Zfp553 Is Essential for Maintenance and Acquisition of Pluripotency

Abstract

Pluripotent cells are promising tools in the arena of regenerative medicine. For many years, research efforts have been directed toward uncovering the underlying mechanisms that govern the pluripotent state and this involves identifying new pluripotency-associated factors. Zinc finger protein 553 (Zfp553) has been hypothesized to be one such factor because of its predominant expression in inner cell mass of the mouse early embryo. In this study, we have identified Zfp553 as a regulator of pluripotency. Zfp553 knockdown downregulates pluripotency markers and triggers differentiation in mouse embryonic stem cells (mESCs). Further investigation revealed that Zfp553 regulates pluripotency in mESCs through the transcriptional activation of Pou5f1 and Nanog. Microarray results revealed that depletion of Zfp553 downregulates many pluripotency genes, as well as genes associated with metabolism-related processes. ChIP-sequencing (ChIP-seq) depicted the genomic binding sites of Zfp553 in mESCs and its binding motif. In addition, we found that depletion of Zfp553 could impair somatic cell reprogramming, evidenced by reduced reprogramming efficiency and cell viability. Together, our preliminary findings provide novel insights to a newly identified pluripotency factor Zfp553 and its role in pluripotency regulation.

Introduction

The derivative of embryonic stem cells (ESCs) from the inner cell mass (ICM) of mouse blastocysts in 1981, the establishment of human ESCs (hESCs) in 1998, and the subsequent reprogramming of somatic cells to induced pluripotent stem cells (iPSCs) in 2006 are remarkable breakthroughs in biomedical research [1 –4]. Pluripotent stem cells, both ESCs and iPSCs, possess unique characteristics of pluripotency—the ability to develop into all cell lineages, and self-renewal—the capacity to divide infinitely in vitro [5]. They are also highly adaptable to genetic manipulation without losing their pluripotent nature. Because of their ability to capture and retain a pluripotent nature that would only arise transitorily in vivo, they have been used as remarkable tools for in vitro manipulation to uncover the mechanisms that regulate the embryonic cell state and development [6,7]. Furthermore, with the significant discovery of somatic cell reprogramming, pluripotent stem cells are also endowed with prosperous application prospects for cell-based therapies and disease modeling in regenerative medicine.

To gain an explicit understanding of early embryo development and exploit the regenerative potential of pluripotent stem cells for therapeutic medicine, tremendous studies have been conducted to elucidate the genetic and epigenetic mechanisms that regulate pluripotency and self-renewal of pluripotent stem cells [8]. These mechanisms comprise distinct signaling pathways, core transcriptional factors, and epigenetic modulators that regulate the characteristic nature of ESCs [8]. The core transcriptional regulators, Oct4, Nanog, and Sox2, are well known for their essential roles in the maintenance and acquisition of pluripotency. Genome-wide studies have also identified more pluripotency-associated factors. These factors form a complex transcriptional network that regulates the unique pluripotent state in mouse ESCs (mESCs) [9,10]. Hence, many recent studies have been focused on discovery of new pluripotency-associated factors; however, the precise manner in which these transcriptional networks synchronize has not been well characterized, and more studies are needed to fully elucidate the transcriptional regulation mechanisms in mESCs.

Zfp553 belongs to the Krueppel Cysteine2 Histidine2 (C2H2) family of zinc finger proteins. Proteins with such C2H2 zinc finger motifs are characterized by the presence of a beta hairpin at the N-terminus and an alpha helix at the C-terminus [11]. Zfp553 consists of 591 amino acids and contains 12 such zinc finger domains in total. Up to date, many proteins from this family have been identified to be downstream intermediates or transcriptional activators of the core pluripotency factors and are required for mESCs to maintain the unique pluripotent state. Examples of such include Zic3, Zfp322a, Zfp143, Zfp206, and Patz1 [12 –16]. Noticeably, Yoshikawa et al. used whole-mount in situ hybridization and identified that Zfp553 displayed higher expression levels in ICM compared to trophectoderm (TE), which indicates a potential function of Zfp553 in ESCs [17]. Another study by Tang et al. has also postulated that Zfp553 could be a pluripotency-associated factor because of its relative high expression in the ICM and ESCs [17,18]. Nonetheless, the molecular functions of Zfp553 and its roles in ESC pluripotency are still unclear.

In this study, we identified Zfp553 as a new pluripotency-associated factor that is required in mESCs. Zfp553-depleted ESCs were driven to differentiate, with the upregulation of lineage-specific markers and the significant reduction of Oct4, Nanog, and other pluripotency factors. Zfp553 ChIP-sequencing (ChIP-seq) and microarray results revealed downstream targets of Zfp553 and its potential functions in metabolism maintenance and apoptosis pathways. iPSC formation assays demonstrated that reprogramming efficiency was reduced upon Zfp553 depletion in generating iPSCs. Together, these results established Zfp553 as a novel pluripotency factor, which is also required for the reprogramming process.

Materials and Methods

Cell culture

Cells were cultured in a specific medium at 37°C in 5% CO₂ incubator. The ESC medium contains Glasgow Minimum Essential Medium (GMEM; Invitrogen), 0.055 mM β-mercaptoethanol (Sigma-Aldrich), 0.1 mM MEM nonessential amino acid (NEAA; Life Technologies), 1 mM sodium pyruvate (Life Technologies), 1,000 U/mL of leukemia inhibitory factor (LIF; Millipore), and 15% ES cell-qualified fetal bovine serum (ES FBS; Life Technologies). Medium was changed daily, and cells were passaged every 2–3 days. SNL feeder cells were cultured with GMEM containing 10% FBS. SNL feeder cells (80%–90% confluency) were inactivated by treating with mitomycin C (12 mg/mL; Sigma-Aldrich) for 2.5 h. The inactivated cells can be frozen or seeded for culturing iPSCs. Platinum-E (Plat-E) cells were cultured in the Plat-E medium, which consists of Dulbecco's modified Eagle medium (DMEM; Invitrogen) and 10% FBS. iPSCs were maintained in the knockout serum replacement (KSR) medium, which contains DMEM, 15% KSR (Life Technologies), 2 mM l-glutamine (PAA), 1 mM sodium pyruvate, 1,000 U/mL of LIF, 0.055 mM β-mercaptoethanol, and 0.1 mM MEM NEAA.

