Harnessing an Inhibitory Role of miR-16 in Osteogenesis by Human Mesenchymal Stem Cells for Advanced Scaffold-Based Bone Tissue Engineering

Abstract

MicroRNA (miRNA) therapeutics is increasingly being developed to either target bone-related diseases such as osteoporosis and osteoarthritis or as the basis for novel bone tissue engineering strategies. A number of miRNAs have been reported as potential osteo-therapeutics but no consensus has yet been established on the optimal target. miR-16 has been studied extensively in nonosteogenic functions and used as functionality reporter target in the development of nonviral miRNA delivery platforms. This study hypothesized that miR-16 may also play an inhibitory role in osteogenesis due to its ability to directly target Smad5 and AcvR2a. This study thus aimed to assess the potential of miR-16 inhibition to increase osteogenesis in human mesenchymal stem cells (hMSCs) using a previously established miRNA delivery platform composed of nanohydroxyapatite (nHA) particles as nonviral vectors in combination with collagen-nHA scaffolds designed specifically for bone repair. Initial results showed that antagomiR-16 delivery efficiently increased the relative levels of both putative targets and Runx2, the key transcription factor for osteogenesis, while also increasing osteocalcin levels. Furthermore, significant increases in mineral calcium deposition by hMSCs were found in both monolayer and most importantly in scaffold-based osteodifferentiation studies, ultimately demonstrating that miR-16 inhibition further enhances the therapeutic potential of a scaffold with known potential for bone repair applications and thus holds significant therapeutic potential as a novel bone tissue engineering strategy. Furthermore, we suggest that harnessing the additional functions known to miR-16 by incorporating either its enhancers or inhibitors to tissue-specific tailored scaffolds provides exciting opportunities for a diverse range of therapeutic indications.

Introduction

MicroRNAs (miRNAs) are endogenous RNA molecules involved in posttranscriptional gene regulation by both perfect and partial sequence complementarity binding to the untranslated region of messenger (m)RNA targets. Thus, miRNAs are capable of binding to multiple mRNA targets and are postulated to inhibit the protein expression of entire gene cohorts.^1–5 The availability of synthetic enhancers (mimics) or inhibitors (antagomiRs) has triggered the investigation of the potential of miRNA therapeutics. Hence, miRNA therapeutics is increasingly proposed as a novel strategy to treat diseases such as osteoporosis and osteoarthritis^6,7 or to provide improved bone tissue engineering strategies targeting a global market valued in 2015 at $2.5 billion.^8,9 Recently, a selection of miRNAs have been collectively identified to influence osteogenesis¹⁰ and it has also been reported that, dependent on cell types and species, particular miRNAs can adopt distinct roles and functions.^11–13 Therefore, control of function specificity remains key for the application of miRNA therapeutics and a consensus regarding the optimal target remains elusive.

One strategy to control miRNA function specificity is the application of a localized and tissue-targeted delivery system.¹⁴ Previously within our laboratory, porous collagen scaffolds have been targeted to bone tissue repair by incorporating different phases and particulate forms of hydroxyapatite (HA).^15,16 These composite collagen-HA scaffolds have significant bone healing efficacy in small and large animals.^17–22 These scaffolds have been further utilized as delivery platforms for plasmid (p)DNA encoding bone morphogenetic protein (BMP)-2 and vascular endothelial growth factor (VEGF)^23–25 to enhance bone repair. One variant, a coll-nanoHA (nHA) scaffold, has recently proven effective in delivering reporter GAPDH-silencing miR-mimics and miR-16 inhibitors²⁶—targets used to demonstrate proof of concept without therapeutic indication. However, when used to deliver an inhibitor for the known antiosteogenic miR-133a, this scaffold platform also demonstrated bone repair efficacy²⁷ (Mencía Castaño et al. 2015, Under Revision). In this study, we sought to answer the question as to whether the highly effective miR-16 inhibition we previously observed might provide a novel therapeutic to improve osteogenesis by human mesenchymal stem cells (hMSCs).

miR-16 has been studied extensively²⁸ and implicated in ∼50 different pathologies spanning from different cancer types^29–33 to the progression of viral,³⁴ bacterial,³⁵ and parasitic infections³⁶ and the activity of the innate immune system,³⁷ to the function of the respiratory epithelium³⁸ and even to the transport of neurotransmitters such as serotonin³⁹ or several neurological diseases such as Parkinson's⁴⁰ or Alzheimer's.⁴¹ miR-16 has also a well-established antiangiogenic role^42,43 and has been found increased in rheumatoid arthritis patients versus healthy controls,^44,45 while a downregulation was seen in odontogenic keratocysts⁴⁶ and osteosarcoma.^47,48 Currently, there is no defined role for miR-16 in osteogenesis, although Eguchi et al. designed miR-16 as a stemness maintenance marker that deterred osteocyte maturation in MSC osteogenesis.⁴⁹

Interestingly, studies at the developmental⁵⁰ or genome-wide screening level⁵¹ have pointed at two targets that could link miR-16 to osteogenesis: small mothers against decapentaplegic (Smad)-5 and activin receptor (AcvR)-2a involved, respectively, in BMP and nodal/transforming growth factor (TGF)-β/activin signaling. While both of these signaling pathways are involved in multiple developmental processes, they are also tightly related to MSC osteogenesis. A direct miR-16::Smad5 interaction has been reported at a proteomic level in HeLa cells,⁵¹ and the implication of miR-16 in BMP signaling was shown in mouse bone cells using quantitative polymerase chain reaction (qPCR).⁵² Finally, the direct miR-16::AcvR2a targeting was demonstrated in a study performed in the human hepatocarcinoma cell line HepG2 and in Xenopus embryos.⁵⁰ If miR-16 inhibits Smad5 and AcvR2a, which play a positive role in osteogenesis, we hypothesized that treatment with antagomiR-16 may in turn enhance both of these targets and thus promote osteogenesis by MSCs. This study thus aimed to elucidate the inhibitory role of miR-16 in osteogenesis and subsequently assess the potential of harnessing miR-16 inhibition with the nonviral nHA delivery system, to ultimately produce antagomiR-16-loaded collagen-nHA (coll-nHA) scaffolds with potential as novel off-the-shelf platforms for improved bone tissue engineering. Specifically, we first aimed to establish the role of miR-16 in osteogenesis via bioinformatic analysis, to then determine the ability of nHA-based antagomiR-16 delivery to hMSCs to effectively enhance the level of the two putative direct targets, Smad5 and AcvR2a, and most importantly assess the ability of this treatment to improve osteogenesis not only in the monolayer culture but also when antagomiR-16 is delivered using the coll-nHA scaffold as off-the-shelf three-dimensional (3D) platforms.

