The Inductive Effect of Bone Morphogenetic Protein-4 on Chondral-Lineage Differentiation and In Situ Cartilage Repair

Abstract

Objectives:

As recent studies have suggested that bone morphogenetic protein-4 (BMP-4) and BMP-7 are promising cartilage differentiation factors, this study aimed to compare the efficacy of BMP-4 and BMP-7 for chondral-lineage differentiation in vitro as well as the efficacy of BMP-4 for articular cartilage repair in vivo.

Methods:

Rabbit mesenchymal stromal cells and articular chondrocytes were treated with 10 ng/mL human recombinant BMP-4 or BMP-7. The expression of cartilage-specific genes (col II, aggrecan, and Sox9) and fibroblast growth factor receptor genes was tested by real-time polymerase chain reaction in vitro. Also, full-thickness cartilage defects (diameter 4 mm, thickness 3 mm) were created in New Zealand white rabbits and untreated (group I), or treated with a bilayer collagen scaffold (group II) or BMP-4 with scaffold (group III) (n = 12/group). The repaired tissues were harvested for histology and mechanical testing after 6 or 12 weeks.

Results:

Cartilage differentiation of mesenchymal stromal cells was more apparent after BMP-4 treatment, as evidenced by higher expression of type II collagen and aggrecan genes. Also, BMP-4 induced higher aggrecan and fibroblast growth factor receptor-2 gene expression in chondrocytes, whereas BMP-7 had no effect. In the in vivo experiments, group III treated with BMP-4 protein had the largest amounts of cartilage tissue, which restored a greater surface area of the defect and achieved higher International Cartilage Repair Society scores. Moreover, Young's modulus, which indicates the mechanical properties of the repaired tissue, was markedly higher in group III than in groups I and II (p < 0.05), but lower than in normal tissue.

Conclusion:

BMP-4 is more potent than BMP-7 for cartilage differentiation. The delivery of BMP-4 protein in a bilayer collagen scaffold stimulates the formation of cartilage tissue.

Introduction

Articular cartilage is an avascular tissue that provides structural support and performs load-bearing functions in joints. Loss of function due to trauma or chronic disease may lead to debilitating conditions and osteoarthritis.¹ Current therapies include microfracture,² abrasion, drilling,³ osteochondral grafting,⁴ and autologous chondrocyte implantation (ACI) with or without additional biomaterials.^5,6 However, ACI and osteochondral grafting are complex and costly. Further studies are warranted to search for strategies of stimulating cartilage repair and regeneration.

As a scaffold may provide an optimal microenvironment for endogenous mesenchymal stromal cell (MSC) infiltration, proliferation, and differentiation,⁷ as well as for the migration of surrounding chondrocytes, a variety of scaffolds have been studied and used.^8–12 The collagen-based scaffold is regarded as one of the most promising biomaterials because of its excellent biocompatibility, biodegradability, and mechanical properties.¹³ However, these scaffold strategies for cartilage repair often result in unsatisfactory outcomes, due in part to the limited infiltration, proliferation, and differentiation capacity of the host cells.¹⁴

The quality of cartilage repair can be improved by growth factors, which are important for the proliferation and differentiation of MSCs and chondrocytes. Various cytokines or growth factors, such as transforming growth factor-beta and insulin-like growth factor, enhance the healing process in cartilage lesions¹⁵ and some of them stimulate cell proliferation, differentiation, and matrix synthesis.¹⁶ However, exposure to high concentrations of transforming growth factor-beta can lead to osteophyte formation,^17,18 and insulin-like growth factor loses its superiority when other growth factors are present^19,20; hence, these are not suitable for future clinical application. Application of morphogenetic proteins may be one approach to enhance in situ cartilage repair by microfracture.^21,22 With proper stimulation, endogeneous MSCs and chondrocytes may be induced to assume and maintain a phenotype that more closely resembles normal articular cartilage.

Given that bone morphogenetic protein-2 (BMP-2) triggers the signal for bone formation,²³ among the members of the BMP family, BMP-4 and BMP-7 are promising cartilage differentiation factors. Previous experiments reported that BMP-4 and BMP-7 aid the healing of chondral defects. When delivered in gene form, these factors are capable of inducing de novo cartilage formation and also play a role in the maintenance of articular cartilage.^24–29 As these studies used different models and different application strategies, the data are difficult to compare. And there is no other evidence available comparing their efficacy in cartilage repair. Moreover, the delivery of BMP-4 protein for cartilage repair has not been investigated in vivo.

Based on the physiological characteristics of articular cartilage, bone marrow MSCs and chondrocytes are two of the major cell sources for in situ cartilage repair and regeneration. So, this study aimed to compare the efficacy of BMP-4 and BMP-7 on the chondral differentiation of these two cell types. Also, based on in vitro results, we hypothesized that the delivery of BMP-4 in collagen matrix improves in situ articular cartilage repair. The results of this study are useful for developing a new strategy to stimulate endogenous MSCs and the performance of chondrocytes for in situ cartilage repair.

Materials and Methods

Bilayer collagen scaffold fabrication

The biodegradable collagen scaffold used in this study was made of insoluble type I collagen and was composed of two layers, one dense and the other loose. The scaffold was made as a cylinder with 4 mm diameter and 3 mm length. Insoluble type I collagen was isolated and purified from pig Achilles tendon and dissolved in 0.5 M acetic acid (1.0 wt%).³⁰ The collagen solution was frozen at −80°C, lyophilized in a freeze dryer (Heto Power Dry LL1500, Thermo Fisher Scientific, Shanghai, P.R. China), and then compressed mechanically. Collagen solution was added onto the compressed collagen matrix and freeze-dried again to make a second layer. The scaffold was crosslinked by severe dehydration (dehydrothermal crosslinking)³¹ and then used for implantation.

The pores per unit area were measured by scanning electron microscopy observation using an internal reference bar, and then the average was calculated.