Embryoid body formation

ESCs were dissociated as per passaging, and they were cultured in the Ultra-Low Attachment surface culture plate (Corning) with LIF withdrawal medium. Embryoid bodies (EBs) were collected after they were cultured in LIF withdrawal medium for 1, 3, 5, and 7 days.

Construction of plasmids

The plasmids for knocking down Zfp553 were constructed according to the pSUPER RNAi system manual (OligoEngine). shRNA sequences were designed using the Eurofins MWG Operon siMAX™ design tool, which were as follows:

mZfp553 shRNA-1: ACACCATCGTGTGCACACA

mZfp553 shRNA-2: ACACAGGCGTACACATACC

Zfp553 cDNA PCR products were cloned into the pCAG-3HA vector to generate pCAG-3HA-Zfp553 plasmid. The polymerase chain reaction (PCR) primers were as follows:

Forward: 5′ ATATAAGATCTGAGGCTTCTCCGGGGGATGAGTTTG 3′

Reverse: 5′ TAATA ACGCGTTCACTCCAGTCCAGCTGGTGACTCC 3′

For those plasmids used in luciferase assays, Pou5f1 CR4 region and Nanog proximal promoter were amplified and cloned separately into the pGL3-Promoter Vector (Promega) upstream of the firefly luciferase gene to generate pSV40-CR4-Luc, pSV40-Pou5f1 pp-Luc, and pSV40-Nanog pp-Luc plasmids. The PCR primers were as follows:

Pou5f1 CR4 region:

Forward: 5′ ATATACTCGAGCACAATCCATAAGACAAGGTTGG 3′

Reverse: 5′ TATATAGATCTAGCTTCCTCAATAGCAGATTAAG 3′

Pou5f1 pp region:

Forward: 5′ ATATACTCGAGAGCTGGGGAAGTCTTGTGTG 3′

Reverse: 5′ TATATAGATCTGGTGGGAGGTGGGTAGAGAG 3′

Nanog proximal promoter region:

Forward: 5′ ATATACTCGAGTAAAGTGAAATGAGGTAAAGCC 3′

Reverse: 5′ TATATAGATCTGGAAAGATCATAGAAAGAAGAG 3′

For retrovirus packaging plasmids for knocking down Zfp553, Zfp553 shRNA-2 was inserted into pSUPER.retro.puro plasmid (Addgene).

Transfection, reverse transcription, and quantitative real-time PCR

Transfection was performed using the Lipofectamine 2000 (Life Technologies) according to the product manual. After transfection, cells were selected with 1 μg/mL puromycin for 4 days. Then, total RNA was harvested using TRIzol reagent (Life Technologies) according to the provided protocol. Reverse transcription was performed using the Superscript III First-Strand Synthesis System with oligo-dT primer (Life Technologies). Furthermore, quantitative real-time PCR was conducted using the SYBR Green PCR Master Mix (Bio-Rad).

Western blot

Western blot assay was performed as before [19]. Primary antibodies used were rabbit anti-Zfp553 (sc-249644; Santa Cruz), mouse anti-β-actin (sc-81178; Santa Cruz), goat anti-Oct4 (sc-8628; Santa Cruz), and rabbit anti-Nanog (sc-33760; Santa Cruz).

Alkaline phosphatase staining

Alkaline phosphatase (AP) staining was carried out using the Alkaline Phosphatase Detection Kit (Millipore) according to the manufacturer's protocol. The numbers of AP colonies were counted under the Zeiss Axio Observer A1 inverted light microscope, and the images of AP staining results in each well were taken using a camera.

Immunofluorescence staining

Immunofluorescence staining was conducted as previously described [15]. Primary antibodies used were anti-HA (sc-7392; Santa Cruz), anti-Oct4 (sc-8628; Santa Cruz), anti-Nanog (sc-33760; Santa Cruz), anti-SSEA-1 (mab34301; Millipore), anti-alpha smooth muscle actin (ab5694; Abcam), anti-nestin (mab2736; R&D), and anti-Gata4 (sc-25310; Santa Cruz). Zfp553 blocking peptide (sc-249644 P; Santa Cruz) was used in peptide blocking assay.

Chromatin immunoprecipitation assay and ChIP-sequencing

ChIP and ChIP-seq were carried out as previously described [15,20]. Anti-Zfp553 antibody (sc-249644; Santa Cruz), anti-HA (sc-7392; Santa Cruz), and anti-goat IgG (SC-2028; Santa Cruz) were used in the ChIP or ChIP-seq process.

Gene expression microarray analysis

Mouse E14 cells were transfected with Zfp553 RNAi or control plasmids followed by RNA extraction. Later, gene expression microarray was performed, and microarray data were analyzed as previously described [15,16].

Luciferase reporter assay

Six hundred nanograms of reporter plasmid was cotransfected with an internal control pRL-TK (30 ng; Promega) encoding Renilla luciferase gene and 600 ng of RNAi or overexpression plasmids. After cells were selected for 72 h, firefly and Renilla luciferase activities were measured with the dual-luciferase reporter system (Promega) by the Ultra 384 Microplate Reader (Tecan) according to the manufacturer's instructions.

Retrovirus packaging and infection

Retrovirus packaging and infection were conducted as previously described [15]. Briefly, Plat-E cells were transfected with pMXs retroviral vectors or pSUPER.retro.puro plasmids and selected with a medium containing 1 μg/mL puromycin (Sigma-Aldrich) and 10 μg/mL blasticidin (Life Technologies) for 36–48 h. Retroviruses were then collected and concentrated using centrifugal filter units (Millipore). Oct4-GFP mouse embryonic fibroblasts (MEFs) were split into 24-well plates and infected with retroviruses 6 h later. Infected MEFs were seeded onto SNL feeder layers 48 h postinfection and maintained in the mESC medium without LIF till the fifth day postinfection. From day 6 after retroviruses infection, they were cultured with the KSR medium. The numbers of GFP⁺ colonies were counted daily till day 14, at which time point AP staining assay was performed.