Materials and Methods

Bioinformatic analysis

Bioinformatic analysis provides detailed information about the features of putative and experimentally validated interactions of a given miRNA entry, which allows to establish a suggested function for any given miRNA. To gather knowledge regarding the hypothesis of possible role of miR-16 in osteogenesis, online databases were explored in terms of (1) identification of putative mRNA targets implicated in osteogenesis and (2) identification of validated targets for which the miRNA interaction was assessed in the context of a cellular function different to osteogenesis. A subsequent analysis was carried out to assess (3) homology in the interaction of miRNAs and their relevant direct targets across human, rat, and mouse species, as well as (4) the types of miRNA::mRNA target interaction taking place and (5) occupancy of nearby seed region by other neighboring miRNAs. All of these features were explored by searching the following peer-consulted databases available online: TargetScan,⁵² microRNA.org,⁵³ and miRTarBase.²⁹

hMSC culture, expansion, and osteodifferentiation

Bone marrow aspirates from the iliac crest of healthy human volunteers were used to obtain hMSCs following stern phenotype analysis, in compliance with the procedures approved by the Clinical Research Ethics Committee at University College Hospital Galway and after obtaining written informed consent from all subjects. hMSCs were expanded in low-glucose DMEM supplemented with 10% fetal bovine serum plus 1% penicillin/streptomycin (all from Sigma-Aldrich, Ireland) until passage number 4 for experimentation. For osteodifferentiation assays, standard growth medium was supplemented with 50 μg/mL ascorbic acid-2-phosphate, 10 nM β-glycerophosphate, and 100 nM dexamethasone (all from Sigma-Aldrich). This was administered to cells every 3/4 days until the experiment endpoint. Untreated cells either in standard or osteogenic complete growth medium for the duration of the assay served as controls.

hMSC transfection with antagomiR-16 and nHA particles

To study the effect of miR-16 inhibition on the identified targets and on the ability of hMSCs to undergo osteogenic differentiation, cells were transfected with antagomiR-16 and nHA particles. To do so, 3 × 10⁴ cells per well of a six-well plate were seeded 24 h in advance of the transfection and complexes of antagomiR and nHA particles were prepared immediately before transfection as per a previously established protocol.^26,54 Briefly, a volume of 12 mM sodium phosphate solution containing 0.017% Darvan 821A (RT Vanderbilt, Norwalk,) was added to an equal volume of 20 mM calcium chloride and 0.2 μm sterile filtered to obtain nHA particles; 150 μL nHA particles were then combined with 20 nM miRIDIAN antagomiR-16 or scrambled (scr) antagomiR (Dharmacon-GE Healthcare, United Kingdom) and immediately administered per well. The supplier-designed antagomiRs are based, respectively, on the MIMAT0000069 sequence of hsa-miR-16(−5p) [UAGCAGCACGUAAAUAUUGGCG] and the MIMAT0000039 sequence of cel-miR-67 [UCACAACCUCCUAGAAAGAGUAGA].

Assessment of effective antagomiR-16 transfection, genetic manipulation, and osteogenic gene expression using quantitative real-time polymerase chain reaction

Quantitative real-time PCR (qRT-PCR) analysis was carried out to assess the effective antagomiR-16 transfection at three levels: (1) miR-16, (2) relative mRNA expression of the putative direct miRNA targets Smad5 and AcvR2a, and (3) relative mRNA expression of the key transcription factor for osteogenesis Runx2 and the osteogenesis marker osteocalcin (OCN). Total RNA extraction was done using QIAzol in combination with an miRNeasy kit (Qiagen, United Kingdom) under the manufacturer's instructions. The hsa-miR-16 TaqMan^® microRNA assay was combined with the corresponding TaqMan assay kit (Biosciences, Ireland); QuantiTect Reverse Transcription kit and SYBR Green master mix (Roche, Ireland) were applied in tandem with the following validated predesigned human QuantiTect primer assays (Qiagen): Hs_SMAD5_va.1_SG, Hs_AcvR2a_1_SG, Hs_Runx2_1_SG, and Hs_BGLAP_1_SG. The scr group was set as reference to calculate relative expression, normalized to 18S ribosomal RNA, using the 2^−ΔΔCt method.

Assessment of alkaline phosphatase activity as a biofunctional marker of osteogenesis

To assess the effect of antagomiR-16 delivery on hMSC osteogenesis, we first analyzed the specific biofunctional marker, that is, assessment of alkaline phosphatase (ALP) activity. To do so, the SensoLyte^® pNPP Alkaline Phosphatase Assay Kit (Cambridge Bioscience, United Kingdom) was used under the manufacturer's instructions on samples harvested at 10 days post-treatment. Absorbance of the color product generated was read at 405 nm using a Varioskan Flash plate reader (Thermo Scientific, Ireland) and SkanIt^® for Varioskan software. The Quant-iT PicoGreen dsDNA kit (Invitrogen, Ireland) assay was performed following the manufacturer's instructions to normalize levels of ALP activity to cell number.