Protein release assay

Based on previous studies,^32,33 we used 1.2% alginate gel (Sigma-Aldrich, St. Louis, MO) in the collagen scaffold for protein delivery. At first, bovine serum albumin (BSA) (250 ng/mL; Invitrogen, Carlsbad, CA) was used to evaluate the efficacy of this protein deliver system (Fig. 3A). To prevent the diffusional loss of protein solution, 25 μL alginate-BSA solution was absorbed by a larger volume of collagen scaffold (cylinder diameter 4 mm, thickness 3 mm, volume 36 mm³), incubated at 37°C for 30 min, and then transferred into a centrifuge tube containing 102 mM CaCl₂ to form a hydrogel. Then the vehicle was washed three times sequentially with distilled water and phosphate-buffered saline (PBS) to remove residual CaCl₂. Three pieces of alginate-BSA gel scaffold were mixed with 20 mL PBS and stored at 37°C in a centrifuge tube to mimic body temperature. Solution (2 mL) was removed and resupplied at 0, 1, 2.5, 4.5, 5.5, 6.5, 10, and 21 h. The cumulative release of BSA was tested with a kit (Micro BCA™ Protein Assay Kit; Thermo Scientific). The experiment was repeated three times. After confirming the effectiveness of this system, BMP-4 was delivered into the defect area in vivo.

Cell culture

Primary chondrocytes were isolated from rabbit articular cartilage (three donors, 16-week-old female New Zealand white rabbits), digested by collagenase (0.2%; Gibco, Grand Island, NY), and cultured in Dulbecco's modified Eagle's medium (Gibco) supplemented with fetal bovine serum (10%, w/v; Gibco), penicillin (100 units/mL), and streptomycin (100 mg/mL) (Gibco). Chondrocytes from passages 1 to 3 (P1–P3) were used.

MSCs were isolated from rabbit iliac bone marrow (three donors, 16-week-old female New Zealand white rabbits). The marrow was aspirated and collected into polypropylene tubes containing preservative-free heparin (1000 units/mL) and mixed well. Bone marrow stromal cells were isolated by short-term adherence to plastic. The nucleated cells were plated in Dulbecco's modified Eagle's medium supplemented with fetal bovine serum (10%, w/v), penicillin (100 units/mL), and streptomycin (100 mg/mL). The nucleated cells were plated at 5 million per 100 mm² dish and incubated at 37°C with 5% humidified CO₂. After 24 h, nonadherent cells were discarded and adherent cells were cultured. The culture medium was changed every 3 days. When the culture dishes became nearly confluent after about 14 days, the cells were detached and serially subcultured. P2–P5 cells were used. For the in vitro differentiation study, BMP-4 (10 ng/mL, human recombinant BMP-4, Stem Cell Technologies, Inc., Vancouver, Canada) and BMP-7 (10 ng/mL, human recombinant BMP-7, Peprotech Ltd., London, United Kingdom) were added to the medium for 3 days of induction. High-density (>95% confluence) monolayer cultures were used in the gene expression level test.

Real-time polymerase chain reaction

Total cellular RNA was isolated by lysis in TRIzol (Invitrogen). The levels of cartilage-specific genes in stimulated rabbit chondrocytes and MSCs were assessed by quantitative polymerase chain reaction (PCR). Rabbit MSCs and chondrocytes seeded without BMP treatment served as controls. PCR was performed using Brilliant SYBR Green QPCR Master Mix (TaKaRa Biotechnologies, Dalian, Canada) on a Light Cycler apparatus (ABI 7900HT, Applied Biosystems, US). The PCR cycling consisted of 40 cycles of amplification of the template DNA, with primer annealing at 60°C. The relative level of expression of each target gene was then calculated using the 2^−ΔΔCt method. The amplification efficiencies of primer pairs were validated to enable quantitative comparison of gene expression. All primers (Invitrogen, Shanghai, China) were designed using Primer 5.0. Each real-time PCR was performed on at least five different experimental samples; representative results are shown as target gene expression normalized to rabbit glyceraldehyde 3-phosphate dehydrogenase. Error bars reflect standard deviation from the mean of three donors and three technical replicates. The experiments were repeated three times. The following 5′ and 3′ primers (listed with GenBank number) were used to evaluate gene expression: type II collagen (Col2, S83370): ATGGACATTGGAGGGCCTGA and TGTTTGACACGGAGTAGCACCA; aggrecan (Agn, L38480): AGGTCGTGGTGAAAGGTGTTG and GTAGGTTCTCACGCCAGGGA; Sox9 (Z46629): GGTGCTCAAGGGCTACGACT and GGGTGGTCTTTCTTGTGCTG; type X collagen (Col10, AF247705): GAAAACCAGGCTATGGAACC and GCTCCTGTAAGTCCCTGTTGTC; fibroblast growth factor receptor 2 (FGFr2, AF184968): TGGTGGAGAACGAGTACGGGTC and TCCCCAGCATCCTCAAAAGTTACA; and glyceraldehyde 3-phosphate dehydrogenase (L23961): TCACCATCTTCCAGGAGCGA and CACAATGCCGAAGTGGTCGT.

Animal model

Adult male New Zealand white rabbits (2.5–3 kg) were maintained singly in stainless-steel cages. Under intramuscular droperidol (0.25 mg/kg), intravenous pentobarbital (20 mg/kg), and general isoflurane (2%) anesthesia, the knee joint was opened with a medial parapatellar approach. The patella was dislocated laterally and the surface of the femoropatellar groove was exposed. A full-thickness cylindrical cartilage defect of 4 mm diameter and 3 mm deep was created in the patellar groove using a stainless-steel punch.

The defects were untreated (group I, n = 12 joints), or treated with bilayer collagen matrix alone (group II, n = 12 joints) or with BMP-4 (250 ng/mL) delivered in the bilayer collagen matrix (group III, n = 12 joints) (Fig. 3B). Immediately after surgery, the animals were returned to their individual cages without joint immobilization. A postoperative antibiotic (gentamicin) was administered intramuscularly at 6 mg/kg per day for 3 days. After sacrifice, three knee joints from each group were evaluated histologically at 6 and 12 weeks. Five knee joints from each group were used for mechanical testing at 12 weeks. All animals were treated according to the standard guidelines approved by Zhejiang University Ethics Committee (no. ZJU2007105002).