Oxygen consumption rate and extracellular acidification rate measurement

The oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using the XFe24 Extracellular Flux Analyzer (Seahorse Bioscience) according to the manufacturer's protocol. The XF Sensor Cartridge was hydrated overnight with 1 mL XF Calibrant Solution at 37°C without CO₂. The XF Cell Culture Microplate was pretreated with 0.1% gelatin. Cells were passaged and seeded with 1 × 10⁵ cells per well. The culture medium was then exchanged for the XF Base Medium supplemented with 25 mM glucose (G7528; Sigma-Aldrich), 2 mM l-glutamine (25030-081; Life technologies), and 1.0 mM sodium pyruvate (S8636; Sigma-Aldrich), with an adjusted pH of 7.4 for OCR assays, and 2 mM l-glutamine, with an adjusted pH of 7.35 for ECAR assays. Cells were incubated at 37°C in a non-CO₂ incubator 1 h before the assay. Carbonyl cyanide p-trifluoromethoxyphenylhydrazone (FCCP) titrations were performed to define the optimal FCCP concentration for the OCR assays. Substrates and selective inhibitors were injected during the main assays to achieve final concentrations of 1 μM oligomycin, 0.5 μM FCCP, and 0.5 μM rotenone/antimycin A for OCR assays and 10 mM glucose, 1 μM oligomycin, and 50 mM 2-DG for ECAR assays. OCAR and ECAR results were analyzed using the Seahorse Bioscience Wave software.

Cell cycle analysis

ESCs were selected with puromycin for 4 days after transfected with Zfp553 RNAi plasmid or control plasmid. Then, cells were harvested and resuspended in cold phosphate-buffered saline (PBS). The cells were then fixed by adding cold 70% ethanol drop by drop and incubated on ice for 30 min. After washing twice with cold PBS, the cells were treated with 50 μL of RNase A (100 μg/mL) to ensure only DNA was stained. Then, propidium iodide (50 μg/mL) was added directly to the cells. After incubation at room temperature for 30 min, the cells were analyzed on the flow cytometer (BD FACSCanto). The flow cytometry results were analyzed with flow software 2.5.0.

Annexin V-FITC apoptosis assay

The apoptosis assay was conducted according to the manufacturer's protocol (APOAF; Sigma-Aldrich). Briefly, cells were transfected with Zfp553 RNAi plasmid in six-well dishes and selected for 3 days. Then, the cells were stained with Annexin V-FITC and propidium iodide followed by determining the fluorescence of the cells with a flow cytometer.

Results

Depletion of Zfp553 leads to differentiation of mESCs

Yoshikawa et al. have shown that Zfp553 is predominantly located in the ICM of embryos [17]. Furthermore, the increasing reports of other zinc finger proteins playing a role in ESC pluripotency suggest that Zfp553 might have similar functions. We first performed western blot and immunostaining with ESC lysate using a specific anti-Zfp553 antibody and detected Zfp553 in mESCs (Supplementary Fig. S1A, B; Supplementary Data are available online at www.liebertpub.com/scd). Next, to determine the cellular location of Zfp553 in the ESCs, we performed coimmunostaining with anti-ZFP553 and anti-Oct4 antibodies. We observed that Zfp553 is predominantly localized in the nucleus (Supplementary Fig. S1C).

To further investigate if Zfp553 is a pluripotency-associated factor, we induced mESCs to differentiate by culturing them in the LIF withdrawal medium. We then examined the expression levels of Zfp553 after ESC differentiation. RNA was extracted from days 1, 3, and 5 after LIF removal, and gene expression levels of Pou5f1 and Zfp553 were quantified in comparison to those of control cells that were cultured in a normal ESC medium. The results revealed that Zfp553 mRNA level displayed a similar trend as Pou5f1 during ESC differentiation course, decreasing to about 30% at 5 days after LIF removal (Fig. 1A). Meanwhile, Zfp553 protein levels were also decreased during ESC differentiation course after LIF removal (Fig. 1B). It was further supported by the observation that Zfp553 mRNA was decreased in EBs (Supplementary Fig. S1D). These indicate that Zfp553 could be a pluripotency-associated factor in mESCs.

FIG. 1.

Zfp553 is required for maintaining embryonic stem cell (ESC) pluripotency. (A) Zfp553 mRNA level and (B) Zfp553 protein level in mouse (mESCs) were decreased in leukemia inhibitory factor (LIF) withdrawal assay, which induces mESC differentiation. The levels of the Zfp553 and Pou5f1 mRNA were compared to those of control cells cultured in normal ESC medium and normalized against β-actin. Pluripotency genes Pou5f1 and Nanog were downregulated on Zfp553 RNAi both at mRNA level (C) and protein level (D). Two different Zfp553 RNAi plasmids were used for transfection. Cells were selected for 72 h. Control cells were transfected with empty vector, and gene expression levels were normalized against β-actin. (E) Zfp553 depletion caused upregulation of some lineage markers for trophectoderm (TE), endoderm (EN), and mesoderm (ME). Specific primers for lineage markers were used to test the respective gene expression levels by real-time polymerase chain reaction (PCR) and normalized against β-actin. (F) Zfp553 RNAi cells showed a lower alkaline phosphatase (AP) activity compared to control cells. AP staining was performed on the fourth day of selection after the cells were transfected with Zfp553 RNAi or empty vector (scale bar = 100 μm).

To examine the role of Zfp553 in mESCs, it is critical to determine the effects of Zfp553 RNAi in pluripotent mESCs. Two RNAi plasmids were used to knock down Zfp553 in mESCs. As seen in Figure 1C and D, the Zfp553 expression level was reduced both at mRNA level (Fig. 1C) and protein level (Fig. 1D) in mESCs transfected with either RNAi plasmid, indicating a significant knockdown (KD) efficiency. It was observed that Pou5f1 and Nanog expression levels decreased significantly upon Zfp553 RNAi. This indicates that Zfp553 is essential for the maintenance of pluripotency in mESCs.

