Detection of Panton-Valentine Leukocidin-Positive Methicillin-Resistant Staphylococcus aureus Nasal Carriage among Egyptian Health Care Workers

Abstract

Background:

Transmission of methicillin-resistant Staphylococcus aureus (MRSA) among patients is linked mainly to health care personnel. The Panton-Valentine leukocidin (PVL) is a cytotoxin that causes leukocyte lysis. Virulence of pvl-positive-MRSA has been attributed to its ability to express PVL toxin.

Methods:

Swabs for detection of nasal carriage of pvl-positive MRSA among health care personnel at Fayoum University Hospital, Fayoum, Egypt, were collected from 223 health care personnel including 70 doctors (31.4%), 95 nurses (42.6%), 21 laboratory technicians (9.4%), and 37 housekeeping staff (16.6%). Detection of MRSA was done using conventional screening methods and confirmed by multiplex polymerase chain reaction (PCR) for mecA, or its homologue mecC, and pvl genes amplification. Re-swabbing after decolonization therapy was done to evaluate the efficacy of decolonization therapy.

Results:

Fifty-one of 223 participants (22.9%) were colonized with S. aureus. This included 13.5% (30/223) colonized with MRSA and 2.2% (5/223) colonized with PVL-positive MRSA. Moreover, all MRSA isolates were negative for mecC genes. Decolonization therapy was successful in 80% of MRSA carriers including all pvl-positive MRSA carriers.

Conclusions:

This is the first report on nasal carriage of pvl-positive MRSA among Egyptian health care personnel. High carriage rate of MRSA among health care personnel has been attributed mainly to poor hand hygiene compliance and non-judicious use of antibiotics. Improving compliance, reducing antibiotic overuse, screening for carriers, and decolonization are recommended strategies for reducing the spread of MRSA. Multiplex PCR could be used for confirmation of results obtained by conventional phenotypic methods.

Methicillin-resistant Staphylococcus aureus (MRSA) used to be recognized as a hospital-associated pathogen, causing serious and often fatal infections in patients with known risk factors such as advanced age, antibiotic usage, prolonged hospital stay, and immunocompromised state [1]. Community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) strains and the multi-drug–resistant hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) are present and can be diagnosed in both the community and the hospital settings. Although CA-MRSA is phenotypically and genetically different from HA-MRSA [2], no clear distinction between HA-MRSA and CA-MRSA clones was observed in Africa or worldwide [3].

The ability of CA-MRSA to cause infection has been attributed to its ability to express the Panton-Valentine leukocidin (PVL) toxin [4], which also explains its propensity for causing recurrent and severe skin or soft tissue infections [5]. The first report about PVL association with CA-MRSA strains was in the 1990s [6], albeit not all CA-MRSA isolates are PVL producers [1]. Panton-Valentine leukocidin is a bicomponent pore-forming cytotoxin that causes leukocyte lysis or death [1]. Panton-Valentine leukocidin is encoded by two genes, lukF-PV and lukS-PV, carried on lysogenic bacteriophages, [7]. pvl-associated MRSA strains are genetically different from HA-MRSA, because they harbor smaller staphylococcal cassette chromosome (SCCmec) elements, types IV or V, and are frequently more sensitive to antibiotics [4,8].

In the hospital environment, asymptomatically colonized health care personnel and patients are the main sources of MRSA. Methicillin-resistant S. aureus transmission among patients is linked mainly to health care personnel [9]. Several outbreaks of MRSA among patients associated with colonized health care personnel have been described [10]. Health care personnel can act as reservoirs, mechanical vectors, or victims of MRSA transmission because they are at the interface between hospitals and communities. Poor compliance with infection control practices has been implicated in both colonization and transmission of MRSA by health care personnel [11].

Resistance to β-lactams in MRSA is conferred by the acquisition of a mobile genetic element, the SCCmec, carrying the mecA gene that encodes an altered PBP, PBP2a/PBP2b, which has reduced affinity for β-lactam antibiotics. As a result, cell wall biosynthesis in MRSA strains continues even in the presence of otherwise inhibitory levels of β-lactam antibiotics [12].