Gross morphology and histology

At 6 and 12 weeks after surgery, the rabbits were sacrificed by intravenous overdose of pentobarbital. Three to four samples from each group were examined and photographed for evaluation according to the International Cartilage Repair Society (ICRS) macroscopic assessment scale for cartilage repair (Table 1). After gross examination, samples were fixed in 4% formalin, decalcified in 4% ethylenediamine tetraacetic acid for 14 days, and then embedded in paraffin and cut into 7 μm sections. Four sections from each sample were stained with hematoxylin and eosin for morphological evaluation and stained with safranine-O for glycosaminoglycan distribution. Histological and histomorphometric observation was performed on a light microscope (X71; Olympus, Tokyo, Japan) and analyzed with DP Controller 3.1.1.267 software (Olympus).

Table 1.

International Cartilage Repair Society Macroscopic Evaluation of Cartilage Repair

Cartilage repair assessment ICRS	Points
Degree of defect repair
In level with surrounding cartilage	4
75% repair of defect depth	3
50% repair of defect depth	2
25% repair of defect depth	1
0% repair of defect depth	0
Integration to border zone
Complete integration with surrounding cartilage	4
Demarcating border <1 mm	3
3/4th of graft integrated, 1/4th with a notable border >1 mm width	2
1/2 of graft integrated with surrounding cartilage, 1/2 with a notable border >1 mm	1
From no contact to 1/4th of graft integrated with surrounding cartilage	0
Macroscopic appearance
Intact smooth surface	4
Fibrillated surface	3
Small, scattered fissures or cracks	2
Several, small or few but large fissures	1
Total degeneration of grafted area	0
Overall repair assessment
Grade I: normal	12
Grade II: nearly normal	11–8
Grade III: abnormal	7–4
Grade IV: severely abnormal	3–1

ICRS, International Cartilage Repair Society.

The percentage of cartilage tissue in the area of the defect was calculated from the area of positive safranine-O staining. For the overall evaluation of regenerated tissue in the defects, the repaired tissues were graded blindly by three observers, using the ICRS Visual Histological Assessment Scale (Table 2).³⁴

Table 2.

International Cartilage Repair Society Visual Histological Assessment Scale for Cartilage Repair

Feature	Points
I. Surface
Smooth/continuous	3
Discontinuities/irregularities	0
II. Matrix
Hyaline	3
Mixture: hyaline/fibrocartilage	2
Fibrocartilage	1
Fibrous tissue	0
III. Cell distribution
Columnar	3
Mixed/columnar clusters	2
Clusters	1
Individual cells/disorganized	0
IV. Cell population viability
Predominantly viable	3
Partially viable	1
<10% viable	0
V. Subchondral bone
Normal	3
Increased remodeling	2
Bone necrosis/granulation tissue	1
Detached/fracture/callus at base	0
VI. Cartilage mineralization (calcified cartilage)
Normal	3
Abnormal/inappropriate location	0

Mechanical evaluation

Following a previous study,^35,36 mechanical evaluation was performed as below. Samples were placed in PBS at room temperature for 3–4 h to equilibrate before testing. The compressive mechanical properties of the surface cartilage layer were tested with an Instron testing machine (model 5543; Instron, Canton, MA) and software (Bluehill V2.0; Instron), using a 2 mm diameter cylindrical indenter fitted with a 10 N maximum loading cell. The unconfined equilibrium modulus was determined by applying a step displacement (20% strain) and monitoring compressive force with time until equilibrium was reached. The thickness of the fully relaxed cartilage layer was tested to estimate strain for applied deformations. The crosshead speed used was approximately 0.06 mm/min. The ratio of equilibrium force to cross-sectional area was divided by the applied strain to calculate the equilibrium modulus (in MPa).

Samples following long-term treatment in vivo (12 weeks, n = 5 samples/group) were tested, and native osteochondral samples were also evaluated (n = 5 plugs).

Statistical analysis

To assess differences in histological scoring data and biomechanical data, one-way analysis of variance, post hoc Student-Newman-Keuls (SNK) test was used with SPSS v16. A p-value of less than 0.05 was considered statistically significant.

Results

Bilayer scaffold manufacture

Scanning electron microscopy images showed that the dense layer of the scaffold had micropores and the loose layer had macropores (Fig. 1A). The average pore size was 100–200 and 10–50 μm in the loose and dense layers, respectively.

FIG. 1.

(A) Scanning electron microscopy photograph of a cross section showing the bilayer scaffold. (B) Average cumulative BSA release from the alginate–collagen scaffold. (C) Full osteochondral defect in rabbit patellar groove. Inset: BMP-4 delivery system, collagen sponge, and growth factor in alginate capsule (25 μL system). (D) Scaffold and protein implanted in defect area. BSA, bovine serum albumin; BMP, bone morphogenetic protein.

The efficacy of the alginate–collagen scaffold system for protein delivery was evaluated (Fig. 1C). The cumulative release curve showed that the BSA was released completely in 10 h (Fig. 1B). After confirming the effectiveness of this system, BMP-4 was delivered into the defect area in vivo.

Effects of growth factors on cartilage differentiation of MSCs and chondrocytes

At a seeding density of 300 cells/cm², MSCs were exposed to BMP-4 (10 ng/mL)³⁷ or BMP-7 (10 ng/mL)^38,39 for 3 days. The expression levels of type II collagen and Sox9 genes in MSCs were higher in the BMP-4 group than those in the BMP-7 group (Fig. 2A, C).

FIG. 2.

(A) Type II collagen (Col2), aggrecan (Agn), Sox9, and type X collagen (Col10) mRNA expression in rabbit mesenchymal stromal cells after culture with BMP-4 (BMP4; 10 ng/mL) or BMP-7 (BMP7; 10 ng/mL) or without treatment (Control) for 3 days. (B) Type II collagen (Col2), aggrecan (Agn), Sox9, and FGFr2 mRNA expression levels in rabbit chondrocytes after culture with BMP-4 (BMP4; 10 ng/mL) or BMP-7 (BMP7; 10 ng/mL) or without treatment (Control) for 3 days. (C) Polymerase chain reaction bands of type II collagen (Col2), aggrecan (Agn), Sox9, and type X collagen (Col10) in rabbit mesenchymal stromal cells. (D) Polymerase chain reaction bands of type II collagen (Col2), aggrecan (Agn), Sox9, and FGFr2 expression in rabbit chondrocytes. FGFr2, fibroblast growth factor receptor 2.