Assessment of mineralization as end-stage marker of osteogenesis

To complete the assessment of the effect of antagomiR-16 delivery on hMSC osteogenesis, the presence of calcium deposits in the extracellular matrix (ECM) was studied as an endpoint marker. To visualize calcium deposits, samples were stained directly on culture plates with 2% alizarin red, which stains calcium red. Briefly, samples were fixed using 10% formalin and subjected to alizarin red staining for 5 min, following which excess staining was removed rinsing with distilled water. Microscopic imaging was carried out using an inverted microscope coupled to the LASV4.5 digital imaging system (Leica, Germany). In addition, the Calcium Liquicolor kit (Stanbio Laboratories, United Kingdom) was used under the manufacturer's instructions on samples prepared in 0.5 M HCl; absorbance of the color product generated was read at 595 nm using a Varioskan Flash plate reader as before and also normalized to cell number again using the Quant-iT PicoGreen dsDNA assay.

AntagomiR-16-loaded collagen-nHA scaffolds: preparation, hMSC culture, and mineralization analysis

coll-nHA scaffolds, 1:1 weight ratio of collagen to nHA, were prepared by freeze-drying following a protocol developed in-house, which provides scaffolds of >90% porosity with uniform HA distribution and pores of ∼100 μm.¹⁶ Briefly, suspensions combining collagen type I (Integra Life Sciences) and freshly precipitated nHA particles were homogenized in 0.05 M acetic acid and lyophilized at a −40°C in a VirTis Genesis 25 EL freeze-dryer (Biopharma, United Kingdom). Scaffolds were sterilized by dehydrothermal treatment, cut into 8 × 4 mm discs, and crosslinked for 2 h using 14 mM 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDAC) and 5.5 mM N-hydroxysuccinimide (NHS) (both from Sigma-Aldrich). Coll-nHA scaffolds were then soak-loaded on both sides with a 150 μL total volume of blank nHA particles or complexes of 20 nM antagomiR-16 or -scr. After having loaded the blank particles or antagomiRs onto the coll-nHA scaffolds, hMSCs (passage 5) were seeded dropwise onto both sides of the scaffold at 3 × 10⁵ cells per scaffold. For mineralization assessment, scaffolds were fixed in 10% formalin and cut in serial sections of 7 μm thickness, which were then stained with 2% alizarin red and imaged using a Nikon Eclipse 90i plus DS Ri1 with NIS Elements software (Nikon Instruments, Netherlands). Calcium deposition was also quantified, as described in the section immediately above, where calcium content corresponding to noncultured scaffolds was subtracted from all values.

Statistical analysis

Results were analyzed using one-way ANOVA plus Tukey post hoc tests (n ≥ 3). p < 0.05, p < 0.01, and p < 0.001 were considered significant, highly significant, and very highly significant differences.

Results

Bioinformatic analysis supports a negative role of miR-16 in osteogenesis

Bioinformatic analysis provided the identification of 1273 predicted hit interactions between potential mRNA targets and miR-16 in human species, nine of which were of interest for osteogenesis (Fig. 1a). These target hits were then compared with the database of validated targets, miRTarBase. More than 90% of the total predicted targets have been experimentally validated. Interestingly, among the targets validated in human cells or tissues, the screening identified seven targets of interest for osteogenesis in addition to Smad5 and AcvR2a, including COL4A2 and IGF2R, which also play a positive role in osteogenesis. Taken together, these results support our central hypothesis and suggest an inhibitory role of miR-16 in MSC osteogenesis. Bioinformatic databases were then searched to document further details of the miR-16::Smad5 and miR-16::AcvR2a interactions in terms of homology across human, rat, and mouse (Fig. 1b). First for Smad5, a double number of binding sites was predicted for the interaction in mouse, and rat context percentile scores were lower than those of both human and mice. In relation to AcvR2a, the 7mer-m8 binding type, together with context percentile score, and remaining parameters tested were maintained across species. Taken together, these data confirmed the promising potential of miR-16 to exert multiple functions related with osteogenesis across the three species analyzed in this study.

FIG. 1.

Bioinformatic exploration of miR-16. (a) Predicted (top circle) versus validated (bottom circle) targets related to osteogenesis across human, mouse, and rat for miR-16. Overlapping sections of internal circles indicate that validation has been reported in both species. (b) miRNA:target interaction for (i) miR-16 and AcvR2a and (ii) miR-16 and Smad5 across hsa, mmu, and rno species. AcvR, activin receptor. Color images available online at www.liebertpub.com/tea

Effective manipulation of intracellular miR-16 level in hMSC was achieved using nHA-based delivery

Manipulation of miR-16 levels with antagomiR-16 treatment during hMSC osteogenic culture proved highly efficient, yielding higher than 90% reduction of miR-16 relative expression levels (Fig. 2a). As a consequence of this efficient inhibition of miR-16, both AcvR2a and Smad5 were increased at the mRNA level when analyzed at day 7 of the osteogenic monolayer culture, achieving, respectively, a 2.54 (±0.55)-fold and 10.92 (±1.12)-fold increase over the antagomiR-scr control, respectively (Fig. 2b, c). These data thus demonstrate for the first time an underlying link between manipulation of intracellular miR-16 levels and increased positive signaling molecules in the BMP and activin signaling pathways in hMSCs undergoing osteogenesis.

