Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells from the Tasmanian Devil ( Sarcophilus harrisii ) Express Immunomodulatory Factors and a Tropism Toward Devil Facial Tumor Cells

Abstract

Marsupials have long attracted scientific interest because of their unique biological features and their position in mammalian evolution. Mesenchymal stem cells (MSCs) are of considerable research interest in translational medicine due to their immunomodulatory, anti-inflammatory, and regenerative properties. MSCs have been harvested from various tissues in numerous eutherian species; however, there are no descriptions of MSCs derived from a marsupial. In this study, we have generated Tasmanian devil (Sarcophilus harrisii) MSCs from devil induced pluripotent stem cells (iPSCs), thus providing an unlimited source of devil MSCs and circumventing the need to harvest tissues from live animals. Devil iPSCs were differentiated into MSCs (iMSCs) through both embryoid body formation assays (EB-iMSCs) and through inhibition of the transforming growth factor beta/activin signaling pathway (SB-iMSCs). Both EB-iMSCs and SB-iMSCs are highly proliferative and express the MSC-specific surface proteins CD73, CD90, and CD105, in addition to the pluripotency transcription factors OCT4/POU5F1, SOX2, and NANOG. Expression of the marsupial pluripotency factor POU5F3, a paralogue of OCT4/POU5F1, is significantly reduced in association with the transition from pluripotency to multipotency. Devil iMSCs readily differentiate along the adipogenic, osteogenic, and chondrogenic pathways in vitro, confirming their trilineage differentiation potential. Importantly, in vitro teratoma assays confirmed their multipotency, rather than pluripotency, since the iMSCs only formed derivatives of the mesodermal germ layer. Devil iMSCs show a tropism toward medium conditioned by devil facial tumor cells and express a range of immunomodulatory and anti-inflammatory factors. Therefore, devil iMSCs will be a valuable tool for further studies on marsupial biology and may facilitate the development of an MSC-based treatment strategy against Devil Facial Tumor Disease.

Introduction

Mesenchymal stem cells (MSCs), also known as mesenchymal stromal cells, represent a heterogeneous population of plastic-adherent, fibroblast-like cells that are capable of self-renewal and multipotent differentiation into adipocytes, osteoblasts, and chondroblasts [1]. MSCs continue to attract research interest in the development of cell-based therapies, particularly for degenerative diseases such as osteoarthritis and degenerative disc disease [2,3]. However, MSCs have also been shown to secrete a wide variety of immunomodulatory, anti-inflammatory, and angiogenic factors, and so their potential as a novel therapeutic for a range of immune-mediated and inflammatory disorders is also attracting interest [4,5]. A further important consideration is that MSCs appear to be immune evasive, which permits the use of allogeneic MSCs for therapy, circumventing the need to harvest MSCs directly from the individual being treated [6].

Tissue-derived MSCs have been isolated and characterized from numerous eutherian species [7]. However, when harvested from older donors, their limited proliferative ability, rapid decline of differentiation potential, and the variability in quality across different donors hinder their therapeutic or research utility. Moreover, MSC-based therapies require large numbers of highly proliferative cells, which are relatively homogenous in culture and that will readily differentiate, effectively limiting the donor source to young individuals. Therefore, induced pluripotent stem cell (iPSC)-derived MSCs present a viable alternative to harvested MSCs that have been shown to closely resemble conventional tissue-derived MSCs in terms of both phenotype and function [8,9]. Thus far, iPSC-derived MSCs have been generated in several eutherian models, including mouse, human, and dog [8,10 –12]; however, there are no descriptions of MSCs derived from a marsupial.

Previously, we have generated the first reported marsupial iPSCs from adult Tasmanian devil (Sarcophilus harrisii) dermal fibroblasts [13]. In this study, we report the generation of MSCs from the Tasmanian devil iPSCs (iMSCs), through both embryoid body (EB) formation assays and through inhibition of the transforming growth factor beta (TGF-β)/activin signaling pathway. These iMSCs exhibit MSC-like morphology, are highly proliferative, and express specific MSC surface proteins in addition to endogenously expressed pluripotency factors. Moreover, devil iMSCs readily differentiate along the adipogenic, osteogenic, and chondrogenic pathways in vitro and express a range of immunomodulatory and anti-inflammatory factors. These iMSCs are the first example of an iPSC-derived functional cell type from a marsupial and serve to further validate the devil iPSCs in addition to providing a unique resource for further in vitro studies. It is our hope that they also hold potential for the development of an effective MSC-based treatment strategy against Devil Facial Tumor Disease (DFTD), which is threatening Tasmanian devils with extinction.

Materials and Methods

The use of animal tissues was reviewed and permitted by the Animal Ethics Committee at The University of Queensland, Australia (Ethics approval number: SVS/550/12).

Culture of devil iPSCs

Two of the fully characterized clones of devil iPSCs (Clones A2 and A3) (13) were grown on irradiated mouse embryonic fibroblasts with iPSC medium prepared from KnockOut Dulbecco's modified Eagle's medium (DMEM) (Gibco, Invitrogen, Australia) with the addition of 15% (v/v) defined fetal calf serum (HyClone, GE Healthcare Life Sciences, Australia), 0.1 mM nonessential amino acid solution (NEAA) (Gibco), 1 mM l-glutamine (Gibco), and 0.1 mM 2-mercaptoethanol (Gibco) supplemented with 1,000 IU/mL murine leukemia inhibitory factor (Merck Millipore, Australia) and 6.0 ng/mL human basic fibroblast growth factor (Invitrogen, Australia). Both iPSC clones (Clones A2 and A3) were subjected to mesengenic induction using two established protocols.

Mesengenic induction of devil iPSCs through inhibition of the TGF-β/activin signaling pathway (SB-iMSCs)

Devil iPSCs (Clones A2 and A3) were enzymatically passaged with TrypLE (Gibco) until small clumps of colonies were formed and iPSC bulk cultures were seeded into iPSC basal medium consisting of KnockOut DMEM supplemented with 15% (v/v) defined fetal bovine serum (FBS), 0.1 mM NEAA, 1 mM l-glutamine, and 0.1 mM 2-mercaptoethanol on Matrigel-coated (BD Biosciences, Australia) T25 tissue culture flasks (Costar, Corning Life Sciences, Australia). Cells were then grown for 12–14 days in iPSC medium supplemented with the TGF-β/activin type I receptor inhibitor SB431542 (Stemgent) at a concentration of 10 μM [12,14]. Medium was replaced daily. A single cell suspension was generated with TrypLE, and cells were transferred to T75 cell culture flasks (Costar). Thereafter, MSC medium was used, which consisted of DMEM-high glucose (Gibco) with the addition of 10% FBS (JRH Biosciences, Australia), 0.1 mM NEAA, 1 mM l-glutamine, and 1 mM sodium pyruvate (Gibco).