After 3 days of exposure to BMP-4 (10 ng/mL) or BMP-7 (10 ng/mL), chondrocyte expression of the Agn gene was upregulated. However, the expression levels of Col2, Sox9, and Col10 did not differ in the induced and noninduced chondrocytes. The genes for the FGF receptors FGFr1 and FGFr3 were not expressed in chondrocytes with or without BMP-4 or BMP-7 (data not shown). The FGFr2 gene was expressed in all groups, and the BMP-4 treatment group had the highest level (Fig. 2B, D).

Macroscopic observations

Gross examination of knee joints showed no abrasion on the opposing articulating surface and no inflammation at both 6 and 12 weeks. The defect remained empty in small parts at 6 weeks after transplantation, and gross examination of the cartilage defect at 6 weeks revealed glossy white, well-integrated, repaired tissue in the BMP-4 treatment group. Treated regions in the scaffold alone group and the control group appeared patchy and only moderately well integrated with the surrounding normal cartilage (Fig. 3A–F).

FIG. 3.

(A–F) Macrophotographs showing the defects in the three groups at 6 weeks (upper panels) and 12 weeks (lower panels) after surgery. (A, D) Full osteochondral defect group (group I); (B, E) collagen scaffold treatment group (group II); (C, F) scaffold and BMP-4 treatment group (group III). Scale bars: 5 mm. (G) ICRS scores of groups I, II, and III at 6 and 12 weeks after surgery (maximum score = 14). Values are mean ± standard deviation. ICRS, International Cartilage Repair Society. Color images available online at www.liebertonline.com/ten.

Twelve weeks after transplantation, the original defect in the BMP-4 group contained glossy white repaired tissue that appeared to be well integrated with the surrounding tissues (Fig. 3D–F). According to the ICRS scores from macroscopic observations, the average scores in the BMP-4–treated group (8.11 ± 1.71 at 6 weeks, 10.75 ± 0.88 at 12 weeks) were higher than the other groups (scaffold: 6.83 ± 0.70 at 6 weeks, 10.56 ± 0.51 at 12 weeks; control: 3.17 ± 1.18 at 6 weeks, 8.78 ± 1.02 at 12 weeks) (Fig. 3G).

Histological examination

At 6 weeks after transplantation, the joint surface of the defect in group I (n = 3) was filled with fibrous tissue (Fig. 4A, D, H, K). In group II (n = 3), the joint surface of the defect was repaired with a mixture of fibrous tissue and cartilage-like tissue as shown by hematoxylin and eosin and safranine-O staining. New bone formation was found at the subchondral defect (Fig. 4B, E, I, L). And in group III (n = 3) the amounts of chondrocyte-like cells and cartilage-like extracellular matrix were greater than those in group II (Fig. 4C, F, J, M). The subchondral space of both treated groups was filled with fibrocartilage-like tissue rather than bone. This suggests that the collagen scaffold is able to protect space for cartilage formation by decreasing the ingrowth of new bone tissue. All samples were evaluated by the ICRS scale (Table 1, Fig. 5A). The average score was 3.33 ± 1.154 in group I, 11 ± 5.291 in group II, and 13 ± 4.358 in group III (Fig. 5B).

FIG. 4.

Histological sections from the three groups at 6 weeks after surgery, stained with hematoxylin and eosin (A–F) and safranine-O (H–M). (A, D, H, K) Full osteochondral defect group (group I); (B, E, I, L) collagen scaffold treatment group (group II); (C, F, J, M) scaffold and BMP-4 treatment group (group III). (A–C, H–J) Original magnification × 40; scale bar: 500 μm. (D–F, K–M) Original magnification × 200; scale bar: 100 μm. Open box of the middle column indicates the area shown in the under column with higher magnification. The edge of the defect is indicated with a black arrow. Color images available online at www.liebertonline.com/ten.

FIG. 5.

(A) Percentage of cartilage tissue in the area of defect from the three groups at 6 weeks after surgery. Values represent mean ± standard deviation (***p < 0.05 vs. group I, ^###p < 0.05 vs. group II). (B) ICRS scores for all samples from the three groups at 6 weeks after surgery.

At 12 weeks after transplantation, the joint surface of the defect in group I (n = 2, two samples lost) was almost filled with fibrous tissue and a little cartilage-like tissue occurred at the margins. The subchondral space was filled with mature spongy bone (Fig. 6A, D, H, K). Group II had larger amounts of cartilage-like tissue (Fig. 6B, E, I, L). Group III had the greatest amount of cartilage-like tissue, which not only filled the surface but also showed growth into the central part of the defect. Bony tissue from subchondral area almost bridged over the defect in both treated groups and was denser in group III (Fig. 6C, F, J, M). The average ICRS score was 10 ± 2.828 in group I, 12.25 ± 3.304 in group II, and 15.25 ± 1.893 in group III (Fig. 7B).

FIG. 6.

Histological sections from the three groups at 12 weeks after surgery, stained with hematoxylin and eosin (A–F) and safranine-O (H–M). (A, D, H, K) Full osteochondral defect group (group I); (B, E, I, L) collagen scaffold treatment group (group II); (C, F, J, M) scaffold and BMP-4 treatment group (group III). (A–C, H–J) Original magnification ×40; scale bar: 500 μm. Open box of the middle column indicates the area shown in the under column with higher magnification. The edge of the defect is indicated with a black arrow. (D–F, K–M) Original magnification × 200; scale bar: 100 μm. Color images available online at www.liebertonline.com/ten.

FIG. 7.