FIG. 2.

qPCR analysis of miR-16 manipulation and its effect on putative miR-16 direct targets in hMSCs after 7 days in osteogenic monolayer culture. (a) miR-16 intracellular levels were successfully inhibited, while (b) Smad5 and (c) AcvR2a were significantly increased. Mean+standard deviation. n = 4, *p < 0.05, ***p < 0.001. hMSC, human mesenchymal stem cell; qPCR, quantitative polymerase chain reaction. Color images available online at www.liebertpub.com/tea

AntagomiR-16 treatment enhanced hMSC osteogenic gene expression and ALP activity

Having confirmed that efficient miR-16 inhibition can lead to enhanced relative levels of both Smad5 and AcvR2a, we carried out an evaluation of the downstream effect of this treatment on osteogenic differentiation of hMSCs. Initially at the 7-day time point, Runx2 and OCN mRNA expression was increased to 6.29 (±2.3)-fold and 8.19 (±1.96)-fold, respectively, in comparison with the antagomiR-16 treatment (Fig. 3a, b), supporting that inhibition of miR-16 can have a positive influence in hMSC osteogenesis at the gene level. The biofunctional assessment of osteogenesis by ALP activity quantification showed 11.32- and 8.62-fold higher levels in the antagomiR-16 treatment than in untreated cells and cells treated with blank nHA particles, respectively (Fig. 3c). These levels were also 1.22-fold higher than the antagomiR-scr group, which surprisingly enhanced ALP activity over untreated cells. In summary, this result supported the ability of antagomiR-16 treatment to enhance a panel of osteogenesis markers in hMSCs at the two time points assessed, specifically 7 and 10 days in osteogenic monolayer culture.

FIG. 3.

Analysis of the effect of miR-16 inhibition on osteogenic gene expression and osteogenesis bioactivity. (a) Runx2 and (b) OCN relative expression levels were significantly enhanced at the 7-day time point. Mean+standard deviation, n = 4, *p < 0.05, ***p < 0.001. (c) Quantification of ALP normalized to dsDNA content demonstrated increased ALP activity levels in both antagomiR scr and antagomiR-16 groups compared to untreated cells and blank nHA particles at the 10-day time point. Mean+standard deviation, n = 3, ***p < 0.001. ALP, assessment of alkaline phosphatase; nHA, nanohydroxyapatite. OCN, osteocalcin. Color images available online at www.liebertpub.com/tea

Mineral deposition was enhanced by antagomiR-16 treatment and antagomiR-16-loaded scaffolds

As an endpoint assessment of antagomiR-16 inhibition-mediated osteogenesis, significantly enhanced extracellular calcium deposition was demonstrated in hMSCs treated with antagomiR-16 in monolayer culture (Fig. 4a, b). Originally, alizarin red staining showed consistently abundant presence of calcium deposits in the antagomiR-16 group; in comparison, all control groups showed reduced positive staining, with deposit-free areas alternated with dispersed calcium deposits still evident in the antagomiR-scr control (Fig. 4a). Accordingly, the quantification of calcium levels deposited per cell by monolayer hMSCs demonstrated a significant 3.23-fold increase over untreated cells after antagomiR-16 delivery; while calcium deposition, relative to untreated cells, was progressively increased by the treatment with blank nHA particles or the antagomiR-scr control, this effect was largely surpassed by the antagomiR-16 treatment (Fig. 4b). More importantly, this beneficial effect translated seamlessly to the 3D microenvironment of the antagomiR-16-loaded scaffolds. Alizarin red staining of the 3D samples corroborated the prominent calcium deposition by hMSCs within the antagomiR-16-loaded scaffolds in contrast with the staining-free areas in the antagomiR-scr control scaffolds (Fig. 4d). Correspondingly, calcium quantification per cell confirmed the antagomiR-16 group being highest, at ∼2.42-fold greater than the untreated cells cultured on the antagomiR-free scaffolds. This effect indicated a significant increase versus all other groups tested and was again followed by the progressive increase, relative to untreated cells, across the remaining groups (Fig. 4e). Taken together, the results indicated the potential of antagomiR-16 treatment to enhance calcium mineralization by hMSCs, denoting clear potential of the antagomiR-16-loaded scaffold as an off-the-shelf platform for bone tissue engineering.

FIG. 4.

Analysis of the effect of miR-16 inhibition on mineral deposition in monolayer and 3D osteogenic culture. (a–c) Monolayer osteogenic culture at end time point of 14 days and (d–f) 3D osteogenic culture on antagomiR-loaded coll-nHA scaffolds at end time point of 28 days. (a, d) Alizarin red staining showed increased presence of calcium deposits in the antagomiR-16 treatment group in both monolayer and 3D, scale bar = 200 μm and 100 μm, respectively. (b, e) Calcium normalized to dsDNA content confirmed an increase in calcium deposition after treatment with antagomiR-16 in both monolayer and 3D osteogenic culture. (c, f) dsDNA content quantified for monolayer and 3D culture showed no significant changes with the delivery of either antagomiR-scr or antagomiR-16. Mean+standard deviation, n = 3, NS, nonsignificant, **p < 0.01, ***p < 0.001. 3D, three-dimensional; coll-nHA, collagen-nHA. Color images available online at www.liebertpub.com/tea

Discussion

The controlled delivery of miRNAs has received much attention as novel therapeutics in tissue engineering strategies. However, translating such miRNA therapeutic strategies to the clinic has been limited by poor delivery systems and difficulties reaching consensus on best targets for any given application. This study identified for the first time a negative role of miR-16 in osteogenesis and demonstrated the potential of miR-16 inhibition as an osteotherapeutic by utilizing nHA particles as nonviral vectors in combination with coll-nHA scaffolds designed specifically for bone repair. The study identified a link between miR-16 and osteogenesis by identifying multiple putative targets through bioinformatics and then specifically focusing on two direct targets involved in BMP and activin signaling, that is, Smad5 and AcvR2a, respectively. The results demonstrated that efficient miR-16 inhibition significantly promoted Runx2 and OCN expression as well as ALP activity. Ultimately, antagomiR-16-loaded scaffolds significantly increased mineral calcium deposition by hMSCs, indicating that miR-16 inhibition holds therapeutic potential as a novel bone tissue engineering strategy.

