work lays the foundation for identifying novel mesenchymal stem cell markers and/or key regulators of self-renewal, growth, and commitment.

Footnotes

Acknowledgments

We would like to acknowledge the technical assistance of Mr. Krzysztof Mrozik and Dr. Naohisa Wada and bioinformatics support of Mr. Yoganand Sundaravadanam and Mr. Mark Van Der Hoek. This study was funded by National Health and Medical Research Council project grants (ID#453497 and ID#453599), Australian Dental Research Foundation Grant (62/2008), DAWES, and Betty Fanning Postgraduate Scholarships.

Author Disclosure Statement

No competing financial interests exist.

References

Friedenstein

, Gorskaja

, Kulagina

. 1976. Fibroblast precursors in normal and irradiated mouse hematopoietic organs. Exp Hematol, 4:267–274.

Friedenstein

, Piatetzky-Shapiro

, Petrakova

. 1966. Osteogenesis in transplants of bone marrow cells. J Embryol Exp Morphol, 16:381–390.

Castro-Malaspina

, Gay

, Resnick

, Kapoor

, Meyers

, Chiarieri

, McKenzie

, Broxmeyer

, Moore

. 1980. Characterization of human bone marrow fibroblast colony-forming cells (CFU-F) and their progeny. Blood, 56:289–301.

Haynesworth

, Goshima

, Goldberg

, Caplan

. 1992. Characterization of cells with osteogenic potential from human marrow. Bone, 13:81–88.

Kuznetsov

, Krebsbach

, Satomura

, Kerr

, Riminucci

, Benayahu

, Robey

. 1997. Single-colony derived strains of human marrow stromal fibroblasts form bone after transplantation in vivo. J Bone Miner Res, 12:1335–1347.

Gronthos

, Zannettino

, Hay

, Shi

, Graves

, Kortesidis

, Simmons

. 2003. Molecular and cellular characterisation of highly purified stromal stem cells derived from human bone marrow. J Cell Sci, 116,Pt 9:1827–1835.

Gronthos

, Mankani

, Brahim

, Robey

, Shi

. 2000. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci USA, 97:13625–13630.

Seo

, Miura

, Gronthos

, Bartold

, Batouli

, Brahim

, Young

, Robey

, Wang

, Shi

. 2004. Investigation of multipotent postnatal stem cells from human periodontal ligament. Lancet, 364:149–155.

Miura

, Gronthos

, Zhao

, Lu

, Fisher

, Robey

, Shi

. 2003. SHED: stem cells from human exfoliated deciduous teeth. Proc Natl Acad Sci USA, 100:5807–5812.

10.

Shi

, Robey

, Gronthos

. 2001. Comparison of human dental pulp and bone marrow stromal stem cells by cDNA microarray analysis. Bone, 29:532–539.

11.

Gronthos

, Brahim

, Li

, Fisher

, Cherman

, Boyde

, DenBesten

, Robey

, Shi

. 2002. Stem cell properties of human dental pulp stem cells. J Dent Res, 81:531–535.

12.