The percentage of cartilage tissue in the area of the defect was calculated based on the area of positive safranine-O staining (Olympus; DP71). At 6 weeks, the percentage of cartilage tissue in group III was 81.5% ± 16.92%, which was much higher than the 7.96% ± 1.89% in group I and 20.87% ± 5.15% in group II (p < 0.05; Fig. 5A). At 12 weeks, the percentages of cartilage tissue in the defects from groups I, II, and III markedly increased to 28.91% ± 5.15%, 43.41% ±5.447%, and 100% ± 0%, respectively (Fig. 7A). The differences between each pair of groups were statistically significant (p < 0.05 vs. group I, p < 0.05 vs. group II).

Biomechanical evaluation

From the indentation test, Young's modulus of repaired tissues from the three groups (12 weeks) was determined and compared, and the tissues from normal rabbit knee joints were used as normal controls (Fig. 8). At 12 weeks, the compressive modulus of the repaired tissue in groups II (0.14 ± 0.03 MPa) and III (0.19 ± 0.05 MPa) showed greater improvement than specimens from group I (0.086 ±0.012 MPa) (p < 0.05). But the modulus of repaired tissue in both groups II and III was inferior to that of normal cartilage (0.55 ± 0.01 MPa) (p < 0.05).

FIG. 8.

Biomechanical analysis of repaired tissues at 12 weeks after surgery. Values represent mean ± standard deviation (n = 5 in all groups). Statistically significant differences were found between the full osteochondral defect group (group I) and the collagen scaffold treatment group (group II) (***p < 0.05), and between the scaffold treatment group (group II) and the scaffold plus BMP-4 treatment group (group III) (***p < 0.05, ^###p < 0.05 vs. group I).

Discussion

This study demonstrated that BMP-4 is more potent than BMP-7 for cartilage differentiation of MSCs and chondrocytes, as evidenced by higher cartilage-specific matrix gene expression. Moreover, this study is the first to demonstrate that BMP-4 protein improves articular cartilage repair. In all, these findings provide important information for developing a new regeneration strategy for cartilage diseases.

Endogenous bone marrow MSCs and articular chondrocytes are two of the major cell types that contribute to articular cartilage repair and regeneration in situ. So, culturing MSCs and chondrocytes is a valuable system for evaluating the effects of growth factors in the context of cartilage repair. Our findings relating to cartilage differentiation of MSCs and dedifferentiated chondrocytes serves as a basis for the choice of chondrogenesis factors.

BMP-4 is potent in maintaining the chondrocyte phenotype

In our chondrocyte culture system, the expression levels of the aggrecan, but not the type X collagen genes, were upregulated by BMP-4 treatment, whereas BMP-7 had no effect. The type II collagen and Sox9 genes showed the same effects as the control group. This suggests that BMP-4 plays positive roles in maintaining the chondrogenic phenotype by enhancing the matrix gene (aggrecan), maintaining the expression of cartilage matrix production genes (collagen II and Sox9), and preventing hypertrophic matrix synthesis (collagen X).^40,41

Interestingly, the expression level of the FGFr2 gene was higher in BMP-4–treated cells. This suggests that the FGF signal pathway might be involved in the maintenance of the chondrocyte phenotype by BMP-4. The FGF signal pathway is a regulator of mesenchymal differentiation and skeletal patterning along the proximodistal axis of the limb bud⁴² in embryonic development. FGFr2 is important for both chondrogenesis and osteogenesis in the development of the musculoskeletal system.⁴³ Also, FGFr2 is expressed mainly at sites of precartilage condensation during limb development in vivo and in vitro.⁴⁴ So, higher expression of FGFr2 in this study further implicates its role in the chondral-lineage differentiation induced by BMP-4.

BMP-4 is potent for inducing cartilage differentiation of MSCs

MSCs are the most promising seed cells for cartilage tissue engineering and in situ cartilage repair. The responses and activities of MSCs provide crucial evidence for the choice of treatment for articular cartilage repair. In our MSC culture system, the expression levels of type II collagen and aggrecan genes in MSCs were much higher in the BMP-4 group than in the BMP-7 group. This suggests that BMP-4 is more efficient in inducing the cartilage differentiation of MSCs. BMP-7, also named as osteogenic protein-1, has been used in a clinical trial for bone nonunion treatment but with limited success. Also it has been investigated for chondrogenesis, but the conclusion is controversial in previous studies.^28,39 This may be due to the weak effect of BMP-7 on chondrogenesis as shown in this study. Moreover, it was found that BMP-7 efficiently promotes adipogenesis⁴⁵ and regulates other cell functions.^46,47 This evidence, together with our findings, suggests that BMP-7 is less appropriate for cartilage differentiation.

On the other hand, it is worthy of note that expression of the type X collagen gene was not upregulated in BMP-4 and BMP-7–treated MSCs. It is known that in cartilage calcification, chondrocyte hypertrophy is associated with a shift from type II to type X collagen expression. Type X gene upregulation indicates a hypertrophic process, which results in apoptosis and ossification.⁴⁸ So, the findings of this study suggest that BMP-4 not only efficiently induces cartilage differentiation but also is unlikely to result in cartilage calcification.

BMP-4 and collagen scaffold promote articular cartilage defect repair in vivo

The knee joint cartilage defect in rabbits has been used as an animal model to evaluate the regenerative capability of new treatments.^7,25,28 This study showed that BMP-4 combined with the bilayer scaffold improved cartilage defect repair in this model. This is consistent with previous findings that transfection of the BMP-4 gene improves articular cartilage defect repair.²⁷ Our experiment showed that direct use of BMP-4 works as well for cartilage repair. This is the first report of the use of BMP-4 to heal cartilage without a viral vector. It is known that the application of protein can prevent unpredictable biological side effects.²⁵ The finding that BMP-4 has the same effect as gene transfection on cartilage repair provides evidence in support of the translation from bench to bedside.