The two putative targets of focus in this study, Smad5 and AcvR2a, were identified in the bioinformatic analysis to present robust characteristics for direct interaction with miR-16, including the presence of multiple seed sites, the high context percentile scores, and the interspecies conserved type of binding and neighboring interacting miRNAs. In addition, beyond the known functions of miR-16,^28–48 the bioinformatic data reported the additional direct interaction of miR-16 with other targets such as IGF2R and COL4A2, beneficial for osteogenesis,⁵⁵ further supporting the negative role of this miRNA in osteogenesis. Following this, the single treatment with antagomiR-16 successfully reduced intracellular miR-16 levels to less than 0.1-fold over 7 days, corroborating the ability of the nonviral nHA particle system to achieve over 90% silencing functionality.²⁶ Subsequently, greater than twofold expression of AcvR2a and Smad5 was demonstrated versus the antagomiR-scr control at the mRNA level, indicating a robust manipulation of the direct gene targets of interest to this study. This is the first time that the interaction between miR-16 and Smad5 or AcvR2a has been assessed at the mRNA level, and this can be interpreted as of high biological relevance considering that the effects of miRNA manipulation are more easily detectable at the protein level than at the mRNA level.^56,57 Moreover, it has been previously reported that antagomiR-16 treatment did not affect intracellular miR-133a levels and vice versa.²⁷ Hence, owing to the specific manipulation of intracellular miRNA levels with this treatment, the efficient increase in mRNA levels of the targets assessed confirmed the ability of nHA-based delivery to mediate the successful genetic manipulation of hMSC osteogenic culture at the posttranscriptional level.

The effects of miR-16 inhibition and upregulation of Smad5 and AcvR2a on downstream hMSC osteogenesis were demonstrated by the markedly increased mRNA levels of Runx2 and OCN (by >6-fold) as well as the enhanced ALP activity. Runx2 and OCN expression is routinely analyzed in osteogenesis studies, together with ALP activity, as they denote the specific commitment of MSCs to the bone-forming lineage. Changes for these genes are generally less than threefold following miRNA delivery with varied delivery vectors, miRNA doses, and cell types.^58–61 However, the present study detected increases more in line with the 2.5- to 10-fold range that have been reported following the delivery of BMP2, activin-receptor like kinase (caALK)-6, or Runx2 pDNA using the popular vector polyethylenimine (PEI),^62–64 which underlines the high effectivity of the nHA-based antagomiR-16 delivery to inducing robust genetic modifications. Regarding ALP activity, the remarkable ∼11-fold increase following antagomiR-16 treatment compared to untreated cells in osteogenic medium was in contrast with a limited ∼1.22-fold increase over the surprising unspecific effect of the antagomiR-scr control group. Other studies have shown that ALP activity was affected by the treatment with scr miRNAs^60,61 and that a substantial (∼30%) overlapping exists with this sequence and >100 human protein-coding genes, which may account for this unexpected effect.²⁷ Taken together, these data confirmed the premise that the specific inhibition of miR-16 with nHA particle-based delivery can enhance a panel of markers for osteogenesis in hMSCs.

Most importantly from a bone repair perspective, a significant increase in calcium deposition with antagomiR-16 was detected at each of the culture conditions assessed: monolayer and antagomiR-loaded scaffolds. Calcium deposition in the ECM during osteogenic culture is regarded as a definite functional marker of both 2D and 3D osteogenesis assays.^{52,60,61,65–71} miR-16 inhibition led to ∼3.5-fold enhanced calcium deposition over untreated cells in monolayer in this study, representing a pronounced effect that surpassed the twofold effect reported for other combinations of miRNA and nonviral vectors in monolayer.^71,72 In the 3D scaffold setting, a ∼2.4-fold increase in calcium deposition was found over the untreated cells cultured on antagomiR-free scaffolds. Of note, limited in vitro studies are available to interpret the effect on calcium deposition observed with the antagomiR-16-loaded scaffolds; this is due to the extended practice of testing the pretransfected cells in monolayer to directly assess in vivo the effect of combining them with the 3D biomaterials.⁹ We have previously combined coll-nHA scaffolds with antagomiR-133a²⁷ or iterations of BMP2/VEGF pDNA^23,24 and reported induced hMSC calcium deposition between 0.8-fold (80%) and ∼2-fold in vitro. Importantly, both systems later proved effective without the addition of external cells in vivo to locally transfect host cells and accelerate bone repair, underlining the high significance of the ∼2.4-fold calcium increase result of this study. In summary, these data demonstrated that miR-16 inhibition using the bone-targeted coll-nHA scaffolds presents significant potential as a novel off-the-shelf strategy for bone tissue engineering.

Importantly, due to the many physiopathological implications of miR-16,^28–48 the fine-tuning of this off-the-shelf platform system to deliver either miR-16 enhancers or inhibitors and target other tissues and pathways offers exciting opportunities in the wide arena of tissue engineering; as examples, miR-16 inhibition in combination with HA-free skin-targeted collagen-based scaffolds for promoting angiogenesis may offer an alternative for enhancing wound healing, while the comparison between scaffolds activating or inhibiting miR-16 poses vast potential for in vitro modeling of multiple types of cancer.

Conclusion

Taken together, the results of this study demonstrated for the first time that miR-16 plays an inhibitory role in osteogenesis, which can be harnessed as a therapeutic and generate novel off-the-shelf platforms for improved bone tissue engineering by delivering antagomiR-16 from an efficient bone-targeted system consisting of nHA particles and coll-nHA scaffolds. We identified the inhibitory role of miR-16 in osteogenesis and demonstrated the successful ability of nHA-based antagomiR-16 delivery to hMSCs to mediate miR-16 inhibition and subsequently enhance the levels of the two direct targets of interest Smad5 and AcvR2a. Ultimately, this nonviral delivery induced the robust increase of a panel of osteogenesis markers along with hMSC-mediated mineralization. Most importantly, we demonstrated the potential of the antagomiR-16-loaded scaffolds as off-the-shelf 3D platforms to improve hMSC osteogenesis, indicating that miR-16 inhibition in combination with the nonviral delivery platform described herein holds significant therapeutic potential as a novel bone repair strategy.