A mecA homologue gene mecC, formerly named mec_ALGA251, has been found in S. aureus strains and shares only 70% nucleotide homology with mecA. The mecC gene has been found in SCCmec XI [13]. Thus far, isolates containing mecC have been proven to be resistant phenotypically to β-lactams, but some isolates with the mecC gene showed a hetero-resistant phenotype such as resistance against cefoxitin but susceptibility against oxacillin [14]. mecC-positive MRSA have failed to be recognized as classic MRSA with conventional polymerase chain reactions (PCRs) for mecA because of the different nucleotide composition [13]. The mecC-positive MRSA has been implicated in severe infections in human beings [15].

A comprehensive infection control policy for MRSA should include the screening and eradication of this organism from the colonized health care personnel [9]. Cefoxitin susceptibility testing has been used for screening mecA gene because it induces mecA expression better than other agents and interpretation of results is easier [16]. Diagnosis of antibiotic resistance genes in MRSA using multiplex PCR is accurate, rapid, saves effort and resources, and is important in preventing the spread of infections [17].

Therefore, this cross-sectional study was performed to find the nasal carriers of pvl-positive MRSA among health care personnel of Fayoum University Hospital because the study results could be useful for the development of a control policy for MRSA at this hospital.

Patients and Methods

Study setting and design

This prospective cross-sectional study was based at Fayoum University Hospital, Fayoum, Egypt, to identify the prevalence of pvl-positive MRSA nasal carriage among health care personnel. Fayoum University Hospital is a tertiary referral hospital, serving a population of more than three million.

Subjects and nasal swabs

After thorough explanation of the study and obtaining verbal consent, 223 health care personnel were included in the study: 70 (31.4%) doctors, 95 (42.6%) nurses, 21 (9.4%) laboratory workers, and 37 (16.6%) housekeeping staff. The presence or absence of pvl was correlated with age, gender, work category, and current skin infections of participants, which were obtained in a document prepared for this purpose. Individuals with a history of hospitalization within the previous year or the use of antibiotics within one week of collection of swabs were excluded from the study. Nasal samples were collected from both anterior nares by use of a sterile dry cotton collection swab. Each swab contained specimens from both nares of each subject. Specimens were transported at room temperature to the laboratory and processed within two hours.

Isolation and morphologic characterization of S. aureus

These swabs were first cultured on blood agar plates and mannitol salt agar (MSA) for 48 h at 37°C. Identification of S. aureus was confirmed by conventional microbiologic methods based on gram stain, growth on MSA, production of catalase and coagulase, and β-hemolysis.

Antibiotic susceptibility test

Susceptibility testing was done by disk diffusion sensitivity tests against cefoxitin as suggested by the Clinical and Laboratory Standards Institute (CLSI) [16]. For identification of MRSA isolates, cefoxitin disks (30 mcg) were placed to determine the antibiotic susceptibility to cefoxitin. Zone diameters were measured at 24 h. A zone diameter of ≤21 mm was reported as MRSA and those with a zone diameter of ≥22 mm was reported as methicillin-sensitive S. aureus (MSSA) [16]. Methicillin resistance was also screened by using oxacillin resistance screening agar base (ORSAB), supplemented with 2 mg/L of oxacillin (Oxoid, Hampshire, UK). Media plates were inoculated with a drop of a bacterial suspension (turbidity equivalent to that of a 0.5 McFarland standard). Any bacterial growth after 24 or 48 h at 37°C was indicative of resistance to methicillin. Methicillin-resistant S. aureus grows as intense blue colonies as a result of mannitol fermentation and presence of aniline blue. Thus, S. aureus isolates were categorized as being either MSSA or MRSA. Methicillin-resistant S. aureus isolates susceptibility to other antibiotics was tested according to the recommendations of the CLSI [16].

Molecular detection of mecA, mecC, and pvl genes

Methicillin-resistant S. aureus identification was confirmed for the presence of mecA gene or its homologue gene mecC. Multiplex PCR assay was used for amplification of mecA, mecC, and pvl genes.