The effective dose of growth factors is a major issue when using them for tissue repair and regeneration. Previous studies showed that when transfected MSCs express BMP-4 at 1 ng/mL, these cells perform well in cartilage defect repair.⁴⁹ The effective dose of BMPs in vivo has been studied in an 8 mm rat calvarial bone defect model, and no significant difference in bone formation was found between 2.5 and 5 mg of BMP-4 per defect.^50–52 This suggests that these concentrations are greater than the minimum effective dose. Other in vitro research reported that a lower dose (10 ng/mL) of BMP-4 stimulates cartilage formation, whereas a larger dose (100 ng/mL) induces bone formation,³⁷ which indicates a dose-dependency of BMP-4 for bone and cartilage formation. In this study, 50 μL of BMP-4 at 250 ng/mL was effective for improving cartilage repair in vivo, far less than the microgram-level dose for bone repair in vivo.⁵¹ It is a limitation of this study that the titration of BMP-4 for cell differentiation in vitro and cartilage repair in vivo was not carried out. Further research is warranted to investigate the dose–response curve of BMP-4 for cartilage repair. However, the findings are solid in supporting the concept that BMP-4 in the protein form is efficient for cartilage differentiation and repair.

Scaffold for cartilage repair with BMP-4

Collagen matrix has been used as an efficient cell delivery vehicle for clinical cartilage repair and is well known as matrix-induced ACI technology.⁵³ Also, type I collagen has been successfully used as a carrier to deliver BMPs to osteochondral defects in animal models. BMP-2 adsorbed onto a type I collagen sponge enhances healing of osteochondral lesions in rabbits.⁵⁴ In this study, 1.2% alginate gel was used to combine BMP-4 protein onto the bilayer collagen sponge scaffold. As alginate is able to induce the chondrogenic differentiation of MSCs,⁴⁰ it may not only play the role of vehicle for growth factors, but also act as an inducer of chondrogenic differentiation. Unlike the long-term effect of using transgenic means of BMP delivery, the protein delivery system used in this study lasted for only 10 h in vitro, which is consistent with the findings from previous studies of the alginate release system.^32,33 However, the release condition in vivo is very different from that of in vitro in which there is daily medium exchange, so the growth factor can be maintained at the location for longer time. Moreover, the results of the in vitro MSC differentiation experiments showed that a single addition of BMP-4 into the culture medium is enough to initiate 2–3 times higher cartilage gene expression. This implies that short-time exposure of cells to BMP-4 is functional. The positive findings of the in vivo experiments together with our in vitro results establish the potential of BMP-4 for cartilage repair and the feasibility of the alginate protein delivery system.

In addition to serving as a carrier, the matrix also serves as a scaffold for tissue repair. The type I collagen sponge used in this study increased the surface area of repair tissue without improving either thickness or histological characteristics. The ability of the scaffold alone to improve the quantity of repair tissue without greatly affecting its quality implies that the scaffold alone is not enough for cartilage regeneration.

Conclusion

In summary, this study demonstrated for the first time that BMP-4 is more potent than BMP-7 in inducing cartilage differentiation of MSCs and chondrocytes. The combination of BMP-4 and a bilayer scaffold improves articular cartilage repair. These findings provide useful information for the future development of a BMP-4–based strategy to stimulate in situ cartilage repair and extend the therapeutics of cartilage diseases.

Footnotes

Acknowledgments

This work was supported by grants from NSFC (30600301, 30600670, U0672001), Zhejiang Province (R206016, 2006CB084, Y2080141), MOE (J20070258, 2008DFB30090), and Foundation of Zhejiang Provincial Key Medical Discipline (Medical Tissue Engineering).

Disclosure Statement

The authors indicate no potential conflicts of interest.

References

Furman

B.D.

, Olson

S.A.

, Guilak

The development of posttraumatic arthritis after articular fracture. J Orthop Trauma, 20:719 2006.

Hunziker

E.B.

Articular cartilage repair: basic science and clinical progress. A review of the current status and prospects. Osteoarthritis Cartilage, 10:432 2002.

Dzioba

R.B.

The classification and treatment of acute articular cartilage lesions. Arthroscopy, 4:72 1988.

Matsusue

, Yamamuro

, Hama

Arthroscopic multiple osteochondral transplantation to the chondral defect in the knee associated with anterior cruciate ligament disruption. Arthroscopy, 9:318 1993.

LaPrade

R.F.

, Swiontkowski

M.F.

New horizons in the treatment of osteoarthritis of the knee. JAMA, 281:876 1999.

Gillogly

S.D.

, Myers

T.H.

, Reinold

M.M.

Treatment of full-thickness chondral defects in the knee with autologous chondrocyte implantation. J Orthop Sports Phys Ther, 36:751 2006.

Buma

, Pieper

J.S.

, van Tienen

, van Susante

J.L.

, van der Kraan

P.M.

, Veerkamp

J.H.

, van den Berg

W.B.

, Veth

R.P.

, van Kuppevelt

T.H.

Cross-linked type I and type II collagenous matrices for the repair of full-thickness articular cartilage defects—a study in rabbits. Biomaterials, 24:3255 2003.

Wang

, Grogan

S.P.

, Rieser

, Winkelmann

, Maquet

, Berge

M.L.

, Mainil-Varlet

Tissue engineering of biphasic cartilage constructs using various biodegradable scaffolds: an in vitro study. Biomaterials, 25:3681 2004.

, Gao

, Gong

, Shen

Cartilage tissue engineering PLLA scaffold with surface immobilized collagen and basic fibroblast growth factor. Biomaterials, 26:1253 2005.

10.

Chen

, Sato

, Tanaka

, Tateishi

Preparation of a biphasic scaffold for osteochondral tissue engineering. Mater Sci Eng C, 26:118 2006.

11.

Sherwood

J.K.

, Riley

S.L.

, Palazzolo

, Brown

S.C.

, Monkhouse

D.C.

, Coates

, Griffith

L.G.

, Landeen

L.K.

, Ratcliffe

A three-dimensional osteochondral composite scaffold for articular cartilage repair. Biomaterials, 23:4739 2002.

12.

Oliveira

J.M.

, Rodrigues

M.T.

, Silva

S.S.

, Malafaya

P.B.

, Gomes

M.E.

, Viegas

C.A.

, Dias

I.R.

, Azevedo

J.T.

, Mano

J.F.

, Reis

R.L.