Next, expression levels of marker genes specific for the TE, ectoderm (EC), mesoderm (ME), and endoderm (EN) lineages were quantified upon Zfp553 KD. An upregulation of these developmental genes, which are usually repressed in pluripotent ESCs, would indicate a differentiated state of ESCs. Indeed, depletion of Zfp553 caused upregulation of TE markers, Bmp4 and Cdx2, by 2- and 8-fold, respectively, while EN markers, Gata6, Soxa17, and Foxa2, displayed a 5.4-, 3.3-, and 2-fold increment, respectively (Fig. 1E). In addition, Fgf5, an early marker of differentiation, also displayed a 3-fold increment. This suggests that KD of Zfp553 causes differentiation of mESCs. AP staining further demonstrated that Zfp533-depleted cells lost their pluripotency. Upon Zfp553 RNAi, cells showed a lower AP activity as depicted by a much lighter purple coloration compared to the control KD cells (Fig. 1F). The AP staining of Zfp553-depleted cells appears to be heterogeneous, which implied that these cells could possibly be in different stages of differentiation. Moreover, the Zfp553-depleted cells lost their round and tightly adherent shape that is a typical characteristic of pluripotent mESCs. Instead, they displayed the morphology of differentiated cells (data not shown). Hence, this further illustrated that Zfp553 is essential for maintaining the pluripotent ESC state.

To determine whether Zfp553 KD could alter the capacity for EB differentiation, we generated EBs from Zfp553-depleted cells and control cells. We then examined the relative expression of three germ layers in EB formation (day 7). We found that EB generated from Zfp553-depleted cells showed a similar trend as control cells for expression levels of pluripotency markers and germ layer genes (Supplementary Fig. S1E), suggesting that Zfp553 KD cannot significantly alter EB formation.

Taken together, these results establish that Zfp553 depletion could induce ESCs to transit from the pluripotent state to a differentiated state as evidenced by the downregulation of pluripotency markers and upregulation of differentiation-associated genes.

Depletion of Zfp553 causes global downregulation of cellular metabolic genes and pluripotency genes

We next performed gene expression microarray to investigate the global gene expression profile changes induced by Zfp553 depletion. The transcriptome from Zfp553 KD cells was compared to that of control cells transfected with empty vector. From the microarray analysis, we found that 166 genes upregulated (>2-fold) and 194 genes downregulated (<0.7-fold) upon Zfp553 RNAi (Fig. 2A). The top 50 upregulated and downregulated genes from gene expression microarray are shown in Supplementary Table S1.

FIG. 2.

Global gene expression profile changes upon Zfp553 depletion. (A) Microarray heat map was generated from relative gene expression of Zfp553 RNAi cells compared to control RNAi cells. Red tiles represent upregulated genes (fold > 2), and green tiles represent downregulated genes (fold < 0.7). Gene ontology analysis relating to biological process was performed for upregulated or downregulated gene clusters. Enriched terms (P < 0.05) were listed in groups. Downregulated genes (B) and upregulated genes (C) were randomly selected and quantified using quantitative polymerase chain reaction (qPCR) for validation. The results are the mean from duplicate experiments. (D) List of genes related to pluripotency that were downregulated after Zfp553 RNAi. (E) List of glycolysis-related genes that were downregulated after Zfp553 RNAi.

To validate the microarray results, we randomly selected some upregulated and downregulated genes and performed quantitative polymerase chain reaction (qPCR) to examine their levels in Zfp553-depleted cells relative to control cells (Fig. 2B, C). Our real-time PCR results confirmed that the fold change of these genes was consistent with gene expression microarray results, which implies that the fold change of genes can be inferred reliably from gene expression microarray analysis.

To determine whether Zfp553 could be involved in some cellular processes, the cluster of genes upregulated or downregulated was subjected to the gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses by GATHER. Enriched GO terms were summarized in Figure 2A and Supplementary Table S2. Upon Zfp553 depletion, terms related to cell apoptosis or cell cycle were enriched in upregulated gene cluster, in accord with the observation that depletion of Zfp553 induces massive cell death compared with control KD. In addition, both cell cycle analysis (Supplementary Fig. S2A) and Annexin V-FTIC apoptosis assay (Supplementary Fig. S2B) showed that depletion of Zfp553 resulted in more cell death compared to control, which further suggests that Zfp553 depletion induces cell apoptosis. Interestingly, the significantly downregulated genes were associated with cellular metabolism terms, indicating a decreased metabolic activity of the cells upon Zfp553 depletion. As differentiated cells are less metabolically active compared to ESCs that are constantly undergoing self-renewal, decreased metabolic activity of the cell may further imply that these Zfp553-depleted ESCs were undergoing differentiation [21,22]. We also found that many pluripotency-associated genes were downregulated on Zfp553 RNAi (Fig. 2D), such as Aire [23], which has been found to be an essential factor that can promote self-renewal of ESCs through Lin28 and Zfp143 [12], which can regulate Nanog through modulation of Oct4 binding. These further indicate that Zfp553-depleted cells were induced to transit from the pluripotent state to a differentiated state.

Zfp553 depletion reduces metabolic rate in mESCs

In addition, the KEGG pathway analysis revealed that glycolysis was enriched in downregulated genes. Figure 2E lists the genes that were downregulated in Zfp553 RNAi cells in microarray analysis. qPCR analysis of these genes confirmed that their levels were indeed reduced in Zfp553-depleted cells compared to control KD cells (Fig. 3A). Same number of control or Zfp553 RNAi cells were seeded into the XF Sensor Cartridge on the fourth day of RNAi assay. Oxidative phosphorylation and glycolytic rates were measured in cell culture using a Seahorse XF24 analyzer. Interestingly, we found that upon depletion of Zfp553 in mESCs, both the glycolytic activity and oxidative phosphorylation rate (as indicated by the mitochondrial adenosine triphosphate [ATP] production) showed a trend of downregulation (Fig. 3B, C). The representative figures of the results are shown (Fig. 3D, E). In contrast, Zfp553 KD in differentiated cells (MEFs) showed no difference in both the glycolytic activity and oxidative phosphorylation rate (Supplementary Fig. S3A, B). Although it has been known that pluripotent stem cells mainly use the glycolytic pathway for energy production, hESCs also generate ATP through oxidative phosphorylation [22,24]. Nevertheless, these results suggest that Zfp553 is involved in maintaining the active metabolism of pluripotent stem cells.

FIG. 3.

Zfp553-depleted cells showed a reduced trend in cell metabolic rate. (A) qPCR results showed that glycolysis-related genes were reduced in Zfp553 knocked down cells. (B) Zfp553 RNAi caused the suppression of oxidative phosphorylation rate. Both mitochondrial adenosine triphosphate (ATP) production and maximum respiration rate displayed significant decrease. (C) Glycolytic activity was significantly reduced upon Zfp553 RNAi. The maximum glycolytic capacity and glycolytic reserve also displayed a trend of reduction. Fold changes were calculated from mean values of relative activities based on three independent experiments. Mann–Whitney U test was used for statistical analysis. (D) Measurements of extracellular acidification rate (ECAR) at different time points from a representative Seahorse run. (E) Measurements of oxygen consumption rate (OCR) at different time points from a representative Seahorse run. All error bars are mean ± S.E.M. (n = 3).