Lander

, Linton

, Birren

, Nusbaum

, Zody

, Baldwin

, Devon

, Dewar

, Doyle

, FitzHugh

, Funke

, Gage

, Harris

, Heaford

, Howland

, Kann

, Lehoczky

, LeVine

, McEwan

, McKernan

, Meldrim

, Mesirov

, Miranda

, Morris

, Naylor

, Raymond

, Rosetti

, Santos

, Sheridan

, Sougnez

, Stange-Thomann

, Stojanovic

, Subramanian

, Wyman

, Rogers

, Sulston

, Ainscough

, Beck

, Bentley

, Burton

, Clee

, Carter

, Coulson

, Deadman

, Deloukas

, Dunham

, Durbin

, French

, Grafham

, Gregory

, Hubbard

, Humphray

, Hunt

, Jones

, Lloyd

, McMurray

, Matthews

, Mercer

, Milne

, Mullikin

, Mungall

, Plumb

, Ross

, Shownkeen

, Sims

, Waterston

, Wilson

, Hillier

, McPherson

, Marra

, Mardis

, Fulton

, Chinwalla

, Pepin

, Gish

, Chissoe

, Wendl

, Delehaunty

, Miner

, Delehaunty

, Kramer

, Cook

, Fulton

, Johnson

, Minx

, Clifton

, Hawkins

, Branscomb

, Predki

, Richardson

, Wenning

, Slezak

, Doggett

, Cheng

, Olsen

, Lucas

, Elkin

, Uberbacher

, Frazier

, Gibbs

, Muzny

, Scherer

, Bouck

, Sodergren

, Worley

, Rives

, Gorrell

, Metzker

, Naylor

, Kucherlapati

, Nelson

, Weinstock

, Sakaki

, Fujiyama

, Hattori

, Yada

, Toyoda

, Itoh

, Kawagoe

, Watanabe

, Totoki

, Taylor

, Weissenbach

, Heilig

, Saurin

, Artiguenave

, Brottier

, Bruls

, Pelletier

, Robert

, Wincker

, Smith

, Doucette-Stamm

, Rubenfield

, Weinstock

, Lee

, Dubois

, Rosenthal

, Platzer

, Nyakatura

, Taudien

, Rump

, Yang

, Yu

, Wang

, Huang

, Gu

, Hood

, Rowen

, Madan

, Qin

, Davis

, Federspiel

, Abola

, Proctor

, Myers

, Schmutz

, Dickson

, Grimwood

, Cox

, Olson

, Kaul

, Raymond

, Shimizu

, Kawasaki

, Minoshima

, Evans

, Athanasiou

, Schultz

, Roe

, Chen

, Pan

, Ramser

, Lehrach

, Reinhardt

, McCombie

, de la Bastide

, Dedhia

, Blöcker

, Hornischer

, Nordsiek

, Agarwala

, Aravind

, Bailey

, Bateman

, Batzoglou

, Birney

, Bork

, Brown

, Burge

, Cerutti

, Chen

, Church

, Clamp

, Copley

, Doerks

, Eddy

, Eichler

, Furey

, Galagan

, Gilbert

, Harmon

, Hayashizaki

, Haussler

, Hermjakob

, Hokamp

, Jang

, Johnson

, Jones

, Kasif

, Kaspryzk

, Kennedy

, Kent

, Kitts

, Koonin

, Korf

, Kulp

, Lancet

, Lowe

, McLysaght

, Mikkelsen

, Moran

, Mulder

, Pollara

, Ponting

, Schuler

, Schultz

, Slater

, Smit

, Stupka

, Szustakowski

, Thierry-Mieg

, Wagner

, Wallis

, Wheeler

, Williams

, Wolf

, Wolfe

, Yang

, Yeh

, Collins

, Guyer

, Peterson

, Felsenfeld

, Wetterstrand

, Patrinos

, Morgan

, de Jong

, Catanese

, Osoegawa

, Shizuya

, Choi

, Chen

, Szustakowki

. International Human Genome Sequencing Consortium. 2001. Initial sequencing and analysis of the human genome. Nature, 409:860–921.

13.