Novel hydroxyapatite/chitosan bilayered scaffold for osteochondral tissue-engineering applications: scaffold design and its performance when seeded with goat bone marrow stromal cells. Biomaterials, 27:6123 2006.

13.

Ueblacker

, Wagner

, Vogt

, Salzmann

, Wexel

, Kruger

, Plank

, Brill

, Specht

, Hennig

, Schillinger

, Imhoff

A.B.

, Martinek

, Gansbacher

In vivo analysis of retroviral gene transfer to chondrocytes within collagen scaffolds for the treatment of osteochondral defects. Biomaterials, 28:4480 2007.

14.

Lee

, Lee

, Kim

H.Y.

, Son

Comparison of articular cartilage with costal cartilage in initial cell yield, degree of dedifferentiation during expansion and redifferentiation capacity. Biotechnol Appl Biochem, 48:149 2007.

15.

Holland

T.A.

, Mikos

A.G.

Advances in drug delivery for articular cartilage. J Control Release, 86:1 2003.

16.

Bobacz

, Gruber

, Soleiman

, Graninger

W.B.

, Luyten

F.P.

, Erlacher

Cartilage-derived morphogenetic protein-1 and -2 are endogenously expressed in healthy and osteoarthritic human articular chondrocytes and stimulate matrix synthesis. Osteoarthritis Cartilage OARS, 10:394 2002.

17.

van Beuningen

H.M.

, van der Kraan

P.M.

, Arntz

O.J.

, van den Berg

W.B.

Transforming growth factor-beta 1 stimulates articular chondrocyte proteoglycan synthesis and induces osteophyte formation in the murine knee joint. Lab Invest, 71:279 1994.

18.

van Beuningen

H.M.

, Glansbeek

H.L.

, van der Kraan

P.M.

, van den Berg

W.B.

Osteoarthritis-like changes in the murine knee joint resulting from intra-articular transforming growth factor-beta injections. Osteoarthritis Cartilage OARS, 8:25 2000.

19.

Holland

T.A.

, Bodde

E.W.

, Cuijpers

V.M.

, Baggett

L.S.

, Tabata

, Mikos

A.G.

, Jansen

J.A.

Degradable hydrogel scaffolds for in vivo delivery of single and dual growth factors in cartilage repair. Osteoarthritis Cartilage OARS, 15:187 2007.

20.

Lee

, Kim

J.H.

, Jo

C.H.

, Seong

S.C.

, Lee

J.C.

, Lee

M.C.

Effect of serum and growth factors on chondrogenic differentiation of synovium-derived stromal cells. Tissue Eng Part A, 15:3401 2009.

21.

Reddi

A.H.

Role of morphogenetic proteins in skeletal tissue engineering and regeneration. Nat Biotechnol, 16:247 1998.

22.

Issack

P.S.

, DiCesare

P.E.

Recent advances toward the clinical application of bone morphogenetic proteins in bone and cartilage repair. Am J Orthop, 32:429 2003.

23.

Wang

, Wei

, Zhu

, Zhang

, Shen

, Xing

, O'Keefe

R.J.

, Chen

Bone morphogenetic protein 2 activates Smad6 gene transcription through bone-specific transcription factor Runx2. J Biol Chem, 282:10742 2007.

24.

Miljkovic

N.D.

, Cooper

G.M.

, Marra

K.G.

Chondrogenesis, bone morphogenetic protein-4 and mesenchymal stem cells. Osteoarthritis Cartilage OARS, 16:1121 2008.

25.

Zhang

, Zheng

, Liu

, Ma

, Lin

, Lang

, Fu

, Zhang

, Ma

, Chen

, Zhou

, Ao

The synergistic effects of microfracture, perforated decalcified cortical bone matrix and adenovirus-bone morphogenetic protein-4 in cartilage defect repair. Biomaterials, 29:4616 2008.

26.

Shintani

, Hunziker

E.B.

Chondrogenic differentiation of bovine synovium: bone morphogenetic proteins 2 and 7 and transforming growth factor beta1 induce the formation of different types of cartilaginous tissue. Arthritis Rheum, 56:1869 2007.

27.

Kuroda

, Usas

, Kubo

, Corsi

, Peng

, Rose

, Cummins

, Fu

F.H.

, Huard

Cartilage repair using bone morphogenetic protein 4 and muscle-derived stem cells. Arthritis Rheum, 54:433 2006.

28.

Kuo

A.C.

, Rodrigo

J.J.

, Reddi

A.H.

, Curtiss

, Grotkopp

, Chiu

Microfracture and bone morphogenetic protein 7 (BMP-7) synergistically stimulate articular cartilage repair. Osteoarthritis Cartilage OARS, 14:1126 2006.

29.

Lin

, Zhou

, Wei

, Hou

, Zhao

, Fu

, Zhang

, Yu

Articular cartilage repair using dedifferentiated articular chondrocytes and bone morphogenetic protein 4 in a rabbit model of articular cartilage defects. Arthritis Rheum, 58:1067 2008.

30.

Pieper

J.S.

, Oosterhof

, Dijkstra

P.J.

, Veerkamp

J.H.

, van Kuppevelt

T.H.

Preparation and characterization of porous crosslinked collagenous matrices containing bioavailable chondroitin sulphate. Biomaterials, 20:847 1999.

31.

Wang

M.C.

, Pins

G.D.

, Silver

F.H.

Collagen fibres with improved strength for the repair of soft tissue injuries. Biomaterials, 15:507 1994.

32.

Lingyun Chen

M.S.

Effect of preparation conditions on the nutrient release properties of alginate–whey protein granular microspheres. Eur J Pharm Biopharm, 65:354 2007.

33.

Moebus

, Siepmann

, Bodmeier

Alginate-poloxamer microparticles for controlled drug delivery to mucosal tissue. Eur J Pharm Biopharm, 72:42 2009.

34.

Mainil-Varlet

, Aigner

, Brittberg

, Bullough

, Hollander

, Hunziker

, Kandel

, Nehrer

, Pritzker

, Roberts

, Stauffer

Histological assessment of cartilage repair: a report by the Histology Endpoint Committee of the International Cartilage Repair Society (ICRS). J Bone Joint Surg, 85-A Suppl 2:45 2003.