Genomic DNA extraction

Genomic deoxyribonucleic acid (DNA) was extracted using phenol-chloroform protocol with modifications. After an overnight culture on MSA plates, a single colony from each culture was grown on nutrient broth overnight at 37°C and 1 mL of each culture was sedimented by centrifugation at 13,000g for 10 min at 4°C. The cells were washed with 1× phosphate buffered saline (pH 7.4) and then resuspended in 100 mcL of lysis solution (25% sucrose, 50 mM Tris pH 8.0, 0.1 M Nacl, 30 mg/mL lysozyme, 240 U/mL mutanolysine, and 80 mcg/mL RNase A). The samples were incubated for 15 min at 37°C and treated with 1% sodium dodecyl sulfate (SDS) for two minutes at 21°C and passed through a 25-gauge needle (0.5 mm diameter, 16 mm length) three times. The extracted DNA was depronated by 400 mcL of TE 10.1 and 500 mcL of v/v phenol/chloroform-isoamyl alcohol and centrifuged at 13,000g for 10 min at 21°C. The DNA contained in the aqueous phase was precipitated with 40 mcL 3M sodium acetate (pH 7.0) and 1 mL absolute ethanol for overnight at −20°C and recovered by centrifugation at 12,500g for 45 min at −10°C. The precipitated DNA was washed with 1 mL of 70% ethanol, mixed and sedimented by centrifugation at 13,000g for 30 min at −10°C, and the supernatant was discarded. Deoxyribonucleic acid pellets were dried for 10 min at vacuum desiccators and then were re-suspended in 40 mcL of 10 mM Tris buffer pH 8.0 and stored frozen at −20°C until use.

Primers and preparation for the multiplex PCR assay

Detection of mecA, mecC, and pvl genes was performed according to Stegger et al. [19]. The primers used in this study were obtained from Invitrogen^™, Life Technologies, Carlsbad, California. Sequences of the primers, as well as their target genes, and predicted amplicon size are listed in Table 1. The mecA/mecC/pvl forward and reverse primers mix were prepared according to EURL-AR [18] ^2ST version (www.eurl-ar.eu/data/images/protocols/ pcr_spa_pvl_meca_mecc_sept12.pdf).

Table 1.

Target Genes, Nucleotide Sequences, and Sizes of Multiplex PCR Products for the Panton-Valentine Leukocidin-Positive Methicillin-Resistant S. aureus Gene-Specific Oligonucleotide Primers

Target gene	Primer name	Sequences 5′–3′	Tm	% GC	Size of amplified product (bp)
mecA	MecA P4	TCCAGATTACAACTTCACCAGG	48	45	162
	MecA P7	CCACTTCATATCTTCTAACG	43	40
Pvl	PVl-F	GCTGCACAAAACTTCTTGGAATAT	47	38	85
	PVL-R	AGGACACCAATAAATTCTGGATTG	50	37
mecC	MecA_{LGA251 MultiFP}	GAAAAAAAGGCTTAGAACGCCTC	48	43	138
	MecA_{LGA251 MultiRP}	GAAGATCTTTTCCGTTTTCAGC	46	41

bp = base pair.

Multiplex PCR conditions

Polymerase chain reaction was performed in a total volume of 25 mcL containing 7.5 mcL PCR H₂O, 12.5 mcL 2× PCR Master Mix (One PCR^™, GeneDirex, Taiwan), 1.5 mcL primer mix 1 forward (0.5 mcL of each primer), 1.5 mcL primer mix 2 reverse (0.5 mcL of each primer) and 2 mcL of the DNA template. A positive PCR control from the Fayoum University Hospital collection and a negative control, with no target DNA, were included in the PCR run in the thermal cycler 2720 (Applied Biosystems, Foster City, CA). The amplification program consisted of an initial denaturation step at 94°C for five minutes, 30 cycles of denaturing at 94°C for 30 min, annealing at 59°C for one minute, extension at 72°C for one minute, and a final extension at 72°C for 10 min. Eight microliters of the final product for each samples were analyzed by electrophoresis on a 2% agarose gel, previously stained with ethidium bromide (0.2 mcg/mL) and were run at 130V for one hour. The molecular marker used was a 100 base pair ladder and the amplicons were observed under ultraviolet (UV) radiation.

Decolonization therapy for MRSA carriers

All MRSA carriers were decolonized with Bactroban Nasal^® ointment (2% mupirocin calcium; GlaxoSmithKline, Research Triangle Park, NC). The ointment was put into each nostril two times per day (morning and evening) for seven days [10]. One month later, secondary swabs were collected to check for the status of the carrier state [9].