Zfp553 regulates transcription of Pou5f1 and Nanog

Oct4 has been shown to be one of the master regulators of the pluripotency transcription pathway. Thus, it is important to examine if Zfp553 can bind to the Oct4 promoter and regulate Oct4 expression levels. ChIP experiments were performed using anti-Zfp553 antibody on wild-type E14 chromatin. Gene-specific primers were used in real-time PCR to examine any significant enrichment within the Oct4 promoter (Fig. 4A). The data obtained indicated a clear enrichment in the Oct4 distal enhancer, showing a 9.3-fold increase, and in the Oct4 proximal promoter, which resulted in a 4.9-fold increase (Fig. 4B). CR4 has been shown as the binding site for many transcription factors (TFs), including Nanog and Oct4 itself, acting as a strong enhancer for Pou5f1 activation in ESCs [25 –27]. Similarly, we observed a distinct peak at amplicon 3, which corresponds to the Nanog proximal promoter (Fig. 4C, D). In contrast, we did not find the binding of Zfp553 to Pou5f1 (Supplementary Fig. S4A) and Nanog (Supplementary Fig. S4B) in differentiated cells (EBs). Therefore, these results suggest that Zfp553 may directly bind at proximal promoters of Nanog and Pou5f1 and Pou5f1 CR4 regions in mESCs to regulate their transcription.

FIG. 4.

Zfp553 regulates Oct4 and Nanog transcriptions in ESCs but not in differentiated cells. Locations of real-time PCR primers were mapped to promoter regions of Pou5f1 genes (A) and Nanog genes (C). (B) Zfp553 bound to CR4 region and proximal promoter of Pou5f1. (D) Zfp553 displayed the highest enrichment fold at the proximal promoter of Nanog. Chromatin immunoprecipitation (ChIP) was performed using anti-Zfp553 antibody (anti-IgG as control) and followed by qPCR with primers located at Pou5f1 and Nanog in mES E14 cell lines. (E) Schematics of luciferase vectors Pou5f1 pSV40-CR4-Luc, pSV40-pp-Luc, and pSV40-Nanog pp-Luc. CR4 region and proximal promoters of Pou5f1 and Nanog were cloned into the upstream of luciferase gene driven by SV40 promoter. Luciferase activities of these constructs were determined in Zfp553-depleted cells and compared with those of control cells. Renilla luciferase control vectors were transfected simultaneously, and relative luciferase activities were normalized against Renilla luciferase activity. (F) Relative luciferase activities were downregulated on Zfp553 RNAi using constructs Pou5f1 pSV40-CR4-Luc, pSV40-pp-Luc, and pSV40-Nanog pp-Luc (pGL3 Basic Vector as negative control).

After elucidating the binding sites of Zfp553 at the Pou5f1 and Nanog promoter regions, we next examined whether the binding of Zfp553 could regulate gene transcriptions of Pou5f1 and Nanog. Hence, dual-luciferase assays were conducted using three constructs, pSV40-Pou5f1 pp-Luc, pSV40-CR4-Luc, and pSV40-Nanog pp-Luc (pGL3 Basic Vector as control) to determine whether Zfp553 could modulate promoter or enhancer activities of Pou5f1 and Nanog (Fig. 4E). It was observed that the luciferase activities of Zfp553 KD cells were strikingly reduced to 45% and 62%, respectively, in constructs carrying the CR4 and proximal promoter of Pou5f1 (while Zfp533 KD did not significantly influence pGL3 luciferase activity) (Fig. 4F). Similarly, the luciferase activity significantly decreased to about 48% upon Zfp553 depletion when using pSV40-Nanog pp-Luc (Fig. 4F), suggesting that Zfp553 regulates Nanog transcription through the proximal promoter [28].

Therefore, it could be concluded that Zfp553 modulates the transcriptions of Pou5f1 and Nanog through its binding to the key regulatory regions of these two genes and this further highlights the importance of Zfp553 in pluripotency regulation.

Genome-wide depiction of Zfp553 binding sites

To explore genome-wide binding targets of Zfp553 in mESCs and examine the mechanism of how Zfp553 functions in ESC identity, we performed high-throughput sequencing (ChIP-seq) using the anti-Zfp553 antibody. Genomic regions defined by multiple DNA fragments detected from the ChIP-seq were considered as putative binding sites. Peaks of 7-fold or higher enrichment displayed more than 2-fold enrichment in qPCR validation (IgG ChIP was used as negative control, which showed no significant enrichment) (Fig. 5A). Therefore, a peak height of 7 was determined as a threshold value for identifying biologically real binding targets of Zfp553. A total of 3,035 putative binding sites, which correspond to 2,470 genes, were identified as targets of Zfp553. The 100 top-ranked peak heights in Zfp553 ChIP-seq analysis are listed in Supplementary Table S3.

FIG. 5.

Genome-wide binding sites of Zfp553. (A) Validation of Zfp553 ChIP-sequencing (ChIP-seq) targets by qPCR (IgG ChIP as negative control). Corresponding ChIP-seq fold changes are indicated at the bottom of the chart. (B) Distributions of Zfp553 binding loci within the target genes. Schematic definitions of genomic locations for Zfp533 binding sites in putative target genes. (C) Putative binding motifs of Zfp553.

Notably, visualization of the ChIP-seq results showed that Zfp553 was strongly associated with promoter regions of Pou5f1 and Nanog (Supplementary Fig. S5A, B), which further demonstrated that Oct4 and Nanog are direct targets of Zfp553 in pluripotency regulation. Moreover, GO analysis of Zfp553 target genes inferred from our ChIP-seq revealed that Zfp553 may be directly or indirectly involved in coordinating various biological processes in mESCs (Supplementary Fig. S5C, D; Supplementary Table S4). We found that many terms related to metabolism were enriched, including glycoprotein metabolism, supporting the hypothesis that Zfp553 is important for metabolism regulation in mESCs. Many ChIP-seq target genes were found related to development, such as axis specification, neurogenesis, and epithelium morphogenesis, further suggesting that Zfp553 is a regulator of lineage specification. In addition, RNA processing-related terms were also enriched in GO analysis, which implies the involvement of Zfp553 in RNA processing. Taken together, Zfp553 may play multiple roles in mESCs.

