SOX - 6,9 -Transfected Adipose Stem Cells to Treat Surgically-Induced Osteoarthritis in Goats

Abstract

The authors developed SOX-6, 9-transfected human adipose stem cells (^{SOX-6, 9}ASCs) to treat osteoarthritis (OA) and tested their effectiveness in arresting OA progression when injected intra-articularly (IA) in a surgically-induced OA caprine model. ^{SOX-6, 9}ASCs demonstrated similar in vitro chondrogenic potential, as determined by proteoglycan production, to ASCs treated with TGF-β₂ and BMP-7 (positive control). In contrast, the messenger RNA (mRNA) expressions of COL2A1 and aggrecan were 3.5-fold (p = 0.004) and 1.4-fold (p = 0.058) higher, respectively, in ^{SOX-6, 9}ASCs than in the positive control. In vivo tracking of injected ^{SOX-6, 9}ASCs in rats demonstrated that these cells disappear from the joint cavity within 2 weeks, suggesting paracrine mode of action. In a surgically-induced goat model of OA, IA ^{SOX-6, 9}ASCs at a dose of 0.6 × 10⁷ best preserved articular cartilage and produced significantly better macroscopic and microscopic scores than negative controls in femoral and tibial articular surfaces. In conclusion, SOX-6, 9-transfection led to in vitro chondrogenesis of ASCs comparable to that achieved by growth factor treatment. IA injection of ^{SOX-6, 9}ASCs in optimal dose reduced the progression of surgically-induced OA in goats. We suggest that ^{SOX-6, 9}ASCs offer a novel potential strategy to treat OA.

Impact Statement

We developed SOX-6, 9-transfected human adipose stem cells (^{SOX-6, 9}ASCs) to treat osteoarthritis (OA). SOX-6, 9-transfection led to in vitro chondrogenesis of adipose stem cells (ASCs) comparable to that achieved by growth factor treatment. Intra-articular injection of SOX-6, 9-transfected ASCs reduced the progression of surgically-induced OA in goats. In vivo tracking of transfected cell suggested paracrine mode of action. We think that SOX-6, 9-transfected ASC provides a novel potential strategy for the treatment of OA.

Introduction

Osteoarthritis (OA), the most common type of arthritis, is characterized by the breakdown and subsequent loss of articular cartilage (AC). Unfortunately, current treatment modalities have several limitations. Conservative treatments, such as nonsteroidal anti-inflammatory drugs, provide symptomatic relief but do not regenerate damaged AC.¹ Microfracture is performed to mobilize endogenous bone marrow cells for tissue repair, but it actually results in the production of fibrous cartilage rather than hyaline cartilage and poor clinical outcomes.² Autologous chondrocyte implantation (ACI), which is used to treat focal defects, is associated with donor site morbidity and disadvantaged in the limited amount of available cells. Thus, ACI is not indicated for the diffuse involvement typical of OA.³ Accordingly, the current standard treatment for advanced OA is joint replacement. However, an artificial joint cannot be used for a lifetime in younger patients, and eventually revision surgery is required. These limitations of current treatment methods have created a need for a cell therapy that can promote AC regeneration, alleviate symptoms, and arrest the progression of OA at an early stage.

SOX-trio (SOX-5, -6, and -9) are transcription factors that belong to the same family of regulatory molecules.⁴ SOX-9 is expressed in all chondrogenic cells except hypertrophic chondrocytes⁵ and binds to and activates other chondrocyte-specific enhancer elements in COL2A1, COL9A1, COL11A2, and aggrecan.^5–7 SOX-5 and SOX-6 are cofactors of SOX-9 that are required for optimal chondrogenesis.^5,8,9 Previous studies have reported on the use of SOX gene transfers to induce chondrogenesis in human embryonic stem cells and fibroblasts and to promote chondrogenesis in murine mesenchymal stem cells (MSCs).^10–12 Moreover, adenoviral cotransfections of SOX-5, -6, and -9 induce the chondrogenic differentiations of MSCs and dermal fibroblasts that normally do not differentiate into cartilage.¹³ In previous studies, we found that the electroporation-mediated transfection of SOX trio genes enhanced the in vitro chondrogenic potentials of bone marrow stem cells (BMSCs)¹⁴ and adipose stem cells (ASCs).¹⁵ We also reported that a porous PLGA scaffold impregnated with plasmid deoxyribose nucleic acid (DNA) containing SOX trio genes promoted in vitro chondrogenesis of ASCs and in vivo regeneration of osteochondral defects.¹⁶ Our group had also shown that implantation of retroviral SOX trio-cotransduced ASCs enhanced cartilage repair and delayed the progression of surgically-induced OA in rats.¹⁷ Encouraged by these results, we sought to devise a SOX gene-transfected stem cell to treat OA.