Ethical approval

This study was revised and approved by the Fayoum Faculty of Medicine Research Ethical Committee.

Data analysis

Collected data were computerized and analyzed using Statistical Package for Social Science (SPSS) version 16 (SPSS Inc., Chicago, IL). Descriptive statistics were used to describe variables; percent and proportion for qualitative variables and mean and standard deviation for quantitative variables. Multivariate logistic regression was used to analysis risk factors for MRSA carriage. Comparison of qualitative data was done using χ² test and Fischer exact test for two by two. P values with significance of less than 5% were considered statistically significant.

Results

Demographic data

Two hundred twenty-three participants were investigated for the nasal carriage of pvl-positive MRSA; 32.7% (73/223) were male and 67.3% (150/223) were female. There were 70 doctors (31.4%), 95 nurses (42.6%), 21 laboratory technicians (9.4%), and 37 housekeeping staff members (16.6%). Ages ranged from 17–55 y; mean ± standard deviation (31.7 ± 7.7) were 52% (116/223), 32.3% (72/223), and 15.7% (35/223) for 17–30, 31–40, and >41 year, respectively. Demographic data and the prevalence of S. aureus and MRSA among various demographic groups are shown in Table 2.

Table 2.

Prevalence of Staphylococcus aureus and Methicillin-Resistant Staphylococcus aureus According to Different Demographic Characteristics

			S. aureus Total = 51		MRSA Total = 30
Variable	Levels	Total examined 223 (100%)	n (% of total)	p value	n (% of total)	p value
Age (year)	17–30	116 (52.0)	24 (20.7)	0.48	14 (12.1)	0.33
	31–40	72 (32.3)	20 (27.8)		13 (18.1)
	> 41	35 (15.7)	7 (20.0)		3 ( 8.6)
Gender	Male	73 (32.7)	18 (24.7)	0.66	12 (16.4)	0.36
	Female	150 (67.3)	33 (22.0)		18 (12.0)
Job	Doctor	70 (31.4)	17 (24.3)	0.85	10 (14.3)	0.64
	Nurse	95 (42.6)	20 (21.1)		10 (10.5)
	Laborary technician	21 ( 9.4)	4 ( 7.8)		7 (18.9)
	Worker	37 (16.6)	10 (27.0)		3 (14.3)
Department	Inpatient (medical)	82 (36.8)	18 (22.0)	0.67	8 ( 9.8)	0.399
	Inpatient (surgical)	99 (44.4)	22 (22.2)		14 (14.1)
	Outpatient	21 ( 9.4)	7 (33.3)		5 (23.8)
	Laboratory	21 ( 9.4)	4 (19.0)		3 (14.3)

MRSA = methicillin-resistant Staphylococcus aureus.

pvl-positive-MRSA and MSSA prevalence

Staphylococcus aureus was isolated from 22.9% (51/223) of participants. Of the S. aureus isolates, as proved by multiplex PCR MRSA isolates were 58.8% (30/51 S. aureus isolates) and 13.5% of the total participants whereas prevalence of MSSA was 41.2% of S. aureus isolates and 9.4% among total participants.

Of these 30 MRSA isolates, 16.7% (5/30) were identified as pvl-positive MRSA because they were pvl positive by PCR. pvl-positive MRSA isolates represented 9.8% (5/51) of S. aureus isolates and 2.3% (5/223 total participants). On the other hand all the MRSA isolates showed negative results for the mecC gene. None of the pvl-positive isolates were MSSA. Also, none of the phenotypically identified MRSA lacked mecA genes. Prevalence of S. aureus, pvl-positive MRSA, non-pvl-positive MRSA, and MSSA according to different demographic characteristics is shown in Table 3.

Table 3.