Venter

, Adams

, Myers

, Li

, Mural

, Sutton

, Smith

, Yandell

, Evans

, Holt

, Gocayne

, Amanatides

, Ballew

, Huson

, Wortman

, Zhang

, Kodira

, Zheng

, Chen

, Skupski

, Subramanian

, Thomas

, Zhang

, Gabor Miklos

, Nelson

, Broder

, Clark

, Nadeau

, McKusick

, Zinder

, Levine

, Roberts

, Simon

, Slayman

, Hunkapiller

, Bolanos

, Delcher

, Dew

, Fasulo

, Flanigan

, Florea

, Halpern

, Hannenhalli

, Kravitz

, Levy

, Mobarry

, Reinert

, Remington

, Abu-Threideh

, Beasley

, Biddick

, Bonazzi

, Brandon

, Cargill

, Chandramouliswaran

, Charlab

, Chaturvedi

, Deng

, Di Francesco

, Dunn

, Eilbeck

, Evangelista

, Gabrielian

, Gan

, Ge

, Gong

, Gu

, Guan

, Heiman

, Higgins

, Ji

, Ke

, Ketchum

, Lai

, Lei

, Li

, Liang

, Lin

, Lu

, Merkulov

, Milshina

, Moore

, Naik

, Narayan

, Neelam

, Nusskern

, Rusch

, Salzberg

, Shao

, Shue

, Sun

, Wang

, Wei

, Wides

, Xiao

, Yan

, Yao

, Ye

, Zhan

, Zhang

, Zhao

, Zheng

, Zhong

, Zhu

, Zhao

, Gilbert

, Baumhueter

, Spier

, Carter

, Cravchik

, Woodage

, Ali

, An

, Awe

, Baldwin

, Baden

, Barnstead

, Barrow

, Beeson

, Busam

, Carver

, Center

, Cheng

, Curry

, Danaher

, Davenport

, Desilets

, Dietz

, Dodson

, Doup

, Ferriera

, Garg

, Gluecksmann

, Hart

, Haynes

, Heiner

, Hladun

, Hostin

, Houck

, Howland

, Ibegwam

, Johnson

, Kalush

, Kline

, Koduru

, Love

, Mann

, May

, McCawley

, McIntosh

, McMullen

, Moy

, Murphy

, Nelson

, Pfannkoch

, Pratts

, Puri

, Qureshi

, Reardon

, Rodriguez

, Rogers

, Romblad

, Ruhfel

, Scott

, Sitter

, Smallwood

, Stewart

, Strong

, Suh

, Thomas

, Tint

, Tse

, Vech

, Wang

, Wetter

, Williams

, Windsor

, Winn-Deen

, Wolfe

, Zaveri

, Abril

, Guigó

, Campbell

, Sjolander

, Karlak

, Kejariwal

, Mi

, Lazareva

, Hatton

, Narechania

, Diemer

, Muruganujan

, Guo

, Sato

, Bafna

, Istrail

, Lippert

, Schwartz

, Walenz

, Yooseph

, Allen

, Basu

, Baxendale

, Blick

, Caminha

, Carnes-Stine

, Caulk

, Chiang

, Coyne

, Dahlke

, Mays

, Dombroski

, Donnelly

, Ely

, Esparham

, Fosler

, Gire

, Glanowski

, Glasser

, Glodek

, Gorokhov

, Graham

, Gropman

, Harris

, Heil

, Henderson

, Hoover

, Jennings

, Jordan

, Kasha

, Kagan

, Kraft

, Levitsky

, Lewis

, Liu

, Lopez

, Ma

, Majoros

, McDaniel

, Murphy

, Newman

, Nguyen

, Nodell

, Pan

, Peck

, Peterson

, Rowe

, Sanders

, Scott

, Simpson

, Smith

, Sprague

, Stock well

, Turner

, Venter

, Wang

, Wen

, Wu

, Xia

, Zandieh

, Zhu

. 2001. The sequence of the human genome. Science, 291:1304–1351.

14.

W right

, Simon

. 2003. A random variance model for detection of differential gene expression in small microarray experiments. Bioinformatics, 19:2448–2455.

15.

Shi

, Gronthos

. 2003. Perivascular niche of postnatal mesenchymal stem cells in human bone marrow and dental pulp. J Bone Miner Res, 18:696–704.

16.

Arthur

, Rychkov

, Shi

, Koblar

, Gronthos

. 2008. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells, 26:1787–1795.

17.

Simmons

, Torok-Storb

. 1991. Identification of stromal cell precursors in human bone marrow by a novel monoclonal antibody, STRO-1. Blood, 78:55–62.

18.

Gronthos

, Graves

, Ohta

, Simmons

. 1994. The STRO-1+ fraction of adult human bone marrow contains the osteogenic precursors. Blood, 84:4164–4173.

19.

Gimble

. 1998. Marrow stromal adipocytes. Marrow Stromal Cell Culture. Beresford

, Owen

. Cambridge University Press: Cambridge, UK, 67–87.

20.

Pittenger

, Mackay

, Beck

, Jaiswal

, Douglas

, Mosca

, Moorman

, Simonetti

, Craig

, Marshak

. 1999. Multilineage potential of adult human mesenchymal stem cells. Science, 284:143–147.

21.

Isenmann

, Arthur

, Zannettino

, Turner

, Shi

, Glackin

, Gronthos

. 2009. TWIST family of basic helix-loop-helix transcription factors mediate human mesenchymal stem cell growth and commitment. Stem Cells, 27:2457–2468.

22.

Wada

, Menicanin

, Shi

, Bartold

, Gronthos

. 2009. Immunomodulatory properties of human periodontal ligament stem cells. J Cell Physiol, 219:667–676.

23.

Owen

, Friedenstein

. 1988. Stromal stem cells: marrow-derived osteogenic precursors. Ciba F ound Symp, 136:42–60.

24.

Akavia

, Veinblat

, Benayahu

. 2008. Comparing the transcriptional profile of mesenchymal cells to cardiac and skeletal muscle cells. J Cell Physiol, 216:663–672.