In previous studies, we transfected BMSCs and ASCs with separate SOX-5, 6, 9 plasmids at the same time.^14–17 However, because it was not possible to confirm whether all three genes had entered the nucleus, we constructed a polycistronic plasmid containing all three genes from which all three genes would be transcribed simultaneously. However, due to very high cell death rates during electroporation encountered when these large plasmids (>20 kb) were transfected into human ASCs (hASCs) (Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/tea), we switched to a two gene (SOX-6 and SOX-9) construct to improve the viability of the transfected cells. Although previous studies have reported that all three genes are required to induce chondrogenesis from nonchondrogenic cells,^4,5,13 a recent study showed that functionally SOX-5 is similar to SOX-6 and that SOX-6 alone can act as a SOX-9 cofactor.¹⁸

Therefore, in this study, we developed SOX-6, 9-transfected human ASCs (hereafter designated as ^{SOX-6, 9}ASCs) to treat OA and tested the hypothesis that they effectively prevent OA progression and are safe when administered intra-articularly (IA) in caprine models. In addition, extensive cell tracking of injected cells was performed in rats to study the cell survival and distribution in this therapy.

Materials and Methods

Construction of SOX-6, 9 minicircle parental plasmids

The parental plasmid of minicircle (MC) containing CMV (pMC.CMV-MCS-SV40 PolyA) was purchased from System Biosciences (Mountain View, CA). This system comprises a parental plasmid pMC.CMV-SOX9-T2A-SOX6-SV40 PolyA (hereafter called pMC.SOX-6, 9; size 9827 bp) from which MC.DNA vector was derived using the induction protocol described below. The coding regions of human SOX-6 and SOX-9 were amplified by polymerase chain reaction (PCR) from the NIH Mammalian Gene Collection (MGC) of complementary DNA (cDNA) Clones (Invitrogen, Carlsbad, CA) using the primers listed below (XbaI, EcoRI, and BamHI restriction sites are underlined; the 2A peptide sequence was inserted into SOX-9 reverse primer):

SOX-6 Forward: 5′-GAATTCATGTCTTCCAAGCAAGCCA

SOX-6 Reverse: 5′-GTCGACTCAGTTGGCACTGACAGC

SOX-9 Forward: 5′-TCTAGAGCCACCATGAATCTCCTGGACCCCTTCA

SOX-9 Reverse: 5′-GAATTCAGGGCCGGGATTCTCCTCCACGTCACCGCATGT TAGAAGACTTCCTCTGCCCTCAGGTCGAGTGAGCTGTGTGTA.

PCR products were subcloned into pGEM-T Easy vector and confirmed by DNA sequencing. After ligation of PCR products and pGEM-T Easy vector, they were inserted into empty parental plasmid vector using EcoRI/EcorI (SOX-6) and XbaI/EcoRI (SOX-9) restriction enzymes, respectively (Fig. 1A).

FIG. 1.