Prevalence of pvl-Positive Methicillin-Resistant Staphylococcus aureus and Non-pvl–Positive Methicillin-Resistant Staphylococcus aureus According to Different Demographic Characteristics

	Non-pvl–positive MRSA n (25)	pvl-positive MRSA n (5)	Total (%)
Age (years)
17–30	13 (52.0)	1 ( 20.0)	14 (46.7)
31–40	10 (40.0)	3 ( 60.0)	13 (43.3)
>41	2 ( 8.0)	1 ( 20.0)	3 (10.0)
Gender
Male	9 (36.0)	3 ( 60.0)	12 (40.0)
Female	16 (64.0)	2 ( 40.0)	18 (60.0)
Job^a
Doctor	10 (40.0)	0	10 (33.3)
Nurse	5 (20.0)	5 (100.0)	10 (33.3)
Laboratory technician	3 (12.0)	0	3 (10.0)
Worker	7 (28.0)	0	7 (23.3)
Department
Inpatient (medical)	5 (20.0)	3 ( 60.0)	8 (26.7)
Inpatient (surgical)	13 (52.0)	1 ( 20.0	14 (46.7)
Outpatient	4 (16.0)	1( 20.0)	5 (16.7)
Laboratory	3 (12.0)	0	3 (10.0)

Significant association between nurse job and pvl-positive MRSA, p < 0.001.

MRSA = methicillin-resistant Staphylococcus aureus.

Risk factors assessment

A significant association was found between nurse as a risk factor and pvl-positive MRSA (p < 0.001).

Antibiotic sensitivity testing

Of the 30 MRSA isolates identified by mecA gene amplification, those detected by cefoxitin disk susceptibility test and ORSAB were 29 and 28, respectively. Table 4 displays sensitivity (SN), specificity (SP), negative predictive value (NPV), positive predictive value (PPV), and overall accuracy of cefoxitin disk susceptibility test and ORSAB with reference to PCR amplification of mecA gene as the gold standard for MRSA identification.

Table 4.

Sensitivity, Specificity, Negative Predictive Value, Positive Predictive Value, and Overall Accuracy of Cefoxitin Disk Susceptibility Test and Oxacillin Resistance Screening Agar Base with Reference to Polymerase Chain Reaction Amplification of mec A Gene

		mecA
		+	–	Total	SN	SP	PPV	NPV	Accuracy
Cefoxitin susceptibility test	+	29	0	29	96.7%	100%	100%	95.5%	98%
	−	1	21	22
ORSAB susceptibility test	+	28	1	29	93.3%	95.2%	96.6%	90.9%	94%
	−	2	20	22

SN = sensitivity; SP = specificity; PPV = positive predictive value; NPV = negative predictive value; ORSAB = oxacillin resistance screening agar base.

Susceptibility of MRSA isolates to different antibiotics was tested and none of these isolates was vancomycin resistant. There was no substantial difference in the resistance pattern between pvl-positive-MRSA and pvl-negative-MRSA.

Decolonization therapy

Successful decolonization by intra-nasal mupirocin treatment was achieved in 80% (24/30) of MRSA carriers. All pvl-positive MRSA carriers were decolonized as proved by secondary nasal swabs with absence of S. aureus growth on blood agar and MSA.

Discussion

Previous research had proven transmission of MRSA infection from non-clinically infected health care personnel to patients but research on pvl-positive MRSA carriage among health care personnel and their role in transmission remains limited. Unrecognized pvl-positive MRSA carriers among health care personnel may represent an important reservoir for infection [20]. In the current study, a cohort of 223 health care personnel were investigated for pvl-positive MRSA nasal carriage. Methicillin-sensitive S. aureus carriage in health care personnel was 9.4% compared with 23.7% in a meta-analysis study in which results ranged from 0%–40% (95% confidence interval [CI] 10.7%–36.7%) [10]. Whereas the average MRSA prevalence was 4.6% (range, 0%–59%; 95% CI 1.0%–8.2%) in the same meta-analysis study [10] and 2.5% in another Indian study [21], it was 13.5% in the current study including both non-pvl-positive MRSA (11.2%) and pvl-positive MRSA (2.3%). This high prevalence was expected in this hospital and community because of the inappropriate overuse of antibiotics even with viral infections as a prophylaxis. Absence of MRSA carriage among health care personnel was found in an earlier study [10]. The current findings are in agreement with those of Johnston et al. [22] who found nasal MRSA carriage in 2% of health care personnel in the United States. A greater asymptomatic nasal carriage with CA-MRSA (5.8%) was observed in health care personnel at a German nursing home [23]. Additionally, approximately 7% of pediatricians in Taiwan were found to harbor CA-MRSA in their nares by PCR [24]. In several previous studies, carriage rates of pvl-positive CA-MRSA up to 9.7% were reported among health care personnel [25,23,26] compared with 2.3% in the current work. These variable results may be explained by the variability in patients' colonization or infection. In Africa, the prevalence of pvl-positive MRSA carriage or infections ranged from 0.3% to 100%. The highest prevalence was in North African countries [27,28] and the the lowest prevalence was from South Africa [29]. Community-associated pvl-positive MRSA associated with skin and soft tissue was the most commonly detected clone in Africa [3].