Mesengenic induction of devil iPSCs through the EB differentiation method (EB-iMSCs)

A previously optimized protocol for human embryonic stem cells (ESCs) and iPSCs was followed to generate EBs from devil iPSCs [14]. Devil iPSCs (Clones A2 and A3) were enzymatically passaged with TrypLE and cultured in six-well ultra-low attachment plates (Costar) in iPSC medium. The culture medium was replaced every other day for 10–12 days. EBs were transferred to T25 tissue culture flasks with MSC medium (as in the previous section). EBs adhered to the flask, and differentiated cells grew outward from the center; ∼5–6 days later, the undifferentiated center of each EB was aspirated out manually, and the remaining cells were left in culture until they became confluent. A single cell suspension was generated using TrypLE, and the cells were seeded directly into T75 cell culture flasks with MSC medium and subsequently expanded.

Growth kinetics and doubling time

Both EB- and SB-iMSCs at passage 3, derived from Clones A2 and A3, were seeded into T75 tissue culture flasks at a cell density of 1 × 10⁴ cells per cm². Cells were passaged with TrypLE when they reached 80% confluency and counted with trypan blue using a cell counter (Bio-Rad Laboratories, Australia). The same seeding density was used for successive subcultures, and cell counting was performed for ∼35 days. Cumulative cell number and cumulative population doubling were determined as described previously [15].

RNA isolation, cDNA synthesis, and analysis of gene expression

Total RNA was extracted from devil iPSCs and iMSCs using an RNA Purification Kit (Macherey-Nagel, Thermo Fisher Scientific, Australia) as per the manufacturer's protocol. RNA was reverse transcribed with the iScript cDNA Synthesis Kit (Bio-Rad Laboratories). Quantitative polymerase chain reaction (PCR) analysis was carried out on a CFX96 real-time PCR detection system (Bio-Rad Laboratories) using SsoFast EvaGreen Supermix (Bio-Rad Laboratories). Expression data were normalized to the expression levels of devil β-ACTIN. The relative expression ratios of selected genes were calculated by the Delta Ct method. Devil iPSCs were used as the control. Validated primers and their product sizes are listed in Tables 1 and 2.

Table 1.

Tasmanian Devil Primer Sets Used to Confirm the Expression of Mesenchymal Stem Cell-Specific Surface Markers and Endogenously Expressed Pluripotency Factors

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)	Size (bp)
CD73	GTTGCCGCTGCTGTTTCTAC	CGCACTTCGAAACGACCTTG	143
CD90	CCTAGTTCCGCATGCCATCA	CCCTTGCTCCCTGCTTTACA	182
CD105	CAAAGCACCTTGCCGTCATC	CGGGACTTATGCCTCTCACC	91
OCT4 (POU5F1)	CTGCTCAGGAGATCGCAGTC	AGTTTCTTGTGCCTGCTCGT	146
POU5F3	TGGAACAAGTGCTAGCCCAG	ACAGATTTGCTGGGGAGTGG	122
NANOG	TGACTTGGGGGCTCCCTTTG	ATGGTGTGGGGAGCGCTAAA	90
SOX2	GCGCCCAGCAGACTTCACAT	TCACATGTGCGACAGGGGC	93
β-ACTIN	AGCAGTGAGCTCTTCCACCC	ATGGAAGGGAACACAGCCCG	206

Table 2.

Tasmanian Devil Primer Sets Used to Confirm the Constitutive Expression of Immunomodulatory and Anti-Inflammatory Factors

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)	Size (bp)
IL-6	ACTACCGACCTGGGCAAATG	CTCTTCCTTCAGGGCGTCAG	72
TGFβ	AGTCTACGGTGGAACAGCAC	CCACTGGTACACCACACTGG	140
PGE2	GACCCCTGGGTTTATCTGCT	TCCATGGGGAGAGCAGTTGG	77
VEGF	GACACTTCTCCCGCACTACC	CGGGTATTGCTCCAGCTACC	130
iNOS	AAGTGGTATGGTCTGCCAGC	GTAATCACGGACGCCGATCT	117
IL-8	TTGCTGGAGGGATGGCATTAG	GGACTTTGGCCCAGTAAGAC	118
CCL5	TCACCTTCTCTACTCGGCCA	AGCTGACGGTTTTTACGGGT	112
SDF1	TCTAACCTCCCACACAAGGC	TCAGACAGAGCACGCATACC	132
HGF	CACTTGCAACTTTTTGCCTTCG	GGCGTACCTCTGGATTGCTT	119
GAL9	AGCAGATGTGCTCCCATTCAA	TGGCTTACAGGGAGGTTGTG	75

Fluorescence immunocytochemistry

Devil iMSCs were seeded onto sterile coverslips and placed into 12-well plates (Costar) at 1 × 10⁴ cells per cm² and cultured until 75%–80% confluent. Cells were washed with phosphate buffered saline (PBS) (Invitrogen) three times before fixing with 2% paraformaldehyde (PFA) for 10 min at ambient temperature. Next, cells were permeabilized with 0.1% Triton X-100 in PBS for 20 min and blocked with 5% goat serum (Jackson ImmunoResearch) in PBS. Cells were incubated at 4°C overnight with the primary antibodies, which were diluted in 3% goat serum in PBS at the following dilutions: anti-OCT4 (1:50, MAB4401; Merck Millipore), anti-SOX2 (1:50, ab97959; Abcam, Australia), anti-NANOG (1:150, ab80892; Abcam), anti-CD73 (1:50, sc-25603; Santa Cruz Biotechnology), anti-CD90 (1:50, SM420P; Acris Antibodies, Germany), and anti-CD105 (1:50, ab156756; Abcam). In control groups, primary antibodies were excluded and cells were incubated only with 3% goat serum. Next day, cells were washed again three times with PBS and incubated with secondary antibodies, diluted in PBS to 1:1,000, at room temperature for 1 h. The following secondary antibodies were used: Goat Anti-Rabbit IgG H&L (Alexa Fluor^® 568) (ab175471; Abcam), Goat Anti-Mouse IgG H&L (Alexa Fluor^® 488) (ab150113; Abcam), Goat Anti-Rat IgG H&L (Alexa Fluor 488) (ab150157; Abcam), and Goat Anti-Mouse IgM μ chain (Alexa Fluor 488) (ab150121; Abcam). Coverslips were washed with PBS and mounted onto glass slides with ProLong mounting medium containing 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen). Photomicrographs were captured on an Olympus 1X51 inverted fluorescence microscope (Olympus, Australia).