Preparation and transfection efficiency of SOX-6, 9 MC vector. (A) Schematic representation of SOX-6, 9 MC vector. SOX-6 and SOX-9 genes were linked by T2A, which is an oligopeptide sequence and multigene expression system. (B) Transfection efficiency of MC.RFP vector after electroporation. hASCs transfected with MC.RFP were visualized by fluorescent microscopy 48 h after transfection (upper panel) and analyzed by flow cytometry (lower panel). Results are percentages of transfected cells. (C) Cell viability results 24 h postelectroporation of MC.RFP or MC.SOX-6, 9. (D) Expressions of the SOX-6 and SOX-9 genes as determined by RT-PCR (left panel) and protein expressions determined by Western blot (right panel) in hASCs transfected with RFP or SOX-6, 9 MC vector. Scale bar: 200 μm. GAPDH was used as the reference gene or protein. MC.RFP, ASCs transfected with MC.RFP; MC.SOX-6, 9, ASCs transfected with MC.SOX-6, 9. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hASCs, human adipose stem cells; MC, minicircle; RFP, red fluorescence protein; RT-PCR, reverse transcription-polymerase chain reaction.

Production of MC vector

To produce MC vectors, parental plasmids were transformed into ZYCY10P3S2T Escherichia coli strain (System Biosciences).¹⁹ Assessment of growths and inductions of MC vectors were performed according to the manufacturer's instructions and using the protocol described by Chen et al.¹⁹ Briefly, a single colony was precultured at 37°C for 2 h in Luria-Bertani (LB) broth containing kanamycin (50 mg/mL) and then seed-cultured in Terrific broth (TB) containing kanamycin (50 mg/mL) at 30°C overnight. The next day, induction medium supplemented with 0.01% l-arabinose was added to the overnight culture, and the mixed culture was further incubated at 32°C with shaking at 250 rpm for 2 h. MC vectors were extracted from harvested E. coli cells using the NucleoBond Xtra Maxi Plus Plasmid Purification Kit (Macherey-Nagel, Duren, Germany).

Preparation of hASCs

hASCs were isolated from the lipoaspirates generated during elective liposuction of 3 female patients (mean age, 52 years). Protocol involving human tissue was approved by the Institutional Review Board (IRB) of Hallym University Hangang Sacred Heart Hospital (IRB 2015-001). Informed consent was obtained from all patients. hASCs were cultured and expanded as previously described²⁰ in Dulbecco's modified Eagle's medium (DMEM)/F12 (Gibco, Gaithersburg, MD) containing 10% fetal bovine serum (Gibco), which was changed every 48–72 h. Cells passaged five to seven times were used for transfection.

Transfection by electroporation

For transfection using the Neon transfection system (Life Technologies, Carlsbad, CA), cultured hASCs were harvested, washed with phosphate buffered saline (PBS), resuspended in resuspension buffer R (Invitrogen) at a density of 1 × 10⁶ cells/100 μL, and mixed with 4 μg of MC vectors of SOX-6, 9 or red fluorescence protein (RFP). Electroporation was performed using a microporator using programs recommended by the manufacturer (1400 V, 20 ms, two pulses). After electroporation, cells were plated on a 10 cm dish and placed in a 5% CO₂ incubator at 37°C. Red fluorescence from MC.RFP was visualized using a Leica DMI 6000B microscope (Leica Microsystems, Wetzlar, Germany). To measure transfection efficiency quantitatively, after 48 h of transfection, cells were harvested in 0.05% trypsin-EDTA and washed with PBS thrice. They were then analyzed using a FACSCanto II flow cytometer (BD Biosciences). hASCs electrophoresed without MC vector were used as the controls. To measure cell viabilities, harvested cells were stained with trypan blue, and then percentages of viable cells were obtained using a LUNA-FL system (Logos Biosystems, Gyeonggi-do, South Korea).

Characterization of ^{SOX-6, 9}ASCs

hASCs were analyzed for a set of accepted markers (CD34, positive for hematopoietic stem cells and endothelial cells; CD45, positive for white blood cells; HLA-DR, positive for leukocytes; and CD73, CD90, and CD105, each positive for MSCs) before and after transfection using fluorescence-activated cell sorting analysis (CytoFLEX; Beckman Coulter, Inc.) of hASCs. In untransfected hASCs, 98.1–99.8% of cells were negative for CD34, CD45, and HLA-DR, while 91.2–97.0% of cells were positive for CD73, CD90, and CD166. (Fig. 1A). Similarly for ^{SOX-6, 9}ASCs, 99.2–99.7% were negative for CD34, CD45, and HLA-DR, while 99.7–99.8% of cells were positive for CD73, CD90, and CD166 (Supplementary Fig. S2).