25.

Cam

, Dynlacht

. 2003. Emerging roles for E2F: beyond the G1/S transition and DNA replication. Cancer Cell, 3:311–316.

26.

DeGregori

. 2002. The genetics of the E2F family of transcription factors: shared functions and unique roles. Biochim Biophys Acta, 1602:131–150.

27.

Stevaux

, Dyson

. 2002. A revised picture of the E2F transcriptional network and RB function. Curr Opin Cell Biol, 14:684–691.

28.

Timmers

, Sharma

, Opavsky

, Maiti

, Wu

, Orringer

, Trikha

, Saavedra

, Leone

. 2007. E2f1, E2f2, and E2f3 control E2F target expression and cellular proliferation via a p53-dependent negative feedback loop. Mol Cell Biol, 27:65–78.

29.

Trimarchi

, Lees

. 2002. Sibling rivalry in the E2F family. Nat Rev Mol Cell Biol, 3:11–20.

30.

Won

, Yim

, Kim

. 2002. Opposing regulatory roles of E2F in human telomerase reverse transcriptase (hTERT) gene expression in human tumor and normal somatic cells. FASEB J, 16:1943–1945.

31.

Shi

, Gronthos

, Chen

, Reddi

, Counter

, Robey

, Wang

. 2002. Bone formation by human postnatal bone marrow stromal stem cells is enhanced by telomerase expression. Nat Biotechnol, 20:587–591.

32.

Gronthos

, Chen

, Wang

, Robey

, Shi

. 2003. Telomerase accelerates osteogenesis of bone marrow stromal stem cells by upregulation of CBFA1, osterix, and osteocalcin. J Bone Miner Res, 18:716–722.

33.

Simonsen

, Rosada

, Serakinci

, Justesen

, Stenderup

, Rattan

, Jensen

, Kassem

. 2002. Telomerase expression extends the proliferative life-span and maintains the osteogenic potential of human bone marrow stromal cells. Nat Biotechnol, 20:592–596.

34.

Pei

, Melmed

. 1997. Isolation and characterization of a pituitary tumor-transforming gene (P TTG) Mol Endocrinol, 11:433–441.

35.

Zou

, McGarry

, Bernal

, Kirschner

. 1999. Identification of a vertebrate sister-chromatid separation inhibitor involved in transformation and tumorigenesis. Science, 285:418–422.

36.

Jallepalli

, Waizenegger

, Bunz

, Langer

, Speicher

, Peters

, Kinzler

, Vogelstein

, Lengauer

. 2001. Securin is required for chromosomal stability in human cells. Cell, 105:445–457.

37.

Ramos-Morales

, Dominguez

, Romero

, Luna

, Multon

, Pintor-Toro

, Tortolero

. 2000. Cell cycle regulated expression and phosphorylation of hpttg proto-oncogene product. Oncogene, 19:403–409.

38.

Romero

, Multon

, Ramos-Morales

, Domínguez

, Bernal

, Pintor-Toro

, Tortolero

. 2001. Human securin, hPTTG, is associated with Ku heterodimer, the regulatory subunit of the DNA-dependent protein kinase. Nucleic Acids Res, 29:1300–1307.

39.

Chamaon

, Kirches

, Kanakis

, Braeuninger

, Dietzmann

, Mawrin

. 2005. Regulation of the pituitary tumor transforming gene by insulin-like-growth factor-I and insulin differs between malignant and non-neoplastic astrocytes. Biochem Biophys Res Commun, 331:86–92.

40.

Heaney

, Nelson

, Fernando

, Horwitz

. 2001. Transforming events in thyroid tumorigenesis and their association with follicular lesions. J Clin Endocrinol Metab, 86:5025–5032.

41.

Heaney

, Singson

, McCabe

, Nelson

, Nakashima

, Melmed

. 2000. Expression of pituitary-tumour transforming gene in colorectal tumours. Lancet, 355:716–719.

42.

Kakar

, Malik

. 2006. Suppression of lung cancer with siRNA targeting PTTG. Int J Oncol, 29:387–395.

43.

Puri

, Tousson

, Chen

, Kakar

. 2001. Molecular cloning of pituitary tumor transforming gene 1 from ovarian tumors and its expression in tumors. Cancer Lett, 163:131–139.

44.