Flow cytometry

Devil iMSCs were dissociated with TrypLE, and a total of 2 × 10⁶ cells was used for the analysis of each marker. Cells were washed with PBS three times and fixed with 4% PFA for 20 min at room temperature. Cells were again washed with PBS three times and blocked for 30 min at ambient temperature with 5% goat serum added to 1% bovine serum albumin in PBS (PBA). Cells were then incubated overnight with primary antibodies at 4°C. Primary antibodies were diluted in 5% goat serum/PBA as follows: anti-CD73 (sc-25603; 1:50) and anti-CD90 (SM420P; 1:50). Negative controls were incubated only with PBA. Next day, cells were washed three times with PBA and incubated with secondary antibodies (as stated above) for 1 h at room temperature. Finally, cells were analyzed with a CytoFLEX Flow Cytometer (Beckman Coulter, Australia). Sixty thousand events were recorded for each sample.

In vitro mesodermal differentiation assays

The mesodermal differentiation potential was assessed using StemPro Adipogenesis, Osteogenesis, and Chondrogenesis Differentiation Kits (Life Technologies, Australia) as per the manufacturer's protocols. Osteogenic and adipogenic differentiation were assessed by plating cells into six-well tissue culture plates at a density of 1 × 10⁴ cells/cm². Cells were cultured with osteogenic or adipogenic induction medium, which was replaced every 2–3 days for 14 days. For the chondrogenic differentiation assay, 1 × 10⁶ cells of devil iMSCs were collected by centrifugation (200 g for 3 min) in a 15 mL conical tube. The supernatant was discarded and substituted with chondrogenic induction medium. The medium was replaced every 3 days for 21 days. Chondrogenic and osteogenic differentiation were observed by staining with Alcian blue (Sigma-Aldrich, Australia) and Alizarin red S (Sigma-Aldrich), respectively. Adipogenic differentiation was confirmed with HCS LipidTOX Red staining (Life Technologies).

In vitro teratoma assays

Teratoma formation utilizing immune deficient mice is the “gold-standard” assay to define true pluripotent stem cells (PSCs), which form disorganized tumors containing tissue derivatives of the three embryonic germ layers [16]. However, as an alternative to increasingly controversial live animal testing, a modified protocol of the methylcellulose gel-supported three-dimensional in vitro teratoma assay was used as previously described [13,17]. Devil iMSCs were dissociated with TrypLE, and ∼3 × 10⁵ cells from each group were cultured between two layers of 10% (w/v) low molecular weight methylcellulose (Sigma-Aldrich). iMSCs were cultured with DMEM containing 20% (v/v) FBS, 0.1 mM NEAA, 6 mM l-glutamine, and 1 mM sodium pyruvate for 8 weeks. Finally, teratomas were fixed with 4% PFA, before paraffin embedding and sectioning for histological analysis.

Culture of Devil Facial Tumor 1 cells and preparation of conditioned medium

Devil Facial Tumor 1 (DFT1) cells were generously provided by Prof. Gregory Woods (The University of Tasmania, Tasmania, Australia) and cultured in complete Roswell Park Memorial Institute (RPMI) medium (Gibco) with the addition of 10% FBS, 1 mM l-glutamine, and 1% Antibiotic-Antimycotic (Gibco).

For the preparation of conditioned medium, DFT1 cells were cultured in T75 tissue culture flasks until they reached 75%–80% confluency before being washed with PBS thrice and refed with serum-free DFT1 culture medium (as above, but without FBS). Culture supernatant was collected at 24 and 48 h postincubation and pooled together. The collected conditioned medium was stored at −80°C before being used for the experiments.

Scratch assay

Each well of a six-well tissue culture plate was seeded with devil iMSCs (Clones EB-A2 and SB-A2) (Passage 5) to a final concentration of 1 × 10⁵ cells/well, in MSC medium (as above), and maintained at 37°C and 5% CO₂ for 24 h to allow cell adhesion and the formation of a confluent monolayer. A single scratch was made in the confluent monolayers with sterile 200 μL pipette tips. Each well was washed twice with serum-free MSC culture medium to discard dislodged cells. “Wound” closure was observed by collecting digitized images at 24, 48, and 72 h after the scratch was performed.

In vitro migration assay

In vitro migration assays were performed using the Cultrex 24-Well Cell Migration Assay system (R&D Systems, Australia). Devil iMSCs were cultured in T75 tissue culture flasks until they reached 80% confluency. In the final 24 h before the assay, cells were starved in a serum-free MSC medium (MSC medium without FBS). Following trypsinization, devil iMSCs (EB-iMSCs and SB-iMSCs) were seeded in the upper chamber (1 × 10⁵ cells/well), while conditioned medium from DFT1 cultures was added to the lower chamber, of each well. Two wells were used for each cell line. Cells were then incubated at 37°C, 5% CO₂ for 24 h. Serum-free medium was used as the negative control in place of DFT1-conditioned medium. The following day, medium from the top chambers was carefully aspirated, and each insert was washed with 100 μL of 1 × wash buffer according to the manufacturer's protocol. Medium in the bottom chambers was similarly aspirated, and each bottom chamber was washed with 500 μL of 1 × wash buffer. Next, 500 μL of cell dissociation solution/Calcein-AM was added to the bottom chambers, and the cell migration device was reassembled. After 1 h, the top chambers were removed and the plate was read at 485 nm excitation and 520 nm emission on a TECAN M200 plate reader (Tecan Group Ltd., Männedorf, Switzerland). Using a standard curve, relative fluorescence units were converted to cell number, and the percent invasion was determined as detailed in the manufacturer's protocol.

Statistical analysis

All values are reported as the mean ± standard error of the mean and are representative of at least three independent experiments except where specifically stated otherwise. Differences between individual groups were analyzed by analysis of variance. Means were compared by Student's t-test using GraphPad Prism 7 software. Significance is indicated as: not significant (ns) P > 0.05, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001.

Results

Inhibition of TGF-β/activin type I receptor promotes differentiation of devil iPSCs toward a mesenchymal-like morphology

Incubation of devil iPSCs with TGF-β/activin type I receptor inhibitor (SB431542) for 14 days induced their differentiation toward an MSC-like morphology. This epithelial to mesenchymal transition (EMT) was evident by the gradual formation of a monolayer of cells occupying the culture vessel, particularly around the periphery of a colony (Fig. 1). Following passage into MSC medium the cells rapidly adhered to the plastic surface. After subsequent passages (first or second passage), cells displayed a fusiform to stellate appearance and were uniformly distributed as single cells throughout the culture vessel, resembling adult MSCs described from other mammalian species. In contrast, in the absence of TGF-β/activin type I receptor inhibitor, undifferentiated devil iPSCs remained as dome-shaped, multilayered colonies of tightly packed cells (data not shown).

FIG. 1.