Chondrogenic pellet culture of transfected hASCs

To investigate the in vitro chondrogenic differentiation of hASCs, transfected cells were harvested from 10 cm dishes after 72 h of in vitro culture, and then 2.5 × 10⁵ transfected hASCs were cultured in pellets under base medium (BM), which was DMEM/F-12 supplemented with 1% bovine serum albumin (w/v), 10⁻⁷ M dexamethasone, 50 μM ascorbate-2-phosphate, 50 μM l-proline, 1 mM sodium pyruvate, and 1% insulin-transferrin-selenium (v/v). As a positive control, pellets of hASCs electrophoresed with MC.RFP were treated with chondrogenic medium containing a mixture of 10 ng/mL TGF-β₂ and 100 ng/mL BMP-7 (both from R&D Systems, Minneapolis, MN) in BM, as we previously described.²⁰ As another positive control, articular chondrocytes were isolated from normal AC that had been obtained from osteochondral fracture fragment of an 18-year-old female patient. Chondrocytes were expanded in culture dish on monolayer and then cultured in pellets (2.5 × 10⁵ cells) under BM only. Negative control was hASCs that were electrophoresed with MC.RFP and treated with BM only. For pellet cultures, 500 μL of cell suspension was aliquoted into 5 mL round tubes and spun in a bench top centrifuge (500 g, 10 min). Tubes were then placed in an incubator at 37°C in a humidified 5% CO₂ atmosphere. Tube caps were loosened to allow air exchange, and culture media were changed every 3 days. After 21 days, pellets were harvested for analysis.

Analysis of glycosaminoglycan contents

Pellets of each treatment group were digested in papain buffer at 60°C overnight, and the digested samples were then transferred to 1.5-mL microcentrifuge tubes. DNA content was determined using the Quant-iT dsDNA Assay Kit and Qubit Fluorometer system (Invitrogen). Glycosaminoglycan (GAG) production was determined using a Blyscan Kit according to the manufacturer's instructions (Biocolor, Carrickfergus, Northern Ireland). This assay is based on the specific binding of the cationic dye 1,9-DMMB to the sulfated GAG (s-GAG) chains of proteoglycans and to protein-free s-GAG chains.

Reverse transcription-polymerase chain reaction

RNA extraction was performed using TRIzol reagent (Invitrogen) according to the manufacturer's instructions and then quantified using a nanophotometer (Implen, Inc., Westlake Village, CA). Total RNA was reverse-transcribed with Maxime RT PreMix Kit oligo (dT) primer (iNtRON Biotechnology, Gyeonggi-do, South Korea) according to the manufacturer's instructions. PCR was carried out with HotStart PCR PreMix (Bioneer, Daejeon, South Korea). Real-time PCR was performed using a SYBR^® Premix Ex Taq^™ (Takara Korea Biomedical, Inc., Seoul, Korea) and a LightCycler 480 system (Roche Diagnostics, Mannheim, Germany). The expressions of the SOX-9, aggrecan, and COL2A1 genes were determined. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control for the PCR amplification, and relative normalization ratios of PCR products derived from target genes were calculated using LightCycler System software (Roche, Nutley, NJ) based on delta-delta Ct method. The primer pairs used in the reactions are detailed in Table 1. Values obtained were normalized versus the negative control and expressed as fold changes. All experiments were performed in triplicate.

Table 1.