Next, we examine the locations of Zfp553 binding sites within the genes (Fig. 5B). We found that 47% of the binding sites fell within promoter regions and 37% in intergenic regions, followed by intron, which occupied 10%. Only 3% and 2% of the loci were within the 3′ UTR and 5′ UTR, respectively. Thus, we propose that Zfp553 is primarily associated with gene promoters. A further analysis was conducted for Zfp553 binding motifs, and one motif (Fig. 5C) with significant E values was found in about 70.4% of the peaks, which was a 6-nucleotide sequence containing CGGAAG.

Depletion of Zfp553 reduces reprogramming efficiency

Since Zfp553 is required to maintain mESC pluripotency, it would be interesting to examine whether it plays any role in the somatic reprogramming process. MEFs transfected with an Oct4-GFP reporter were used to identify putative iPSC colonies by GFP expression [29]. MEFs were infected by OKSM retrovirus with Zfp553 KD retroviruses or control RNAi retroviruses. The number of GFP⁺ colonies was counted daily until day 14. We found that after MEFs were infected with Zfp553 KD retroviruses, Zfp553 expression was significantly downregulated (Supplementary Fig. S6A). MEFs infected with OKSM+Zfp553 KD retrovirus showed a lower Zfp553 expression compared to control before infection and 4 days after infection (Supplementary Fig. S6B). Furthermore, we found that MEFs infected with OKSM+Zfp553 KD retroviruses had reduced number of GFP⁺ colonies than the OKSM control throughout the reprogramming process (Fig. 6A). Similarly, AP staining results showed less AP-positive colonies formed upon Zfp553 depletion in OKSM-mediated reprogramming (Fig. 6B). It was also observed that iPSCs derived from Zfp553KD+OKSM displayed reduced cell viability, indicating that these cells might undergo apoptosis. However, these cells were pluripotent to express pluripotency markers, Oct4 and Nanog (Fig. 6C). Immunostaining of the iPSC-derived EBs also showed that they were able to express all three lineage markers when induced to differentiate (Fig. 6D). These results indicate that depletion of Zfp553 impairs the induction of iPSCs during the reprogramming process, which again implies the requirement of Zfp553 in pluripotency regulation.

FIG. 6.

Depletion of Zfp553 can reduce OSKM reprogramming efficiency. (A) Zfp553-depleted cells showed reduced number of GFP⁺ colonies in reprogramming process compared to control infected with OSKM. (B) Zfp553 RNAi led to less AP colony formation. AP staining was performed on the 14th day of the reprogramming process, and image of each well was presented. (C) Induced pluripotent stem cells (iPSCs) derived from Zfp553KD+OKSM express Oct4 and Nanog. GFP⁺ colonies indicate the putative iPSCs. (D) iPSCs derived from Zfp553KD+OKSM were able to express ectoderm marker nestin, mesoderm marker alpha-smooth muscle actin (SMA), and EN marker Gata4 in EB formation assay. The scale bar represents 100 μm.

Discussion

A complex transcription network governed by master regulators, Oct4, Sox2, and Nanog, cooperates with a number of TFs to control ESC identity [30]. Studies in recent years have identified many zinc finger proteins as regulators of pluripotency, such as Zfp143, Zic3, Patz1, and Zfp322a [12 –16]. In this study, we uncovered zinc finger protein Zfp553 as a novel TF that contributes to pluripotency maintenance in mESCs.

Our data effectively identify Zfp553 as a regulator of pluripotency as we demonstrated how depletion of Zfp553 in ESCs triggered a concomitant loss of their pluripotent state. The importance of Zfp553 was first evidenced by the RNAi assay (Fig. 1), where KD of Zfp553 caused a drastic downregulation in the gene expression of master pluripotency markers, Pou5f1 and Nanog. Our ChIP and luciferase assay results further showed that Zfp553 could bind to Pou5f1 and Nanog promoters to regulate their transcriptions. Disruption of Oct4 and Nanog expression levels has been shown to cause ESCs to differentiate. Therefore, ESCs were unable to maintain the pluripotent state when Zfp553 was depleted. The drastic decrease in the activity of AP and upregulation of TE and EN lineage markers in Zfp553-depleted cells further point to the fact that these cells have lost their pluripotency and are in the process of differentiation.

It has been proposed that the ESC transcription network consists of extensively linked nodes, otherwise known as hubs, which if removed would result in a disintegration of the network, triggering ESC differentiation [31]. These hubs therefore demand extensive inputs to guard the pluripotent state of ESCs. Examples of such hubs include the CR4 region of the Pou5f1 gene and the Nanog proximal promoter as these are sites where numerous TFs are bound. In Zfp553-depleted cells, activity was disrupted at these two hubs, as evidenced by the immediate downregulation of Pou5f1 and Nanog and the subsequent loss of pluripotency. Therefore, Zfp553 could be a crucial regulator at these hubs, and the depletion of Zfp553 would essentially cause a disruption of the ESC pluripotency network.

Besides the master pluripotency regulators, many factors of the ESC transcription network also showed a downregulated trend on depletion of Zfp553. Estrogen-related receptor (Esrrb), for example, is a known Oct4-interacting partner that activates Oct4 and Nanog transcriptions to sustain pluripotency in ESCs [32,33]. Notably, Esrrb is also a binding target of Zfp553. Kruppel-like factor 4 (Klf4) and T-box 3 (Tbx3) were also correspondingly downregulated. Overexpressing either of these two genes can maintain the pluripotent state of ESCs in the absence of LIF [34,35]. Fibroblast growth factor 4 (Fgf4) and undifferentiated embryonic cell transcription factor (Utf1) spotted a decrease in gene expression [36,37]. These factors are highly expressed in the ICM and are transcriptionally regulated by the Oct4–Sox2 complex. We also saw the downregulation of genes that code for Oct4- and Nanog-interacting proteins, such as transcription factor CP2-like 1 (Tcfcp2l1), nucleus accumbens associated 1 (Nacc1), and Zfp143 [12,33,38]. Last, Stat3, the key signaling factor that is part of the LIF signaling pathway, was also downregulated [39]. Hence, it appears that Zfp553 is important for the integrity of the transcriptional regulatory network to maintain the pluripotent state in mESCs. Besides, we also found that depletion of Zfp553 reduces the generation of iPSCs from MEFs in the OKSM-mediated reprogramming process. Reprogramming involves a subset of sequential molecular events to transform the differentiated somatic state to a pluripotent state [40]. KD of Zfp553 possibly hinders the reactivation of pluripotency genes and induces apoptosis, thus reducing the reprogramming efficiency. The requirement of Zfp553 in iPSC induction further supports its regulatory role in pluripotency maintenance. Taken together, our results demonstrate that Zfp553 is essential for both maintenance and acquisition of pluripotency.