In the current study, risk for pvl-positive MRSA colonization was only significantly associated with nurses (p < 0.001). Similar results were obtained in an earlier study [30], whereas a previous study identified no risk factors for MRSA colonization [10]. An outbreak caused by PVL-producing CA-MRSA strains among healthy children during vaccination was proven to be transmitted from colonized health care worker [31]. Factors that may facilitate the spread of MRSA within hospitals include unrecognized carrier admission, prolonged silent colonization, insufficient laboratory identification, and poor compliance with hand hygiene [20]. Two earlier studies that investigated the efficacy of MRSA screening had contradictory conclusions, which can be explained by variable level of hand hygiene compliance that decreases the cross-transmission of MRSA between patients [32,33].

The mecA PCR was considered as the gold standard for MRSA screening. The different screening methods were compared with mecA PCR. The cefoxitin disk screening method showed only one false-negative MRSA whereas ORSAB missed two MRSA isolates in comparison with PCR. The sensitivities and specificities of cefoxitin disk screening method and ORSAB were as follows: 96.7%/93.3% and 100%/95.2%, respectively, with reference to PCR as the gold standard. This was similar to results obtained by an earlier study [34]. Failure to detect methicillin resistance phenotypically despite its proven presence by PCR could be attributed to different levels of mecA gene expression of methicillin resistance that occur every 10⁴ or 10⁶ cells. Because PCR is not dependent on gene expression, it is able to detect pre-methicillin–resistance that possess mecA but does not detect gene expression [35]. Mutations in the primer binding site may lead to the primers not binding to the DNA, resulting in no amplification and false-negative results with PCR [36].

No mecC-positive MRSA was detected in the present study. Data regarding the clinical importance of mecC-positive MRSA in African countries are not available. Thus, screening for mecC should be included in surveillance for MRSA detection especially with the absence of mecA in resistant isolates [3].

Successful decolonization of health care personnel is essential for successful termination of nosocomial MRSA outbreaks [37] because it eliminates the reservoirs. Intra-nasal mupirocin has led to eradication of 80% of MRSA, including pvl-positive MRSA, among colonized health care personnel compared with the 91% eradication rate obtained in a previous study [38]. This topical decolonization procedure is safe and has a sustained effect [39]. However, this protocol may provide only temporary benefit because of the emergence of resistance to the decolonizing agent and the high re-colonization rates [40].

Conclusion

Carriage rates of both non-pvl–positive MRSA and pvl-positive MRSA in our hospital could be attributed mostly to poor hand hygiene compliance and non-judicious use of antibiotics. Improving hand hygiene compliance, reducing antibiotic overuse and improvement of prescription behavior, screening for MRSA carriers, decolonization therapy, and placing MRSA-infected individuals on contact precautions are recommended strategies for preventing the spread of MRSA within this hospital and the surrounding community even with rapid continuous influx of resistant transmissible strains.

Footnotes

Authors Disclosure Statement

No financial support was received for this work. All authors report no conflicts of interest relevant to this article.

References

Shore

, Tecklenborg

, Brennan

, et al. Panton-Valentine leukocidin-positive Staphylococcus aureus in Ireland from 2002 to 2011: 21 clones, frequent importation of clones, temporal shifts of predominant methicillin-resistant S. aureus clones, and increasing multi-resistance. J Clin Microbiol, 2014; 52:859–870.

Zetola

, Francis

, Nuermberger

, Bishai

. Community acquired methicillin-resistant Staphylococcus aureus: An emerging threat. Lancet Infect Dis, 2005; 5:275–286.

Abdulgader

, Shittu

, Nicol

, Kaba

. Molecular epidemiology of methicillin-resistant Staphylococcus aureus in Africa: A systematic review. Front Microbiol, 2015; 6:1–21.