Polymerase Chain Reaction Primer Information

Gene	Sequence (5′-3′)	Accession No.
Primers for chondrogenic differentiation markers
Aggrecan	F: TCGAGGACAGCGAGGCC	NM_013227.3
Aggrecan	R: TCGAGGGTGTAGCGTGTAGAGA	NM_013227.3
COL2A1	F: GGCAATAGCAGGTTCACGTACA	NM_001844
COL2A1	R: CGATAACAGTCTTGCCCCACTT	NM_001844
SOX-9	F: AGCGAACGCACATCAAGAC	NM_000346
SOX-9	R: GCTGTAGTGTGGGAGGTTGAA	NM_000346
Primers for human cell markers
hAlu	F: CCTGAGGTCAGGAGTTCGAG	1287991
hAlu	R: CCCGAGTAGCTGGGATTACA	1287992
hSOX-6	F: CGATGTGGTGGACACACTGA	AF_309034
hSOX-6	R: GTCCATTTGCTGCCGTTGTT	AF_309034
House keeping gene
GAPDH	F: GCTCAGACACCATGGGGAAGGT	NM_002046
GAPDH	R: GTGGTGCAGGAGGCATTGCTGA	NM_002046

GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Western blot analysis

Proteins were extracted from cultures, electrophoresed, and transferred to nitrocellulose membranes. For total protein extraction, cells or pellets were washed twice with PBS, then homogenized by grinding, and suspended in 100 μL of RIPA lysis buffer (Invitrogen) supplemented with protease/phosphatase inhibitor cocktail (Invitrogen). For aggrecan, chondroitin sulfate-GAGs were removed by digestion with chondroitinase ABC (Sigma-Aldrich), 0.1 U per 1 μg GAG at 37°C for 4 h. Blots were probed with anti-rabbit SOX-6 (1:500; Abcam, Cambridge, United Kingdom), SOX-9 (1:500; Abcam), COL2A1 (1:200; Abcam), aggrecan (1:200; Abcam), GAPDH (1:2000; Abcam), followed by horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (1:2000; Cell Signaling Technology, Beverly, MA). GAPDH was used as the reference protein and was detected using its specific antibody (Santa Cruz Biotechnology, Inc.). This experiment was repeated on three samples from each of the three individuals.

In vivo tracking of injected ^{SOX-6, 9}ASCs in rats

Retention time of ^{SOX-6, 9}ASCs in knee joints. Three 12-week-old male SD (Sprague Dawley) rats were used for the detection of fluorescence dye-labeled cells. Harvested ^{SOX-6, 9}ASCs were labeled with CellVue^® Claret Far Red Fluorescent Cell Linker Kits (Sigma-Aldrich) or Vybrant^™ DiD cell-labeling solutions (Invitrogen) according to manufacturers' instructions. Labeled cells (1 × 10⁶/100 μL PBS) were injected into left and right knee joints (left: CellVue-labeled cells, right: DiD-labeled cells). After injecting fluorescence dye-labeled ^{SOX-6, 9}ASCs IA, fluorescence spectra (n = 3) were scanned using an in vivo imaging system (IVIS; Xenogen, Hopkinton, MA). Three replicate images were obtained on days 1, 2, 7, 14, 21, 28, and 42 after injection.

A 56-day IA biodistribution study was also performed using SD rats. Control rats (3 females and 3 males) were injected with 60 μL of vehicle (HypoThermosol-FRS), and experimental rats (28 females and 28 males) were injected with 1 × 10⁶ of ^{SOX-6, 9}ASCs in 60 μL of vehicle. Animals were then assessed clinically and weighed on a daily basis and sacrificed on days 1, 2, 3, 7, 14, 28, or 56 (n = 8/time point). Samples of liver, heart, lung, kidney, spleen, pancreas, lymph nodes, bone marrow, brain, blood, ovaries/testes, and right knee cartilage were collected from each rat. All tissues were evaluated for the presence of human Alu or human SOX-6 cDNA by quantitative PCR (qPCR), which was performed using 3 μL of purified DNA (600 ng DNA). Standard curves were obtained from the data using simple regression analysis. Animal experiments were approved by the Animal Research and Care Committee of Chemon Institution (Chemon-16-R105: Yong-in, Korea). The primer pairs of human Alu and human SOX-6 are shown in Table 1.