Morphology of devil iMSCs derived by the TGF-β/activin type I receptor inhibitor method. (A, B) The morphology of devil iMSCs cultured for 12–14 days with SB431542 (Clone A2 and Clone A3, Passage 5) × 100. (C, D) Images of demarcated area (of A and B respectively) at a higher magnification (Clone A2 and Clone A3) × 200. During 12–14 days of inhibition with SB431542, induction of differentiation was noticeable as devil iPSCs organized into a monolayer on the periphery of colonies. (E, F) Devil iMSCs 2 days after being passaged onto plastic with MSC medium (Clone A2 and Clone A3) × 400. All cells were plastic adherent and were evenly distributed as single cells. iMSCs generated from iPSC clone A2 are morphologically similar to those of clone A3. MSC, mesenchymal stem cell; iPSC, induced pluripotent stem cell; TGF-β, transforming growth factor-beta.

Derivation of MSC-like cells through an EB differentiation assay

EBs were first generated for 10–12 days in iPSC medium as spheres and transferred to uncoated tissue culture flasks containing standard MSC medium. After transfer to tissue culture flasks, EBs attached to the surface of the culture vessel and, subsequently, cells with a differentiated morphology grew outward from the center of the EBs. By passage two or three these cells displayed an MSC-like morphology that was comparable to that observed in the SB-iMSCs (Fig. 2).

FIG. 2.

Morphology of devil iMSCs derived by the EB differentiation method. (A, B) The morphology of floating EBs (EBs) grown for 14 days in suspension culture (Clone A2 and Clone A3, Passage 5) × 200. (C, D) The morphology of EBs 4 days after transferring into uncoated tissue culture flasks containing standard MSC medium. EBs rapidly adhered to the vessel and cells that grew outward from the center displayed an MSC-like morphology × 200. (E, F) Devil iMSCs 2 days after being passaged onto plastic with MSC medium (Clone A2 and Clone A3) × 400. All cells were plastic adherent and evenly distributed as single cells. EB, embryoid body.

Devil iMSCs express MSC-specific surface markers

As proposed by the International Society for Cellular Therapy (ISCT), MSCs should express a specific cell-surface antigen expression profile [18]. Therefore, we performed fluorescence immunocytochemistry to demonstrate that devil iMSCs possess an immunophenotype that is consistent with mammalian MSCs. As expected, devil iMSCs derived from both inhibitory and EB differentiation methods (SB-iMSCs and EB-iMSCs, respectively) robustly expressed characteristic MSC surface proteins CD73, CD90, and CD105 (Fig. 3A, B). Negative controls for nonspecific immunostaining are shown in Supplementary Fig. S1.

FIG. 3.

Devil iMSCs express MSC-specific surface markers. (A, B) Fluorescence ICC confirmed expression of MSC-specific surface markers CD73, CD90, and CD105 by SB- and EB-iMSCs (Clone A2, Passage 5) × 400. Nuclei were visualized by staining with DAPI. (C) Quantitative PCR analysis further confirmed the expression of CD73, CD90, and CD105 in iMSCs compared with undifferentiated devil iPSCs (Clone A2 and Clone A3, Passage 5). Gene expression is relative to β-ACTIN. Significance is represented as: not significant (ns) P > 0.05, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001. DAPI, 4′,6-diamidino-2-phenylindole; ICC, immunocytochemistry; PCR, polymerase chain reaction.

The relative mRNA expression levels of these MSC-specific surface markers were further analyzed using quantitative reverse transcription-polymerase chain reaction (RT-PCR) analysis. Clones of both SB- and EB-derived iMSCs had significantly upregulated expression of CD73, CD90, and CD105 compared with devil iPSCs that did not express CD73 or CD90 and had extremely low levels of CD105 expression (Fig. 3C).

Based on flow cytometric analysis, between 82% and 97% of iMSCs (Fig. 4) express the cell surface proteins CD73 and CD90. Despite repeated attempts, with various adjustments to the protocol, we were unable to generate meaningful data using the antibody to CD105.

FIG. 4.

The majority of iMSCs express CD73 and CD90. (A) SB-iMSCs derived from four clones of iPSCs (A1–A4) express CD73 and (B) CD90. (C) The mean percentage of cells positive for CD73 and CD90. (Data shown are for SB-iMSCs, Clone A1–A4, Passage 5).

Devil iMSCs express devil endogenous pluripotency factors

We further characterized devil iMSCs with respect to their expression of pluripotency markers. Interestingly, devil iMSCs derived from both inhibitory and EB differentiation methods continue to express devil endogenous pluripotency factors OCT4, SOX2, and NANOG at both the mRNA and protein levels (Fig. 5). Expression of SOX2 and NANOG was reduced in both EB- and SB-MSCs compared to the iPSCs, with the exception of SOX2 expression in EB-iMSCs derived from iPSC clone A2 which did not change. This is in contrast to the expression of OCT4, which was not significantly different between iPSCs and iMSCs. The most significant change in expression between iPSCs and iMSCs was seen with the marsupial pluripotency factor POU5F3, a paralogue of OCT4, which was robustly expressed in both clones of iPSCs but diminished to low levels in all iMSCs (Fig. 5C). Negative controls for nonspecific immunostaining are shown in Supplementary Fig. S2.

FIG. 5.

Devil iMSCs express pluripotency factors. (A, B) Fluorescence ICC confirmed the expression of endogenous pluripotency factors OCT4, SOX2, and NANOG in both SB- and EB-iMSCs (Clone A2, Passage 5) × 200. Specific localization to nuclei was confirmed by staining with DAPI. (C) Expression of SOX2 and NANOG was reduced in both SB- and EB-MSCs compared to the iPSCs, with the exception of SOX2 expression in EB-A2 which showed no significant change. The expression of OCT4 was not significantly different between iPSCs and iMSCs. In contrast, expression of POU5F3, a paralogue of OCT4, is significantly decreased in iMSCs compared to iPSCs (Clone A2 and Clone A3, Passage 5). Gene expression is relative to β-ACTIN. Significance is represented as: not significant (ns) P > 0.05, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001.

Because the devil iPSCs were generated using a lentiviral system with the transduction of human transcription factors, there is a possibility for reactivation of these transgenes during the EMT. We have previously shown that in devil iPSCs, all six human transcription factor transgenes were transcriptionally silenced at passage 20 (13). Likewise, devil iMSCs (which were generated from devil iPSCs at passage 22) showed no expression of the human transgenes (Supplementary Fig. S3), further confirming that the OCT4, NANOG, and SOX2 proteins detected in the iMSCs are the result of transcription from the devil genes.

Devil iMSCs undergo osteogenesis, chondrogenesis, and adipogenesis

The multipotency of MSCs is typically demonstrated by their differentiation potential into osteogenic, chondrogenic, and adipogenic lineages [19]. Therefore, devil iMSCs were next subjected to standard osteogenic, chondrogenic, and adipogenic differentiation protocols. Devil iMSCs (EB-iMSCs and SB-iMSCs; Clone A2) which were cultured in osteogenic differentiation medium demonstrated mineral deposits that stained strongly with Alizarin red S, characteristic for osteogenic differentiation (Fig. 6A). Devil iMSCs also underwent robust chondrogenic differentiation as demonstrated by Alcian blue staining (Fig. 6B) and adipogenesis as evidenced by the presence of intracellular lipid droplets (Fig. 6C). Negative controls are shown in Supplementary Fig. S4.