Solbach

, Roller

, Fellbaum

, Nicoletti

, Kaufmann

. 2004. PTTG mRNA expression in primary breast cancer: a prognostic marker for lymph node invasion and tumor recurrence. Breast, 13:80–81.

45.

Tsai

, Lin

, Cheng

, Chen

, Wing

. 2005. Expression and functional analysis of pituitary tumor transforming gene-1 [corrected] in uterine leiomyomas. J Clin Endocrinol Metab, 90:3715–3723.

46.

Zhang

, Horwitz

, Heaney

, Nakashima

, Prezant

, Bronstein

, Melmed

. 1999. Pituitary tumor transforming gene (PTTG) expression in pituitary adenomas. J Clin Endocrinol Metab, 84:761–767.

47.

Mei

, Huang

, Zhang

. 2001. Securin is not required for cellular viability, but is required for normal growth of mouse embryonic fibroblasts. Curr Biol, 11:1197–1201.

48.

Rubinek

, Chesnokova

, Wolf

, Wawrowsky

, Vlotides

, Melmed

. 2007. Discordant proliferation and differentiation in pituitary tumor-transforming gene-null bone marrow stem cells. Am J Physiol, Cell Physiol, 293:C1082–C1092.

49.

Chen

, Behringer

. 1995. twist is required in head mesenchyme for cranial neural tube morphogenesis. Genes Dev, 9:686–699.

50.

Lee

, Lowe

, Strong

, Wergedal

, Glackin

. 1999. TWIST, a basic helix-loop-helix transcription factor, can regulate the human osteogenic lineage. J Cell Biochem, 75:566–577.

51.

Leptin

. 1991. twist and snail as positive and negative regulators during Drosophila mesoderm development. Genes Dev, 5:1568–1576.

52.

Lee

, Lowe

, Flanagan

, Kuchler

, Glackin

. 2000. Human Dermo-1 has attributes similar to twist in early bone development. Bone, 27:591–602.

53.

Burgess

, Rawls

, Brown

, Bradley

, Olson

. 1996. Requirement of the paraxis gene for somite formation and musculoskeletal patterning. Nature, 384:570–573.

54.

Cserjesi

, Brown

, Ligon

, Lyons

, Copeland

, Gilbert

, Jenkins

, Olson

. 1995. Scleraxis: a basic helix-loop-helix protein that prefigures skeletal formation during mouse embryogenesis. Development, 121:1099–1110.

55.

Alborzi

, Mac

, Glackin

, Murray

, Zernik

. 1996. Endochondral and intramembranous fetal bone development: osteoblastic cell proliferation, and expression of alkaline phosphatase, m-twist, and histone H4. J Craniofac Genet Dev Biol, 16:94–106.

56.

Connerney

, Andreeva

, Leshem

, Muentener

, Mercado

, Spicer

. 2006. Twist1 dimer selection regulates cranial suture patterning and fusion. Dev Dyn, 235:1345–1357.

57.

Rice

, Aberg

, Chan

, Tang

, Kettunen

, Pakarinen

, Maxson

, Thesleff

. 2000. Integration of FGF and TWIST in calvarial bone and suture development. Development, 127:1845–1855.

58.

Bialek

, Kern

, Yang

, Schrock

, Sosic

, Hong

, Wu

, Yu

, Ornitz

, Olson

, Justice

, Karsenty

. 2004. A twist code determines the onset of osteoblast differentiation. Dev Cell, 6:423–435.

59.

Kronenberg

. 2004. Twist genes regulate Runx2 and bone formation. Dev Cell, 6:317–318.

60.

Rice

, Rice

, Thesleff

. 2003. Molecular mechanisms in calvarial bone and suture development, and their relation to craniosynostosis. Eur J Orthod, 25:139–148.

61.

Funato

, Ohtani

, Ohyama

, Kuroda

, Nakamura

. 2001. Common regulation of growth arrest and differentiation of osteoblasts by helix-loop-helix factors. Mol Cell Biol, 21:7416–7428.

62.

Murray

, Glackin

, Winters

, Gazit

, Kahn

, Murray

. 1992. Expression ofhelix-loop-helix regulatory genes during differentiation of mouse osteoblastic cells. J Bone Miner Res, 7:1131–1138.

63.

Tamura

, Noda

. 1999. Identification of DERMO-1 as a member of helix-loop-helix type transcription factors expressed in osteoblastic cells. J Cell Biochem, 72:167–176.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.23 MB