IA injection of ^{SOX-6, 9}ASCs in OA-induced rats

OA was induced surgically using anterior cruciate ligament (ACL) transection in twelve 12-week-old male SD rats, according to a previous report.¹ The rats were treated with ^{SOX-6, 9}ASCs by IA injection at week 8 after OA induction. IA injection of vehicle (100 μL PBS) or 1.0 × 10⁶ ^{SOX-6, 9}ASCs in 100 μL PBS was performed in the same way to be used as controls (n = 6 in each group). Rats were sacrificed for analysis after days 7 and 14. The distal femora in each group were dissected and fixed in 10% formaldehyde in PBS overnight. Then they were decalcified and sliced on a freezing microtome (CM 1850; Leica Microsystem). The sections (20 μm thick) were subjected to immunohistochemistry (IHC). The human nuclear antigen (HN; 1:100; Chemicon Temecula) primary antibody was applied overnight at 4°C followed by an hour application of secondary antibody (goat anti-mouse antibody; 1:200; Jackson ImmunoResearch Laboratories, West Grove, PA). Tissues were mounted in VECTASHIELD containing 4′,6-diamidino-2-phenylindole (DAPI; Vector Laboratories, Burlingame, CA) and analyzed under an epifluorescent microscope (Nikon, Tokyo, Japan).

In vivo efficacy of ^{SOX-6, 9}ASC injection in goats

Surgically induced caprine OA model

Goat experiments were approved by the Animal Research and Care Committee of the authors' institution (IACUC No. MCTTIACUC ASP-15-001). Thirty Korean native male black goats (DooYeol Biotech, Seoul, Korea) were used in the study. All goats were aged about 40 months and weighed 30–45 kg (mean, 37.5 kg) at the time of surgery. Animals were kept in a barn and fed nutrient pellets and hay on a daily basis. The animals were anesthetized using ketamine (2 mg/kg; Yuhan Corp., Seoul, Korea) and xylazine (0.1 mg/kg; Bayer Korea Corp., Seoul, Korea). After skin preparation, knee joints were exposed using a medial parapatellar approach. The medial meniscus was completely removed from its attachments by sharp dissection. Three left and three right knees were allocated to each of five groups, as defined below. After recovery from anesthesia, animals were allowed free movement in an unconfined environment.

Injection of ^{SOX-6, 9}ASCs into the knee joints of OA-induced goats

Animals were allocated to one of five groups (six goats in each group) at 4 months after OA induction as follows: Group 1—naive hASC group, animals were injected with 0.6 × 10⁷ naive hASCs; Group 2—low-dose group, animals were injected with 0.18 × 10⁷ ^{SOX-6, 9}ASCs; Group 3—mid-dose group, animals were injected with 0.6 × 10⁷ ^{SOX-6, 9}ASCs; Group 4—high-dose group, animals were injected with 1.8 × 10⁷ ^{SOX-6, 9}ASCs; and Group 5—negative control group, animals were injected with vehicle (PBS). Injection doses were calculated based on considerations of joint volume and cartilage sizes in goats and man.²¹ All animals were sacrificed for analysis 5 months postinjection.

Autopsies and visual/histopathological examinations of treated joints

Atropine sulfate (0.1 mg/kg; Jeil Pharm., Daegu, Korea) was administered intramuscularly as a preanesthetic to prevent any respiratory distress. Animals were then anesthetized with an intraperitoneal injection of ketamine 2 mg/kg and xylazine 0.1 mg/kg and euthanized by injecting potassium chloride (2 mmol/kg; Sigma-Aldrich) intravenously. Femoral condyles and tibial plateaus were carefully and separately dissected without damaging cartilage surfaces. Harvested tissues were fixed in 10% formalin solution (Wako, Osaka, Japan) for 1 day, decalcified, and decalcified in 10% ethylenediaminetetraacetic acid in a 0.01 M phosphate buffer (pH 7.4) at 48°C for 3 weeks. After dehydration through a graded series of ethanol solutions, specimens were embedded in paraffin, sectioned at 4 μm, and stained with hematoxylin and eosin (HE), fast green, and Safranin-O.