FIG. 6.

In vitro mesodermal differentiation potential. Devil iMSCs were exposed to standard adipogenic, osteogenic, and chondrogenic differentiation protocols. (A) After 14 days in differentiation medium, Alizarin red S staining demonstrated the presence of calcium mineralized deposits characteristic of osteogenic differentiation (Clone A2, Passage 8) × 200. (B) After 21 days in differentiation medium, chondrogenic differentiation was demonstrated by Alcian blue staining indicating the presence of mucopolysaccharides (Clone A2, Passage 8) × 200. (C) After 14 days in differentiation medium, adipogenic differentiation was confirmed by positive staining with HCS LipidTOX Red indicating the accumulation of intracellular lipid droplets (Clone A2, Passage 8) × 200.

The growth kinetics of devil iMSCs

The proliferative potential of cells is vital with regard to their application in cellular therapies. Therefore, we next evaluated the growth kinetics of devil iMSCs. After 30 days in culture, SB-iMSCs derived from Clones A2 and A3 reached a cumulative cell number of 2.7 × 10¹¹ and 3.56 × 10¹², respectively. Interestingly, during the same period EB-iMSCs derived from Clones A2 and A3 reached a cumulative cell number of 1.68 × 10¹⁰ and 8.6 × 10¹⁰, respectively (Fig. 7A, B). Over this period, cumulative population doublings of SB-iMSCs were greater than those of EB-iMSCs derived from both clones in that SB-iMSCs derived from Clones A2 and A3 achieved a cumulative population doubling of 16.8 and 20.5, respectively, whereas EB-iMSCs derived from Clones A2 and A3 reached a cumulative population doubling of 12.8 and 15.2, respectively (Fig. 7C, D). The live cell counts were between 86% and 94% over this period of evaluation and were consistent across all analyzed cell lines. Significantly, we have maintained these iMSCs for more than 25 passages without any loss of proliferative ability or cell viability during culture (data not shown).

FIG. 7.

Growth kinetics of devil iMSCs. (A, B) SB-iMSCs demonstrate a superior proliferative potential than EB-iMSCs after 35 days in culture (Clone A2 and Clone A3). (C, D) The cumulative population doubling of SB-iMSCs is greater compared with EB-iMSCs during the same period (Clone A2 and Clone A3).

Devil iMSCs are multipotent, but not pluripotent

Teratomas from devil iMSCs derived from both inhibitory and EB differentiation methods contained tissue derivatives only from the mesodermal germ layer. Teratomas from EB-iMSCs and SB-iMSCs clearly displayed adipose tissue and bone spicules (Fig. 8A, B) indicating that devil iMSCs are multipotent, but not pluripotent, cells that can differentiate toward the mesodermal lineage without the addition of exogenous differentiation factors.

FIG. 8.

iMSCs are multipotent but not pluripotent. Both EB- and SB-iMSCs formed adipose tissue and bone in in vitro teratoma assays. The data shown are from EB-iMSC Clone A3. (A) Multiloculated adipocytes (black arrows) and bone spicules (white arrows). (B) Bone spicules (white arrows). × 200.

Devil iMSCs display tropism toward medium conditioned by devil facial tumor cells

Human and mouse MSCs have been reported to have migratory properties and show a tropism toward tumors and sites of inflammation. To confirm a migratory potential in devil iMSCs, a traditional scratch/wound healing assay was performed and within 72 h iMSCs (SB-A2 and EB-A2) had filled the deficits created by the scratches (Fig. 9A).

FIG. 9.

Devil iMSCs are migratory and display a tropism to medium conditioned by devil facial tumor cells. (A) In vitro wound-healing/scratch assay data demonstrating the migration of devil iMSCs (SB-A2 and EB-A2) out from a confluent monolayer onto the “scratch” (Clone A2, Passage 5) × 200. (B) Both SB- and EB-iMSCs migrated toward DFT1-conditioned medium in a transwell migration assay. Columns represent the mean percentage of migrating cells relative to the negative control (Clone A2 and Clone A3, Passage 5). Significance is represented as: **P ≤ 0.01, ***P ≤ 0.001. DFT1, Devil Facial Tumor 1.

A transwell migration assay (Boyden chamber assay) was used to determine if iMSCs possess a tropism toward devil tumor cells or, more specifically, toward medium conditioned by them. We observed a highly significant increase of 10.31% ± 0.55% (P ≤ 0.01) and 13.47% ± 0.18% (P ≤ 0.001) in migration of SB-A2 and SB-A3 iMSCs, respectively, toward DFT1-conditioned medium compared to control medium (Fig. 9B). EB-A2 and EB-A3 iMSCs displayed a 13.07% ± 1.03% (P ≤ 0.01) and 5.21% ± 0.45% (P ≤ 0.01) increase in migration, respectively, compared to control cultures (Fig. 9B).

Devil iMSCs express immunomodulatory and anti-inflammatory factors

MSCs across a range of eutherian species secrete factors that can modulate the immune system in response to inflammation [20]. Therefore, we analyzed the constitutive expression of key immunomodulatory and anti-inflammatory factors by devil iMSCs at the transcriptional level. Both EB- and SB-iMSCs express the immunomodulatory factors interleukin 6 (IL-6), transforming growth factor-β (TGF-β), prostaglandin E2 (PGE2), vascular endothelial growth factor (VEGF), and inducible nitric oxide synthase (iNOS) (Fig. 9A). A study of the expression of anti-inflammatory factors revealed differences between EB- and SB-derived iMSCs in the expression of interleukin 8 (IL-8) and hepatocyte growth factor (HGF), both of which are expressed at significantly higher levels in SB-iMSCs than in EB-iMSCs. Both EB- and SB-iMSCs express the anti-inflammatory factors galectin-9 (GAL-9), chemokine ligand 5 (CCL5), and stromal cell-derived factor 1 (SDF1) (Fig. 10).

FIG. 10.

Devil iMSCs express immunomodulatory and anti-inflammatory factors. Quantitative RT-PCR analysis for (A) immunomodulatory (IL-6, TGF-β, PGE2, VEGF, and iNOS) and (B) anti-inflammatory (IL-8, CCL5, SDF1, HGF, and GAL-9) markers (Clone A2 and Clone A3, Passage 8). CCL5, chemokine ligand 5; GAL-9, galectin-9; HGF, hepatocyte growth factor; IL-8, interleukin-8; iNOS, inducible nitric oxide synthase; PGE2, prostaglandin E2; RT-PCR, reverse transcription-polymease chain reaction; VEGF, vascular endothelial growth factor; SDF1, stromal cell-derived factor 1.