Footnotes

Acknowledgments

Work funded by the European Research Council (ERC) Grant Agreement no. 239685 and 665777 and the BioAT Scholarship funded by the Programme for Research in Third Level Institutions Cycle 5 and the European Regional Development Fund under the 2007–2013 Funds Programme. The authors are thankful to Integra Lifesciences Corporation for providing the collagen for scaffold synthesis, Ms. Georgina Shaw and Dr. J. Mary Murphy at REMEDI NUI Galway for kindly providing hMSCs.

Disclosure Statement

No competing financial interests exist.

References

, Fan

, Liu

, et al. The promotion of bone regeneration through positive regulation of angiogenic-osteogenic coupling using microRNA-26a. Biomaterials, 34, 5048, 2013.

Jacobsen

, Silber

, Harinath

, Huse

J.T.

, Schultz

, and Sander

Analysis of microRNA-target interactions across diverse cancer types. Nat Struct Mol Biol, 20, 1325, 2013.

Mourelatos

, Dostie

, Paushkin

, et al. miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev, 16, 720, 2002.

Bartel

D.P.

MicroRNAs: genomics, biogenesis, mechanism, and function. Cell, 116, 281, 2004.

Lewis

B.P.

, Burge

C.B.

, and Bartel

D.P.

Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell, 120, 15, 2005.

, Li

, Liu

, Yang

, Tan

, and Luo

Targeting miRNAs in osteoblast differentiation and bone formation. Expert Opin Ther Targets, 14, 1109, 2010.

Jensen

E.D.

, Gopalakrishnan

, and Westendorf

J.J.

Regulation of gene expression in osteoblasts. Biofactors, 36, 25, 2010.

Tatkare

Bone grafts and substitutes market global opportunity analysis and industry forecast, 2014–2022. 2014–2022 ed. Portland, OR: Allied Market Research, 2016, pp. 1–10.

Curtin

C.M.

, Mencía Castaño

, and O'Brien

F.J.

Scaffold-based microRNA therapies in regenerative medicine and cancer. Adv Healthc Mater, 7, 2018: 10.1002/adhm.201700695

10.

Kim

K.M.

, and Lim

S.-K.

Role of miRNAs in bone and their potential as therapeutic targets. Curr Opin Pharmacol, 16, 133, 2014.

11.

Rosa

, Spagnoli

F.M.

, and Brivanlou

A.H.

The miR-430/427/302 family controls mesendodermal fate specification via species-specific target selection. Dev Cell, 16, 517, 2009.

12.

Mor

, and Shomron

Species-specific microRNA regulation influences phenotypic variability: perspectives on species-specific microRNA regulation. Bioessays, 35, 881, 2013.

13.

Mor

, Cabilly

, Goldshmit

, et al. Species-specific microRNA roles elucidated following astrocyte activation. Nucleic Acids Res, 39, 3710, 2011.

14.

Sriram

, Sainitya

, Kalyanaraman

, Dhivya

, and Selvamurugan

Biomaterials mediated microRNA delivery for bone tissue engineering. Int J Biol Macromol, 74, 404, 2015.

15.

Gleeson

, Plunkett

, and O'Brien

Addition of hydroxyapatite improves stiffness, interconnectivity and osteogenic potential of a highly porous collagen-based scaffold for bone tissue regeneration. Eur Cell Mater, 20, 218, 2010.

16.

Cunniffe

G.M.

, Dickson

G.R.

, Partap

, Stanton

K.T.

, and O'Brien

F.J.

Development and characterisation of a collagen nano-hydroxyapatite composite scaffold for bone tissue engineering. J Mater Sci Mater Med, 21, 2293, 2010.

17.

Lyons

F.G.

, Al-Munajjed

A.A.

, Kieran

S.M.

, et al. The healing of bony defects by cell-free collagen-based scaffolds compared to stem cell-seeded tissue engineered constructs. Biomaterials, 31, 9232, 2010.

18.

Farrell

, Both

S.K.

, Odörfer

K.I.

, et al. In-vivo generation of bone via endochondral ossification by in-vitro chondrogenic priming of adult human and rat mesenchymal stem cells. BMC Musculoskelet Disord, 12, 31, 2011.

19.

Levingstone

T.J.

, Thompson

, Matsiko

, Schepens

, Gleeson

J.P.

, and O'Brien

F.J.

Multi-layered collagen-based scaffolds for osteochondral defect repair in rabbits. Acta Biomater, 32, 149, 2016.

20.

Cunniffe

G.M.

, Curtin

C.M.

, Thompson

E.M.

, Dickson

G.R.

, and O'Brien

F.J.

Content-dependent osteogenic response of nanohydroxyapatite: an in vitro and in vivo assessment within collagen-based scaffolds. ACS Appl Mater Interfaces, 8, 23477, 2016.

21.

Levingstone

T.J.

, Ramesh

, Brady

R.T.

, et al. Cell-free multi-layered collagen-based scaffolds demonstrate layer specific regeneration of functional osteochondral tissue in caprine joints. Biomaterials, 87, 69, 2016.

22.

David

, Levingstone

T.J.

, Schneeweiss

, et al. Enhanced bone healing using collagen–hydroxyapatite scaffold implantation in the treatment of a large multiloculated mandibular aneurysmal bone cyst in a thoroughbred filly. J Tissue Eng Regen Med, 9, 1193, 2015.

23.

Curtin

C.M.

, Cunniffe

G.M.

, Lyons

F.G.

, et al. Innovative collagen nano-hydroxyapatite scaffolds offer a highly efficient non-viral gene delivery platform for stem cell-mediated bone formation. Adv Mater, 24, 749, 2012.

24.

Curtin

C.M.

, Tierney

E.G.

, Duffy

G.P.

, and O'Brien

F.J.