Vandenesch

, Naimi

, Enright

, et al. Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: Worldwide emergence. Emerg Infect Dis, 2003; 9:978–984.

Shallcross

, Fragaszy

, Johnson

, Hayward

. The role of the Panton-Valentine leucocidin toxin in staphylococcal disease: A systematic review and meta-analysis. Lancet Infect Dis, 2013; 13:43–54.

Lina

, Piémont

, Godail-Gamot

, et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis, 1999; 29:1128–1132.

Boakes

, Kearns

, Ganner

, et al. Distinct bacteriophages encoding Panton-Valentine leukocidin (PVL) among international methicillin-resistant Staphylococcus aureus clones harbouring PVL. J Clin Microbiol, 2001; 49:684–692.

Monecke

, Coombs

, Shore

, et al. A field guide to pandemic, epidemic and sporadic clones of methicillin-resistant Staphylococcus aureus. PLoS One, 2011; 6:e17936.

Malini

, Harle Shruti

, Padmavathy

, et al. Methicillin-resistant Staphylococcus aureus carriage amongst health care workers in a tertiary care hospital. J Clin Diagn Res, 2012; 6:791–793.

10.

Albrich

, Harbarth

. Health-care workers: Source, vector, or victim of MRSA?. Lancet Infect Dis, 2008; 8:289–301.

11.

Faibis

, Laporte

, Fiacre

. An outbreak of methicillin-resistant Staphylococcus aureus surgical-site infections initiated by a healthcare worker with chronic sinusitis. Infect Control Hosp Epidemiol, 2005; 26:213–215.

12.

Shore

, Deasy

, Slickers

. Detection of staphylococcal cassette chromosome mec type XI carrying highly divergent mecA, mecI, mecR1, blaZ, and ccr genes in human clinical isolates of clonal complex 130 methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother, 2011; 55:3765–3773.

13.

Paterson

, Harrison

, Holmes

. The emergence of mecC methicillin-resistant Staphylococcus aureus. Trends Microbiol, 2014; 22:42–47.

14.

Deplano

, Vandendriessche

, Nonhoff

, Denis

. Genetic diversity among methicillin-resistant Staphylococcus aureus isolates carrying the mecC gene in Belgium. J Antimicrob Chemother, 2014; 69:1457–1460.

15.

Paterson

, Morgan

, Harrison

, et al. Prevalence and characterization of human mecC methicillin-resistant Staphylococcus aureus isolates in England. J Antimicrob Chemother, 2014; 69:907–910.

16.

Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Sensitivity Testing. CLSI Approved Standard M100-S25. Volume 33, Number 1, 2015. Wayne, PA: Clinical and Laboratory Standards Institute.

17.

Woodford

, Sundsfjord

. Molecular detection of antibiotic resistance: When and where. J Antimicrob Chemother, 2005; 56:259–261.

18.

EUR. Protocol for PCR amplification of mecA, mecC (mecA_LGA251), spa and pvl recommendation. EURL-AR ^2ST version; 2012; 1–5. www.eurl-ar.eu/data/images/protocols/pcr_spa_pvl_meca_mecc_sept12.pdf (Last accessed February 16, 2016).

19.

Stegger

, Andersen

, Kearns

, et al. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecA _LGA251 . Clin Microbiol Infect, 2012; 18:395–400.

20.

Maltezou

, Vourli

, Katerelos

, et al. Panton-Valentine leukocidin-positive methicillin-resistant Staphylococcus aureus outbreak among healthcare workers in a long-term care facility. Int J Infect Dis, 2009; 13:401–406.

21.

Radhakrishna

, D'Souza

, Kotiqadde

, et al. Prevalence of methicillin resistant Staphylococcus aureus carriage amongst health care workers of critical care units in Kasturba Medical College Hospital, Mangalore, India. J Clin Diagn Res, 2013; 7:2697–2700.

22.

Johnston

, Cooper

, Ruby

, et al. Epidemiology of community-acquired methicillin-resistant Staphylococcus aureus skin infections among healthcare workers in an outpatient clinic. Infect Control Hosp Epidemiol, 2006; 27:1133–1136.

23.