Discussion

MSCs, also known as mesenchymal stromal cells, are an important focus in translational research because of their ability to differentiate into a variety of mesoderm-derived tissues and their anti-inflammatory and immunomodulatory properties. MSCs are typically sourced from bone marrow and fat of adults [21,22], but their clinical potential is hampered due to the scarcity of MSCs in tissues, their heterogeneity, and the invasive nature of harvesting procedures [23]. Therefore, various protocols for generating MSCs from PSCs have been developed to circumvent the need to harvest them directly from live animals [14]. To date, MSCs have been isolated from numerous eutherian mammalian species but not from a marsupial.

The conventional technique for the differentiation of human PSCs (ESCs and iPSCs) into diverse cell types, such as MSC-like cells, involves the formation of EBs and subsequent culturing in appropriate differentiating medium [24,25]. However, Chen et al. described a novel protocol to differentiate human PSCs into MSCs by inhibition of TGF-β/activin signaling and subsequently culturing the cells in appropriate conditions supporting the EMT [14]. We have previously generated canine iPSC-derived MSCs [12] using this protocol and in this study we have demonstrated that it is equally as applicable to marsupial iPSCs as it is to those of eutherians. The devil MSCs (iMSCs) that we have generated using both the EB formation and TGF-β/activin inhibition approaches share traits that are characteristic of MSCs described from other mammalian species, particularly with regard to their morphology, plastic adherence, immunophenotype, and differentiation potential.

Mesenchymal marker proteins are widely used to identify and characterize multipotent stem cells that are capable of differentiation into cells of the mesenchymal lineage. MSCs from a range of eutherian species have been shown to express specific cell surface proteins, including CD73, CD90, and CD105 [26]. Similarly, devil iMSCs express MSC-specific surface markers CD73, CD90, and CD105 both at mRNA and protein levels. Furthermore, flow cytometry confirmed that the majority of these cells were positive for CD73 and CD90. In addition, the expression levels, as well as the high percentages of positive cells, for these markers were consistent between and within the SB-derived and EB-derived cell lines.

Many studies have demonstrated that MSCs from different eutherian species express combinations of the key pluripotency factors OCT4, SOX2, and NANOG, depending on the tissue from which the cells were isolated and the age of the donor. For example, MSCs derived from the bone marrow of young rats express Oct4, Sox2, and Nanog, whereas MSCs from the bone marrow of older rats express only Oct4 [27]. Equine [28] and feline [29] bone marrow-derived MSCs and canine MSCs isolated from adipose tissue [30], bone marrow [12,30], and amniotic fluid [31] similarly express OCT4, NANOG, and SOX2, while bone marrow-derived MSCs and those generated from canine iPSCs also express REX1 [12]. Similarly, MSCs from human amniotic membranes express OCT4, NANOG, SOX2, and REX1 [32], while those isolated from fetal lung [33] and fetal membrane and yolk sac [34] express only OCT4 and/or NANOG. Thus, the expression of OCT4, NANOG, and SOX2 by the devil iMSCs is consistent with observations in MSCs from eutherian species and suggests conserved roles for these genes in MSC self-renewal and differentiation in both eutherians and marsupials.

While expression of SOX2 and NANOG was diminished in both EB- and SB-generated MSCs compared to the iPSCs (with the exception of SOX2 expression in EB-iMSCs derived from iPSC clone A2 which did not change), expression of OCT4 remained similar across the iPSCs and iMSCs. This is of interest when contrasted with the change in expression levels of the marsupial pluripotency factor and paralogue of OCT4/POU5F1, POU5F3 (previously referred to in the literature as POU2). During early marsupial development, both OCT4 and POU5F3 are expressed by cells of the epiblast, the marsupial equivalent of the eutherian inner cell mass [35,36]. However, expression of OCT4 in the epiblast appears to be cytoplasmic, while POU5F3 transcripts are restricted to the nucleus [35]. Furthermore, while OCT4 expression is also present within the hypoblast and trophectoderm, POU5F3 expression is tightly restricted to the epiblast [35]. Our devil iPSCs express both OCT4 and POU5F3 as expected, but levels of POU5F3 are several fold higher than those of OCT4 [this study and 13], which is also seen in blastocysts from the tammar wallaby [36]. POU5F3 expression levels are the most significantly decreased in the transition from pluripotent devil iPSCs to multipotent iMSCs. Taken together, these data suggest that POU5F3 may play a more critical role in maintaining pluripotency in marsupials than OCT4. Low levels of POU5F3 expression in devil iMSCs may reflect the observation by Frankenberg et al. [37] that a range of adult tissues in the tammar wallaby, including skin, kidney, skeletal muscle, liver, and lung, express POU5F3; the authors speculate that POU5F3 may be involved in maintaining multipotency of the adult stem cell population within these tissues, and our detection of low levels of POU5F3 expression in iMSCs adds strength to this argument.

A comparison of the growth kinetics of devil EB-iMSCs and SB-iMSCs over 30 days identified a superior proliferative potential, and hence higher cumulative cell numbers, of SB-iMSCs compared to EB-iMSCs. Similar observations were reported by Chen et al., in human MSCs whereby those derived by the SB inhibitory differentiation method displayed faster growth kinetics and, hence, achieved a markedly higher cumulative cell number than the MSCs derived by the EB differentiation method during the early expansion phases [14]. Regardless of the generation method, the observed high proliferative potential of devil iMSCs in culture provides an opportunity to generate clinically efficacious numbers of cells within a short expansion period.

The beneficial effects of MSC-based therapies have been associated with their potent immunomodulatory and anti-inflammatory effects, affecting both the innate and adaptive immune responses [4,38]. These properties are the result of direct cell–cell contact-dependent mechanisms, secretion of a diverse range of cytokines and chemokines, or by a combination of both mechanisms [39]. Devil iMSCs constitutively express a variety of immunomodulatory and anti-inflammatory factors at the transcriptional level. These include immunomodulatory factors such as IL-6, TGF-β, PGE2, VEGF, and iNOS, in addition to anti-inflammatory factors such as IL-8, CCL5, SDF1, HGF, and GAL-9. Due to the unavailability of recombinant devil pro-inflammatory cytokines (for example, TNFα, IFNγ, and IL-1β) and the toxic effects of pro-inflammatory cytokines from other species that were trialed, the induced secretion of immunomodulatory and anti-inflammatory factors by devil iMSCs could not be evaluated.