Combinatorial gene therapy accelerates bone regeneration: non-viral dual delivery of VEGF and BMP2 in a collagen-nanohydroxyapatite scaffold. Adv Healthc Mat, 4, 223, 2015.

25.

Raftery

R.M.

, Mencía Castaño

, Chen

, et al. Translating the role of osteogenic-angiogenic coupling in bone formation: highly efficient chitosan-pDNA activated scaffolds can accelerate bone regeneration in critical-sized bone defects. Biomaterials, 149, 116, 2017.

26.

Mencía Castaño

, Curtin

C.M.

, Shaw

, Murphy

J.M.

, Duffy

G.P.

, and O'Brien

F.J.

A novel collagen-nanohydroxyapatite microRNA-activated scaffold for tissue engineering applications capable of efficient delivery of both miR-mimics and antagomiRs to human mesenchymal stem cells. J Control Release, 200, 42, 2015.

27.

Mencia Castano

, Curtin

C.M.

, Duffy

G.P.

, and O'Brien

F.J.

Next generation bone tissue engineering: non-viral miR-133a inhibition using collagen-nanohydroxyapatite scaffolds rapidly enhances osteogenesis. Sci Rep, 6, 27941, 2016.

28.

Pekarsky

, Balatti

, and Croce

C.M.

BCL2 and miR-15/16: from gene discovery to treatment. Cell Death Differ, 25, 21, 2018.

29.

ISBLab. miRTarBase: the experimentally validated microRNA-target interactions database. In: Department of Biological Science and Technology I.o.B.a.S.B., National Chiao Tung University, ed. miRTarBase Release 45. Hsinchu, Taiwan © ISBLab, 2013. Available at: http://mirtarbase.mbc.nctu.edu.tw/php/index.php (last accessed October 10, 2017).

30.

Renjie

, and Haiqian

MiR-132, miR-15a and miR-16 synergistically inhibit pituitary tumor cell proliferation, invasion and migration by targeting Sox5. Cancer Lett, 356, 568, 2015.

31.

, Ren

, Chen

, et al. miR-16 targets fibroblast growth factor 2 to inhibit NPC cell proliferation and invasion via PI3K/AKT and MAPK signaling pathways. Oncotarget, 7, 3047, 2016.

32.

Fennell

miR-16: expanding the range of molecular targets in mesothelioma. Lancet Oncol, 18, 1296, 2017.

33.

Jones

, Mazirka

, McNurlan

M.A.

, Brink

, and Caso

Inhibition of human prostate cancer growth by mesenchymal stem cells delivering MiR-16. FASEB J, 31, lb177, 2017.

34.

, Yu

, Xiao

, et al. Hepatitis B virus X protein downregulates expression of the miR-16 family in malignant hepatocytes in vitro. Br J Cancer, 105, 146, 2011.

35.

Moon

H.G.

, Yang

, Zheng

, and Jin

miR-15a/16 regulates macrophage phagocytosis after bacterial infection. J Immunol, 193, 4558, 2014.

36.

Chamnanchanunt

, Kuroki

, Desakorn

, et al. Downregulation of plasma miR-451 and miR-16 in Plasmodium vivax infection. Exp Parasitol, 155, 19, 2015.

37.

Wang

, Wang

, Liu

, et al. miR-15a/16 are upreuglated in the serum of neonatal sepsis patients and inhibit the LPS-induced inflammatory pathway. Int J Clin Exp Med, 8, 5683, 2015.

38.

Tamarapu Parthasarathy

, Galam

, Huynh

, et al. MicroRNA 16 modulates epithelial sodium channel in human alveolar epithelial cells. Biochem Biophys Res Commun, 426, 203, 2012.

39.

Baudry

, Mouillet-Richard

, Schneider

, Launay

J.-M.

, and Kellermann

MiR-16 targets the serotonin transporter: a new facet for adaptive responses to antidepressants. Science, 329, 1537, 2010.

40.

Zhang

, and Cheng

miR-16-1 promotes the aberrant α-synuclein accumulation in Parkinson disease via targeting heat shock protein 70. ScientificWorldJournal, 2014, 8, 2014.

41.

Zhang

, Chen

C.F.

, Wang

A.H.

, and Lin

Q.F.

MiR-16 regulates cell death in Alzheimer's disease by targeting amyloid precursor protein. Eur Rev Med Pharmacol Sci, 19, 4020, 2015.

42.

Zhu

, Lu

, Huo

, et al. MicroRNA-16 inhibits feto-maternal angiogenesis and causes recurrent spontaneous abortion by targeting vascular endothelial growth factor. Sci Rep, 6, 35536, 2016.

43.

Wang

, Fan

, Zhao

, et al. miR-16 inhibits the proliferation and angiogenesis-regulating potential of mesenchymal stem cells in severe pre-eclampsia. FEBS J, 279, 4510, 2012.

44.

Feng

Z.-T.

, Li

, Ren

, and Lv

Expression of miR-146a and miR-16 in peripheral blood mononuclear cells of patients with rheumatoid arthritis and their correlation to the disease activity. Eur PMC, 31, 320, 2011.

45.

Filková

, Aradi

, Šenolt

, et al. Association of circulating miR-223 and miR-16 with disease activity in patients with early rheumatoid arthritis. Ann Rheum Dis, 73, 1898, 2014.

46.

Diniz

M.G.

, Gomes

C.C.

, de Castro

W.H.

, et al. miR-15a/16-1 influences BCL2 expression in keratocystic odontogenic tumors. Cell Oncol (Dordr), 35, 285, 2012.

47.

Chen

, Wang

G.-D.

, et al. miR-16 inhibits cell proliferation by targeting IGF1R and the Raf1-MEK1/2-ERK1/2 pathway in osteosarcoma. FEBS Lett, 587, 1366, 2013.

48.

Cai

C.K.

, Zhao

G.Y.

, Tian

L.Y.