35.

Chen

A.C.

, Bae

W.C.

, Schinagl

R.M.

, Sah

R.L.

Depth- and strain-dependent mechanical and electromechanical properties of full-thickness bovine articular cartilage in confined compression. J Biomech, 34:1 2001.

36.

Kandel

R.A.

, Grynpas

, Pilliar

, Lee

, Wang

, Waldman

, Zalzal

, Hurtig

Repair of osteochondral defects with biphasic cartilage-calcium polyphosphate constructs in a sheep model. Biomaterials, 27:4120 2006.

37.

Shum

, Wang

, Kane

A.A.

, Nuckolls

G.H.

BMP4 promotes chondrocyte proliferation and hypertrophy in the endochondral cranial base. Int J Dev Biol, 47:423 2003.

38.

Chen

, Vukicevic

, Sampath

T.K.

, Luyten

F.P.

Osteogenic protein-1 promotes growth and maturation of chick sternal chondrocytes in serum-free cultures. J Cell Sci, 108 Pt 1:105 1995.

39.

Neumann

, Endres

, Ringe

, Flath

, Manz

, Haupl

, Sittinger

, Kaps

BMP7 promotes adipogenic but not osteo-/chondrogenic differentiation of adult human bone marrow-derived stem cells in high-density micro-mass culture. J Cell Biochem, 102:626 2007.

40.

Steinert

, Weber

, Dimmler

, Julius

, Schutze

, Noth

, Cramer

, Eulert

, Zimmermann

, Hendrich

Chondrogenic differentiation of mesenchymal progenitor cells encapsulated in ultrahigh-viscosity alginate. J Orthop Res, 21:1090 2003.

41.

Reddi

A.H.

Bone morphogenetic proteins: from basic science to clinical applications. J Bone Joint Surg, 83-A Suppl 1:S1 2001.

42.

, Ornitz

D.M.

FGF signaling regulates mesenchymal differentiation and skeletal patterning along the limb bud proximodistal axis. Development, 135:483 2008.

43.

Yin

, Du

, Li

, Xu

, Chen

, Su

, Zhao

, Qi

, Li

, Xue

, Yang

, Jin

, Deng

, Chen

A Pro253Arg mutation in fibroblast growth factor receptor 2 (Fgfr2) causes skeleton malformation mimicking human Apert syndrome by affecting both chondrogenesis and osteogenesis. Bone, 42:631 2008.

44.

Moftah

M.Z.

, Downie

S.A.

, Bronstein

N.B.

, Mezentseva

, Pu

, Maher

P.A.

, Newman

S.A.

Ectodermal FGFs induce perinodular inhibition of limb chondrogenesis in vitro and in vivo via FGF receptor 2. Dev Biol, 249:270 2002.

45.

Tseng

Y.H.

, Kokkotou

, Schulz

T.J.

, Huang

T.L.

, Winnay

J.N.

, Taniguchi

C.M.

, Tran

T.T.

, Suzuki

, Espinoza

D.O.

, Yamamoto

, Ahrens

M.J.

, Dudley

A.T.

, Norris

A.W.

, Kulkarni

R.N.

, Kahn

C.R.

New role of bone morphogenetic protein 7 in brown adipogenesis and energy expenditure. Nature, 454:1000 2008.

46.

Elshaier

A.M.

, Hakimiyan

A.A.

, Rappoport

, Rueger

D.C.

, Chubinskaya

Effect of interleukin-1beta on osteogenic protein 1-induced signaling in adult human articular chondrocytes. Arthritis Rheum, 60:143 2009.

47.

Cassar

, Nicholls

, Pinto

A.R.

, Li

, Liu

J.P.

Bone morphogenetic protein-7 induces telomerase inhibition, telomere shortening, breast cancer cell senescence, and death via Smad3. FASEB J, 23:1880 2009.

48.

Mueller

M.B.

, Tuan

R.S.

Functional characterization of hypertrophy in chondrogenesis of human mesenchymal stem cells. Arthritis Rheum, 58:1377 2008.

49.

Zhang

, Zheng

, Liu

, Ma

, Lin

, Liang

, Fu

, Zhang

, Ma

, Chen

, Zhou

, Ao

The synergistic effects of microfracture, perforated decalcified cortical bone matrix and adenovirus-bone morphogenetic protein-4 in cartilage defect repair. Biomaterials, 29:4616 2008.

50.

Ahn

S.H.

, Kim

C.S.

, Suk

H.J.

, Lee

Y.J.

, Choi

S.H.

, Chai

J.K.

, Kim

C.K.

, Han

S.B.

, Cho

K.S.

Effect of recombinant human bone morphogenetic protein-4 with carriers in rat calvarial defects. J Periodontol, 74:787 2003.

51.

Pang

E.K.

, Im

S.U.

, Kim

C.S.

, Choi

S.H.

, Chai

J.K.

, Kim

C.K.

, Han

S.B.

, Cho

K.S.

Effect of recombinant human bone morphogenetic protein-4 dose on bone formation in a rat calvarial defect model. J Periodontol, 75:1364 2004.

52.

Jung

U.W.

, Choi

S.Y.

, Pang

E.K.

, Kim

C.S.

, Choi

S.H.

, Cho

K.S.

The effect of varying the particle size of beta tricalcium phosphate carrier of recombinant human bone morphogenetic protein-4 on bone formation in rat calvarial defects. J Periodontol, 77:765 2006.

53.

Zheng

M.H.

, Willers

, Kirilak

, Yates

, Xu

, Wood

, Shimmin

Matrix-induced autologous chondrocyte implantation (MACI): biological and histological assessment. Tissue Eng, 13:737 2007.

54.

Sellers

R.S.

, Zhang

, Glasson

S.S.

, Kim

H.D.

, Peluso

, D'Augusta

D.A.

, Beckwith

, Morris

E.A.

Repair of articular cartilage defects one year after treatment with recombinant human bone morphogenetic protein-2 (rhBMP-2). J Bone Joint Surg, 82:151 2000.