One of the major challenges of cancer therapy lies in the inefficient delivery of therapeutic agents directly to the tumor sites, particularly in the case of relapsed or metastatic tumors which are often smaller and directly inaccessible [40]. Once systemically administered, MSCs can home to sites of neoplasia, metastases, and inflammation, where they arrest within the vasculature of the tissue before migrating across the endothelium and infiltrating into the tissue [41]. Given this tropism, MSCs have attracted significant scientific interest as potential delivery vehicles for the targeted transport of antitumor agents. Compared to other delivery platforms, their tumor tropic properties enable MSCs to accumulate specifically at the tumor site for better distribution of therapeutic agents, and their ability to modulate the immune response helps to increase MSC survival after transplantation [42]. Thus, MSCs have been genetically engineered to express various antiproliferative, pro-apoptotic, and antiangiogenic reagents and shown to preferentially engraft and exert their effects on various tumor models [43 –46]. Encouraged by the tropism of devil iMSCs that we observed toward medium conditioned by DFT1 cells, and our ability to expand these cells to clinically relevant cell numbers, we are currently exploring the potential of MSC-based treatment strategies against DFTD.

Conclusion

In conclusion, we report the generation of marsupial MSCs from Tasmanian devil iPSCs. These iMSCs express the pluripotency factors OCT4, SOX2, and NANOG, but show significantly reduced expression of the marsupial pluripotency factor POU5F1, suggesting a more critical role for POU5F1 over OCT4 in maintaining marsupial pluripotency. The persistent low level of POU5F1 expression in devil iMSCs suggests that it is involved in supporting multipotency. Importantly, from a clinical perspective, while devil iMSCs express pluripotency markers, they are capable only of differentiating into mesodermal derivatives and do not form tumors in in vitro differentiation assays. In addition, iMSCs express a variety of immunomodulatory and anti-inflammatory factors and demonstrate a tropism toward medium conditioned by devil facial tumor cells, supporting further investigation into their potential use as an MSC-based treatment strategy against DFTD.

Footnotes

Acknowledgment

The authors are extremely grateful to Prof. Gregory Woods from The University of Tasmania, Australia, who very generously provided the DFT1 cells.

Author Disclosure Statement

No competing financial interests exist.

Funding Information

This study was funded by a Morris Animal Foundation grant to Deanne J. Whitworth (Grant Number: D14ZO-080) and an Australian Government Research Training Program Scholarship awarded to Prasanna Weeratunga. The funding bodies had no involvement in the study design, data collection and analysis, preparation of the article, or decision to publish.

Supplementary Material

Supplementary Figure S1

Supplementary Figure S2

Supplementary Figure S3

Supplementary Figure S4

References

Rodriguez

, Rubio

and Menendez

. (2012). Modeling sarcomagenesis using multipotent mesenchymal stem cells. Cell Res, 22:62–77.

Wyles

, Houdek

, Behfar

and Sierra

. (2015). Mesenchymal stem cell therapy for osteoarthritis: current perspectives. Stem Cells Cloning, 8:117–124.

Drazin

, Rosner

, Avalos

and Costa

. (2012). Stem cell therapy for degenerative disc disease. Adv Orthop, 2012:961052.

Gao

, Chiu

, Motan

DAL

, Zhang

, Chen

, Ji

, Tse

, Fu

and Lian

. (2016). Mesenchymal stem cells and immunomodulation: current status and future prospects. Cell Death Dis, 7:e2062.

Gharibi

, Ahmadi

, Seyfizadeh

, Niaragh

and Yousefi

. (2015). Immunomodulatory characteristics of mesenchymal stem cells and their role in the treatment of multiple sclerosis. Cell Immunol, 293:113–121.

Ankrum

, Ong

and Karp

. (2014). Mesenchymal stem cells: immune evasive, not immune privileged. Nat Biotechnol, 32:252–260.

Huang

, Xu

, Sun

, Wu

, Wang

and Li

. (2015). An improved protocol for isolation and culture of mesenchymal stem cells from mouse bone marrow. J Orthop Transl, 3:26–33.

Soontararak

, Chow

, Johnson

, Coy

, Wheat

, Regan

and Dow

. (2018). Mesenchymal Stem Cells (MSC) derived from induced pluripotent stem cells (iPSC) equivalent to adipose-derived MSC in promoting intestinal healing and microbiome normalization in mouse inflammatory bowel disease model. Stem Cells Transl Med, 7:456–467.

Diederichs

and Tuan

. (2014). Functional comparison of human-induced pluripotent stem cell-derived mesenchymal cells and bone marrow-derived mesenchymal stromal cells from the same donor. Stem Cells Dev, 23:1594–1610.

10.

Nachlas

ALY

, Li

, Jha

, Singh

, Xu

and Davis

. (2018). Human iPSC-derived mesenchymal stem cells encapsulated in PEGDA hydrogels mature into valve interstitial-like cells. Acta Biomater, 15:235–246.

11.

Chow

, Johnson

, Regan

, Wheat

, Webb

, Koch

and Dow

. (2017). Safety and immune regulatory properties of canine induced pluripotent stem cell-derived mesenchymal stem cells. Stem Cell Res, 25:221–232.

12.

Whitworth

, Frith

, Ovchinnikov

, Cooper-White

and Wolvetang

. (2014). Derivation of mesenchymal stromal cells from canine induced pluripotent stem cells by inhibition of the TGFbeta/Activin signalling pathway. Stem Cells Dev, 23:3021–3033.

13.

Weeratunga

, Shahsavari

, Ovchinnikov

, Wolvetang

and Whitworth

. (2018). Induced pluripotent stem cells from a marsupial, the Tasmanian Devil (Sarcophilus harrisii): insight into the evolution of mammalian pluripotency. Stem Cells Dev, 27:112–122.

14.

Chen

, Pelekanos

, Ellis

, Horne

, Wolvetang

and Fisk

. (2012). Small molecule mesengenic induction of human induced pluripotent stem cells to generate mesenchymal stem/stromal cells. Stem Cells Transl Med, 1:83–95.

15.

Barlow

, Brooke

, Chatterjee

, Price

, Pelekanos

, Rossetti

, Doody

, Venter

, Pain

, Gilshenan

and Atkinson

. (2008). Comparison of human placenta- and bone marrow-derived multipotent mesenchymal stem cells. Stem Cells Dev, 17:1095–1107.

16.

Gutierrez-Aranda

, Ramos-Mejia

, Bueno

, Munoz-Lopez

, Real

, Mácia

, Sanchez

, Ligero

, Garcia-Parez

and Menendez

. (2010). Human induced pluripotent stem cells develop teratoma more efficiently and faster than human embryonic stem cells regardless the site of injection. Stem Cells, 28:1568–1570.

17.

Whitworth

, Ovchinnikov

, Sun

, Fortuna

and Wolvetang

. (2014). Generation and characterization of leukemia inhibitory factor-dependent equine induced pluripotent stem cells from adult dermal fibroblasts. Stem Cells Dev, 23:1515–1523.