, et al. miR-15a and miR-16-1 downregulate CCND1 and induce apoptosis and cell cycle arrest in osteosarcoma. Oncol Rep, 28, 1764, 2012.

49.

Eguchi

, Watanabe

, Hara

E.S.

, Ono

, Kuboki

, and Calderwood

S.K.

OstemiR: a novel panel of microRNA biomarkers in osteoblastic and osteocytic differentiation from mesencymal stem cells. PLoS One, 8, e58796, 2013.

50.

Martello

, Zacchigna

, Inui

, et al. MicroRNA control of Nodal signalling. Nature, 449, 183, 2007.

51.

Selbach

, Schwanhausser

, Thierfelder

, Fang

, Khanin

, and Rajewsky

Widespread changes in protein synthesis induced by microRNAs. Nature, 455, 58, 2008.

52.

TargetScan Release 6.2. In: Computing B.a.R., ed. Cambridge, MA: © 2006–2012 Whitehead Institute for Biomedical Research, 2012. Available at: http://mirtarbase.mbc.nctu.edu.tw/php/index.php (last accessed October 10, 2017).

53.

cBio. MicroRNA.org. In: Computational Biology Center M.S.-K.C.C.M., ed. New York: Memorial Sloan-Kettering Cancer Center™, 2010. Available at: http://34.236.212.39/microrna/home.do (last accessed October 10, 2017).

54.

Cunniffe

G.M.

, O'Brien

F.J.

, Partap

, Levingstone

T.J.

, Stanton

K.T.

, and Dickson

G.R.

The synthesis and characterization of nanophase hydroxyapatite using a novel dispersant-aided precipitation method. J Biomed Mater Res A, 95, 1142, 2010.

55.

Chen

, Zou

, Zhang

R.-X.

, et al. IGF1 potentiates BMP9-induced osteogenic differentiation in mesenchymal stem cells through the enhancement of BMP/Smad signaling. BMB Rep, 49, 122, 2016.

56.

Guo

, Ingolia

N.T.

, Weissman

J.S.

, and Bartel

D.P.

Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature, 466, 835, 2010.

57.

Lim

L.P.

, Lau

N.C.

, Garrett-Engele

, et al. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature, 433, 769, 2005.

58.

Hassan

M.Q.

, Maeda

, Taipaleenmaki

, et al. miR-218 directs a Wnt signaling circuit to promote differentiation of osteoblasts and osteomimicry of metastatic cancer cells. J Biol Chem, 287, 42084, 2012.

59.

, Hassan

M.Q.

, Jafferji

, et al. Biological functions of miR-29b contribute to positive regulation of osteoblast differentiation. J Biol Chem, 284, 15676, 2009.

60.

Kim

Y.J.

, Bae

S.W.

, Yu

S.S.

, Bae

Y.C.

, and Jung

J.S.

miR-196a regulates proliferation and osteogenic differentiation in mesenchymal stem cells derived from human adipose tissue. J Bone Miner Res, 24, 816, 2009.

61.

, Xie

, Liu

, et al. A novel microRNA targeting HDAC5 regulates osteoblast differentiation in mice and contributes to primary osteoporosis in humans. J Clin Invest, 119, 3666, 2009.

62.

Lee

S.J.

, Kang

S.W.

, Do

H.J.

, et al. Enhancement of bone regeneration by gene delivery of BMP2/Runx2 bicistronic vector into adipose-derived stromal cells. Biomaterials, 31, 5652, 2010.

63.

Itaka

, Ohba

, Miyata

, et al. Bone regeneration by regulated in vivo gene transfer using biocompatible polyplex nanomicelles. Mol Ther, 15, 1655, 2007.

64.

Qiao

, Zhang

, Jin

, et al. Using poly(lactic-co-glycolic acid) microspheres to encapsulate plasmid of bone morphogenetic protein 2/polyethylenimine nanoparticles to promote bone formation in vitro and in vivo. Int J Nanomedicine, 8, 2985, 2013.

65.

Kwong

F.N.

, Richardson

S.M.

, and Evans

C.H.

Chordin knockdown enhances the osteogenic differentiation of human mesenchymal stem cells. Arthritis Res Ther, 10, R65, 2008.

66.

Liao

X.B.

, Zhang

Z.Y.

, Yuan

, et al. MiR-133a modulates osteogenic differentiation of vascular smooth muscle cells. Endocrinology, 154, 3344, 2013.

67.

Eskildsen

, Taipaleenmaki

, Stenvang

, et al. MicroRNA-138 regulates osteogenic differentiation of human stromal (mesenchymal) stem cells in vivo. Proc Natl Acad Sci U S A, 108, 6139, 2011.

68.

Baglìo

S.R.

, Devescovi

, Granchi

, and Baldini

MicroRNA expression profiling of human bone marrow mesenchymal stem cells during osteogenic differentiation reveals Osterix regulation by miR-31. Gene, 527, 321, 2013.

69.

Huang

, Zhao

, Xing

, and Chen

MicroRNA-204 regulates Runx2 protein expression and mesenchymal progenitor cell differentiation. Stem Cells, 28, 357, 2010.

70.

Luzi

, Marini

, Sala

S.C.

, Tognarini

, Galli

, and Brandi

M.L.

Osteogenic differentiation of human adipose tissue-derived stem cells is modulated by the miR-26a targeting of the SMAD1 transcription factor. J Bone Miner Res, 23, 287, 2008.

71.

Qureshi

A.T.

, Monroe

W.T.

, Dasa

, Gimble

J.M.

, and Hayes

D.J.

miR-148b eNanoparticle conjugates for light mediated osteogenesis of human adipose stromal/stem cells. Biomaterials, 34, 7799, 2013.

72.

Raisin

, Belamie

, and Morille

Non-viral gene activated matrices for mesenchymal stem cells based tissue engineering of bone and cartilage. Biomaterials, 104, 223, 2016.