Our GO and KEGG pathway analyses of Zfp553 downstream targets, which were identified by microarray and ChIP-seq results, revealed that Zfp553 could be involved in metabolic regulation in mESCs. Many of the downregulated genes in Zfp553-depleted cells were associated with cellular metabolism, such as glycolytic pathway and purine catabolism. ESCs, compared with differentiated cells, exhibit a significantly higher proliferation rate with an upregulated purine catabolism and the use of glycolytic pathway for energy supply [21,22]. Our results revealed that Zfp553-depleted cells showed a trend of reduction in the cell metabolic rate of both glycolysis and oxidative phosphorylation, failing to meet the energy demand of high-proliferative mESCs, which possibly induce cell apoptosis. Mandal et al. have shown that upon induced differentiation of ESCs, the change in the metabolic status of the cell often occurs before the entire process of differentiation [41]. Thus, depletion of Zfp553 might trigger metabolic switch, which contributes to ESC differentiation. However, further investigations are required to decipher the precise roles of Zfp553 in ESC metabolism regulation.

In conclusion, we have shown in this study that Zfp553 is essentially required for pluripotency regulation and reprogramming. It would be interesting to explore its functions in embryo development and human system in future studies. Our genome-wide studies also identified the downstream targets of Zfp553 and its potential involvement in multiple cellular functions, such as metabolism regulation and apoptosis. Therefore, our future aim is to uncover more biological functions of Zfp553.

Although the maintenance of hESCs and mESCs relies on different signalings, they do share the similar gene transcriptional network governed by master regulators, Oct4/Sox2/Nanog. In addition, both mouse and human somatic cells can be converted to iPSCs by inducing the well-known Yamanaka factors OKSM [42 –45]. In addition, human ZNF553 is 87% identical to mouse Zfp553 in amino acid sequence, showing that this zinc finger protein is highly conserved. Hence, we propose that ZNF553 likely plays similar functions in hESCs, which is worthy to be elucidated in our future studies.

Footnotes

Acknowledgments

We thank Huck Hui Ng for Pou5f1-GFP MEFs. This research is supported by the Singapore National Medical Research Council.

Author Disclosure Statement

No competing financial interests exist.

References

Martin

. (1981). Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A, 78:7634–7638.

Evans

and Kaufman

. (1981). Establishment in culture of pluripotential cells from mouse embryos. Nature, 292:154–156.

Thomson

. (1998). Embryonic stem cell lines derived from human blastocysts. Science, 282:1145–1147.

Takahashi

and Yamanaka

. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 126:663–676.

Cavaleri

(2004). Molecular facets of pluripotency. In: Handbook of Stem Cells. Lanza

et al., Elsevier Academic Press, Burlington, MA, pp. 27–44.

Surani

, Hayashi

and Hajkova

. (2007). Genetic and epigenetic regulators of pluripotency. Cell, 128:747–762.

Young

. (2011). Control of the embryonic stem cell state. Cell, 144:940–954.

Liu

, Lu

, Tian

and Han

. (2007). Molecular mechanisms involved in self-renewal and pluripotency of embryonic stem cells. J Cell Physiol, 211:279–286.

Chen

, Xu

, Yuan

, Fang

, Huss

, Vega

, Wong

, Orlov

, Zhang

, et al. (2008). Integration of external signaling pathways with the core transcriptional network in embryonic stem cells. Cell, 133:1106–1117.

10.

Xue

, Ng

and Ng

. (2011). Mapping the networks for pluripotency. Philos Trans R Soc Lond B Biol Sci, 366:2238–2246.

11.

Nagashima

, Hayashi

, Umehara

and Yokoyama

. (2009). Molecular structures of kruppel-like factors. In: The Biology of Kruppel Like Factors. Nagai

SLR

ed. Springer-Verlag, New York, pp. 21–31.

12.

Chen

, Fang

, Liou

and Ng

. (2008). Zfp143 regulates Nanog through modulation of Oct4 binding. Stem Cells, 26:2759–2767.

13.

Lim

, Loh

, Zhang

, Li

, Chen

, Wang

, Bakre

, Ng

and Stanton

. (2007). Zic3 is required for maintenance of pluripotency in embryonic stem cells. Mol Biol Cell, 18:1348–1358.

14.

Wang

, Kueh

, Teh

CHL

, Rossbach

, Lim

, Li

, Wong

, Lufkin

, Robson

and Stanton

. (2007). Zfp206 is a transcription factor that controls pluripotency of embryonic stem cells. Stem Cells, 25:2173–2182.

15.

, Ng

, Teh

, Li

, Lee

, Chong

, Loh

, Collins

, Feng

, Yang

and Wu

(2014). Zfp322a regulates mouse ES cell pluripotency and enhances reprogramming efficiency. PLoS Genet, 10:e1004038.

16.

, Ma

, Jean

, Goh

, Lee

, Chong

, Soong

, Fu

, Yang

and Wu

. (2013). Patz1 regulates embryonic stem cell identity. Stem Cells Dev, 23:1062–1073.

17.

Yoshikawa

, Piao

, Zhong

, Matoba

, Carter

, Wang

, Goldberg

and Ko

. (2006). High-throughput screen for genes predominantly expressed in the ICM of mouse blastocysts by whole mount in situ hybridization. Gene Expr Patterns, 6:213–224.

18.

Tang

, Barbacioru

, Bao

, Lee

, Nordman

, Wang

, Lao

and Surani

. (2010). Tracing the derivation of embryonic stem cells from the inner cell mass by single-cell RNA-seq analysis. Cell Stem Cell, 6:468–478.