18.

Krampera

, Galipeau

, Shi

, Tarte

and Sensebe

. (2013). Immunological characterization of multipotent mesenchymal stromal cells—the International Society for Cellular Therapy (ISCT) working proposal. Cytotherapy, 15:1054–1061.

19.

Luis

, Penick

and Welter

. (2011). Chondrogenic differentiation of bone marrow-derived mesenchymal stem cells: tips and tricks. Methods Mol Biol, 698:253–278.

20.

Zhao

, Ren

and Han

. (2016). Mesenchymal stem cells: immunomodulatory capability and clinical potential in immune diseases. J Cell Immunother, 2:3–20.

21.

Malgieri

, Kantzari

, Patrizi

and Gambardella

. (2010). Bone marrow and umbilical cord blood human mesenchymal stem cells: state of the art. Int J Clin Exp Med, 3:248–269.

22.

Zuk

, Zhu

, Mizuno

, Huang

, Futrell

, Katz

, Benhaim

, Lorenz

and Hedrick

. (2001). Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng, 7:211–228.

23.

D'Ippolito

, Schiller

, Ricordi

, Roos

and Howard

. (1999). Age-related osteogenic potential of mesenchymal stromal stem cells from human vertebral bone marrow. J Bone Miner Res, 14:1115–1122.

24.

Brown

, Tong

and Krebsbach

. (2009). The derivation of mesenchymal stem cells from human embryonic stem cells. Cells Tissues Organs, 189:256–260.

25.

Hwang

, Varghese

, Lee

, Zhang

, Ye

, Bae

, Cheng

and Elisseeff

. (2008). In vivo commitment and functional tissue regeneration using human embryonic stem cell-derived mesenchymal cells. Proc Natl Acad Sci U S A, 105:20641–20646.

26.

Gebler

, Zabel

and Seliger

. (2012). The immunomodulatory capacity of mesenchymal stem cells. Trends Mol Med, 18:128–134.

27.

Asumda

and Chase

. (2011). Age-related changes in rat bone-marrow mesenchymal stem cell plasticity. BMC Cell Biol, 12:44.

28.

Violini

, Ramelli

, Pisani

, Gorni

and Mariani

. (2009). Horse bone marrow mesenchymal stem cells express embryo stem cell markers and show the ability for tenogenic differentiation by in vitro exposure to BMP-12. BMC Cell Biol, 10:29.

29.

Zhang

, Maiman

, Kurpad

, Crowe

and Alexanian

. (2011). Feline bone marrow-derived mesenchymal stem cells express several pluripotent and neural markers and easily turn into neural-like cells by manipulation with chromatin modifying agents and neural inducing factors. Cell Reprogram, 13:385–390.

30.

Takemitsu

, Zhao

, Yamamoto

, Harada

, Michishita

and Arai

. (2012). Comparison of bone marrow and adipose tissue-derived canine mesenchymal stem cells. BMC Vet Res, 8:150.

31.

Choi

, Choi

, Kim

, Lee

, Park

, Kim

, Li

, Oh

, Lee

and Kyu

. (2013). Isolation of canine mesenchymal stem cells from amniotic fluid and differentiation into hepatocyte-like cells. In Vitro Cell Dev Biol Anim, 49:42–51.

32.

Rodríguez

, Prado

, Gómez

, Boquete

and Blanco

. (2014). Mesenchymal stem cells from human amniotic membrane. In: Perinatal Stem Cells. Atala

, Murphy

, eds. Springer, New York, NY, pp 191–198.

33.

Hua

, Yu

, Dong

, Yang

, Gao

, Lei

, Sun

, Pan

, Wu

and Dou

. (2009). Characterization of mesenchymal stem cells (MSCs) from human fetal lung: potential differentiation of germ cells. Tissue Cell, 41:448–455.

34.

Shin

, Na

, Lee

, Kim

, Shin

, Kim

and Kim

. (2009). Characterization of fetal tissue-derived mesenchymal stem cells. Int J Stem Cells, 2:51–58.

35.

Woranop

, Frankenberg

, Peradziryi

, Holzenspies

, Livigni

, Iwabuchi

, Kaji

and Brickman

. (2015). The evolution and conserved roles of vertebrate POUV proteins in regulating and inducing pluripotency. In: Annual Meeting of the International Society for Stem Cell Research, Stockholm, Sweden, pp 24–27.

36.

Frankenberg

, Shaw

, Freyer

, Pask

and Renfree

. (2013). Early cell lineage specification in a marsupial: a case for diverse mechanisms among mammals. Development, 140:965–975.

37.

Frankenberg

, Pask

and Renfree

. (2010). The evolution of class V POU domain transcription factors in vertebrates and their characterisation in a marsupial. Dev Biol, 337:162–170.

38.

, Xie

, Li

, Yuan

, Shi

and Wang

. (2014). Immunobiology of mesenchymal stem cells. Cell Death Differ, 21:216–225.

39.

Kyurkchiev

, Bochev

, Todorova

, Mourdjeva

, Oreshkova

, Belemezova

and Kyurkchiev

. (2014). Secretion of immunoregulatory cytokines by mesenchymal stem cells. World J Stem Cells, 6:552–570.

40.

Zhenzhen

, Fan

and Xiong

. (2015). Mesenchymal stem cells as delivery vectors for anti-tumor therapy. Stem Cell Investig, 2:6.

41.

Karp

and Teo

GSL

. (2009). Mesenchymal stem cell homing: the devil is in the details. Cell Stem Cell, 4:206–216.

42.

Nguyen

(2013). Mesenchymal stem cells as targeted cell vehicles to deliver drug-loaded nanoparticles for cancer therapy. J Nanomed Nanotechnol, 4:e128.

43.

, Lin

, Cao

, Chen

, Shou

, Huang

, Han

, Wang

and Shi

. (2014). Interferon-α-secreting mesenchymal stem cells exert potent antitumor effect in vivo. Oncogene, 33:5047–5052.

44.

Nakamizo

, Marini

, Amano

, Khan

, Studeny

, Gumin

, Chen

, Hentschel

, Vecil

, et al. (2005). Human bone marrow-derived mesenchymal stem cells in the treatment of gliomas. Cancer Res, 65:3307–3318.

45.

Yang

, Du

, Xu

and Song

. (2014). IFN-γ-secreting-mesenchymal stem cells exert an antitumor effect in vivo via the TRAIL pathway. J Immunol Res, 2014:318098.

46.

Yan

, Yang

, Li

, Hu

, Fan

, Zhang

, Wang

and Xiong

. (2014). Suppression of orthotopically implanted hepatocarcinoma in mice by umbilical cord-derived mesenchymal stem cells with sTRAIL gene expression driven by AFP promoter. Biomaterials, 35:3035–3043.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.34 MB

0.19 MB