Raab

, Kahlau

, Wagenlehner

. Prevalence of and risk factors for carriage of panton-valentine leukocidin-positive methicillin-resistant Staphylococcus aureus among residents and staff of a German nursing home. Infect Control Hosp Epidemiol, 2006; 27:208–211.

24.

Huang

, Su

, Lin

. Nasal carriage of methicillin-resistant Staphylococcus aureus among pediatricians in Taiwan. PLoS One, 2013; 8:e82472.

25.

Linde

, Wagenlehner

, Strommenger

. Healthcare-associated outbreaks and community-acquired infections due to MRSA carrying the Panton-Valentine leucocidin gene in south eastern Germany. Eur J Clin Microbiol Infect Dis, 2005; 24:419–422.

26.

Wagenlehner

, Naber

, Bambl

, et al. Management of a large health care-associated outbreak of Panton-Valentine leucocidin-positive methicillin resistant Staphylococcus aureus in Germany. J Hosp Infect, 2007; 67:114–120.

27.

Ben Nejma

, Mastouri

, BelHadjJrad

, Nour

. Characterization of ST80 Panton-Valentine leukocidin-positive community-acquired methicillin-resistant Staphylococcus aureus clone in Tunisia. Diagn Microbiol Infect Dis, 2013; 77:20–24.

28.

Antri

, Rouzic

, Dauwalder

, et al. High prevalence of methicillin-resistant Staphylococcus aureus clone ST80-IV in hospital and community settings in Algiers. Clin Microbiol Infect, 2011; 17:526–532.

29.

Moodley

, Oosthuysen

, Dusé

, Marais

. Molecular characterization of clinical methicillin-resistant Staphylococcus aureus isolates in South Africa. J Clin Microbiol, 2010; 48:4608–4611.

30.

Verwer

, Robinson

, Coombs

. Prevalence of nasal methicillin-resistant Staphylococcus aureus colonization in healthcare workers in a Western Australian acute care hospital. Eur J Clin Microbiol Infect Dis, 2012; 31:1067–1072.

31.

Tang

, Nguyen

, Ngo

. An outbreak of severe infections with community-acquired MRSA carrying the Panton-Valentine leukocidin following vaccination. PLoS One, 2007; 2:e822.

32.

Harbath

, Fankhauser

, Schrenzel

. Universal screening for methicillin-resistant Staphylococcus aureus at hospital admission and nosocomial infection in surgical patients. JAMA, 2008; 299:1149–1157.

33.

Robicsek

, Beaumont

, Paule

. Universal surveillance for methicillin-resistant Staphylococcus aureus in 3 affiliated hospitals. Ann Intern Med, 2008; 148:409–418.

34.

Al-Talib

, Yean

, Al-khateeb

, et al. Comparative evaluation of five culture media with triplex PCR assay for detection of methicillin-resistant Staphylococcus aureus. Curr Microbiol, 2010; 61:1–6.

35.

Kuwara-Arai

, Kondo

, Hori

, et al. Suppression of methicillin resistance in a mecA-containing pre-methicillin-resistant Staphylococcus aureus strain is caused by the mecI-mediated repression of PBP 2′ production. Antimicrob Agents Chemother, 1999; 40:2680–2685.

36.

Hiramatsu

, Suzuki

, Takayama

, et al. Role of penicillinase plasmids in the stability of the mecA gene in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother, 1990; 34:600–604.

37.

Harberg

. Society for Healthcare Epidemiology of America guideline approach works to control a methicillin-resistant Staphylococcus aureus outbreak. Infect Control Hosp Epidemiol, 2005; 26:115–116.

38.

Doebbeling

, Breneman

, Neu

, et al. Elimination of Staphylococcus aureus nasal carriage in health care workers: Analysis of six clinical trials with calcium mupirocin ointment. The Mupirocin Collaborative Study Group. Clin Infect Dis, 1993; 17:466–474.

39.

Longtin

, Sudre

, François

, et al. Community-associated methicillin-resistant Staphylococcus aureus: Risk factors for infection, and long-term follow-up. Clin Microbiol Infect, 2009; 15:552–559.

40.

Conly

, Johnston

. Mupirocin: Are we in danger of losing it?. Can J Infect Dis, 2002; 13:157–159.