19.

Lee

, Ma

, Tan

, Ng

, Soong

, Mori

, Fu

, Zernicka-Goetz

and Wu

. (2012). Protein arginine methyltransferase 6 regulates embryonic stem cell identity. Stem Cells Dev, 21:2613–2622.

20.

, Bruce

, Jedrusik

, Ellis

, Andrews

, Langford

, Glover

and Zernicka-Goetz

. (2009). CARM1 is required in embryonic stem cells to maintain pluripotency and resist differentiation. Stem Cells, 27:2637–2645.

21.

Wang

, Alexander

, Wu

, Hammer

, Cleaver

and McKnight

. (2009). Dependence of mouse embryonic stem cells on threonine catabolism. Science, 325:435–439.

22.

Zhang

, Nuebel

, Daley

, Koehler

and Teitell

. (2012). Metabolic regulation in pluripotent stem cells during reprogramming and self-renewal. Cell Stem Cell, 11:589–595.

23.

Bin

, Jiarong

, Shihao

, Xiuli

, Cheng

, Liangbiao

and Ming

. (2012). Aire promotes the self-renewal of embryonic stem cells through Lin28. Stem Cells Dev, 21:2878–2890.

24.

Birket

, Orr

, Gerencser

, Madden

, Vitelli

, Swistowski

, Brand

and Zeng

. (2011). A reduction in ATP demand and mitochondrial activity with neural differentiation of human embryonic stem cells. J Cell Sci, 124:348–358.

25.

Chew

, Loh

, Zhang

, Chen

, Tam

, Yeap

, Li

, Ang

, Lim

, Robson

and Ng

. (2005). Reciprocal transcriptional regulation of Pou5f1 and Sox2 via the Oct4/Sox2 complex in embryonic stem cells. Mol Cell Biol, 25:6031–6046.

26.

Yeom

, Fuhrmann

, Ovitt

, Brehm

, Ohbo

, Gross

, Hubner

and Scholer

. (1996). Germline regulatory element of Oct-4 specific for the totipotent cycle of embryonal cells. Development, 122:881–894.

27.

Loh

, Wu

, Chew

, Vega

, Zhang

, Chen

, Bourque

, George

, Leong

, et al. (2006). The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nat Genet, 38:431–440.

28.

Rodda

, Chew

, Lim

, Loh

, Wang

, Ng

and Robson

. (2005). Transcriptional regulation of Nanog by Oct4 and Sox2. J Biol Chem, 280:24731–24737.

29.

Kim

, Zaehres

, Wu

, Gentile

, Ko

, Sebastiano

, Araúzo-Bravo

, Ruau

, Han

, Zenke

and Schöler

. (2008). Pluripotent stem cells induced from adult neural stem cells by reprogramming with two factors. Nature, 454:646–650.

30.

Yeo

and Ng

. (2013). The transcriptional regulation of pluripotency. Cell Res, 23:20–32.

31.

and Surani

. (2011). The transcriptional and signalling networks of pluripotency. Nat Cell Biol, 13:490–496.

32.

Zhang

, Zhang

, Wang

, Esteban

and Pei

. (2008). Esrrb activates Oct4 transcription and sustains self-renewal and pluripotency in embryonic stem cells. J Biol Chem, 283:35825–35833.

33.

van den Berg

, Snoek

, Mullin

, Yates

, Bezstarosti

, Demmers

, Chambers

and Poot

. (2010). An Oct4-centered protein interaction network in embryonic stem cells. Cell Stem Cell, 6:369–381.

34.

Zhang

, Andrianakos

, Yang

, Liu

and Lu

. (2010). Kruppel-like factor 4 (Klf4) prevents embryonic stem (ES) cell differentiation by regulating Nanog gene expression. J Biol Chem, 285:9180–9189.

35.

Niwa

, Ogawa

, Shimosato

and Adachi

. (2009). A parallel circuit of LIF signalling pathways maintains pluripotency of mouse ES cells. Nature, 460:118–122.

36.

Kosaka

, Sakamoto

, Terada

and Ochiya

. (2009). Pleiotropic function of fgf-4: its role in development and stem cells. Dev Dyn, 238:265–276.

37.

Okuda

, Fukushima

, Nishimoto

, Orimo

, Yamagishi

, Nabeshima

, Kuro-o

, Yi Nabeshima , Boon

, et al. (1998). Utf1, a novel transcriptional coactivator expressed in pluripotent embryonic stem cells and extra-embryonic cells. EMBO J, 17:2019–2032.

38.

Wang

, Rao

, Chu

, Shen

, Levasseur

, Theunissen

and Orkin

. (2006). A protein interaction network for pluripotency of embryonic stem cells. Nature, 444:364–368.

39.

Cartwright

, McLean

, Sheppard

, Rivett

, Jones

and Dalton

. (2005). LIF/STAT3 controls ES cell self-renewal and pluripotency by a myc-dependent mechanism. Development, 132:885–896.

40.

Apostolou

and Hochedlinger

. (2013). Chromatin dynamics during cellular reprogramming. Nature, 502:462–471.

41.

Mandal

, Lindgren

, Srivastava

, Clark

and Banerjee

. (2011). Mitochondrial function controls proliferation and early differentiation potential of embryonic stem cells. Stem Cells, 29:486–495.

42.

Shi

, Desponts

, Do

, Hahm

, Schöler

and Ding

. (2008). Induction of pluripotent stem cells from mouse embryonic fibroblasts by Oct4 and Klf4 with small-molecule compounds. Cell Stem Cell, 3:568–574.

43.

Schnerch

, Cerdan

and Bhatia

. (2010). Distinguishing between mouse and human pluripotent stem cell regulation: the best laid plans of mice and men. Stem Cells, 28:419–430.

44.

Jaenisch

and Young

. (2008). Stem cells, the molecular circuitry of pluripotency and nuclear reprogramming. Cell, 132:567–582.

45.

Lowry

, Richter

, Yachechko

, Pyle

, Tchieu

, Sridharan

, Clark

and Plath

. (2008). Generation of human induced pluripotent stem cells from dermal fibroblasts. Proc Natl Acad Sci U S A, 105:2883–2888.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.18 MB

0.14 MB

0.10 MB

0.06 MB

0.03 MB

0.01 MB

0.09 MB