The Osteoarthritis Research Society International (OARSI) Scoring System for goats was used to grade the degenerative status of tissues.^22,23 The system takes into account macroscopic findings of cartilage (score: 0–16) and osteophytes (score: 0–12) from 4 knee joint sites. Microscopic scoring was performed by evaluating cartilage structure (score: 0–10), chondrocyte density (score: 0–4), cell cloning (score: 0–4), interterritorial proteoglycan staining (score: 0–4), and tidemark integrity (score: 0–3).

Enzyme-linked immunosorbent assay results for inflammatory cytokines in goat synovial fluid

Synovial fluid (SF) samples were obtained from all knee joints during sacrifice and then centrifuged within 4 h at 10,000 g for 10 min and frozen at −70°C to −75°C. SF samples were also obtained from normal knee joints of six goats, which did not undergo any surgical procedure. Supernatants were assayed for goat tumor necrosis factor (TNF)-α and interleukin (IL)-1β using an Enzyme-linked Immunosorbent Assay Kit (MyBioSource, San Diego, CA). Well optical densities were read at 450 nm.

Statistical analyses

All quantitative data are expressed as the mean ± standard error of the mean of at least four independent experiments. Statistical comparisons between groups were made using one-way analysis of variance with Bonferroni's correction or using Dunnett's t test (SPSS 18.0; SPSS, Inc., Chicago, IL). Statistical significance was accepted for p-values <0.05.

Results

Construction of SOX-6, 9 MC vector

MC.RFP was used to measure transfection efficiencies achieved by electroporation because SOX-6, 9 MC vector lacks a fluorescent marker gene. FACS showed that transfection efficiency was 95.6% (Fig. 1B). Mean cell viabilities of RFP and SOX-6, 9 MC vector transfected cells were 92.67% ± 16.02 and 80.03% ± 13.83, respectively (Fig. 1C).

After transferring the SOX-6, 9 MC vector into hASCs, gene transfection was confirmed by examining changes in the messenger RNA (mRNA) expressions of SOX-6 and SOX-9. Both were elevated in ^{SOX-6, 9}ASCs than in negative controls (RFP-transfected hASCs) which showed low, endogenous gene expression of both factors. Western blot confirmed the expressional upregulations of SOX-6 and SOX-9 at the protein level (Fig. 1D).

In vitro chondrogenic potential of ^{SOX-6, 9}ASCs

hASCs underwent standard chondrogenic pellet culture. Pellet diameter sizes were statistically greater for ^{SOX-6, 9}ASCs than for hASCs treated with TGF-β₂ and BMP-7 (p < 0.01, positive control) or hASCs treated with BM only (p < 0.05, negative control) (Fig. 2A). Proteoglycan productions, as measured by GAG/DNA ratio and Safranin-O staining, were comparable between ^{SOX-6, 9}ASCs and the positive control (Fig. 2B, C). In contrast, SOX-9 mRNA expression was >250-fold greater in ^{SOX-6, 9}ASCs than in the positive control. COL2A1 and aggrecan mRNA expressions were 3.5- (p = 0.004) and 1.4-fold (p = 0.058) greater, respectively, in ^{SOX-6, 9}ASCs than in the positive control (Fig. 2D). Western blot also confirmed the expressional upregulations of SOX-9, COL2A1, and aggrecan at the protein level (Fig. 2E and Supplementary Fig. S3). ^{SOX-6, 9}ASCs had comparable proteoglycan production to that of normal articular chondrocyte as observed by Safranin-O staining, while COL2A1 and aggrecan mRNA expression from ^{SOX-6, 9}ASCs tended to be higher but statistically insignificant than those from articular chondrocytes (Supplementary Fig. S4).

FIG. 2.

Chondrogenic potential of ^{SOX-6, 9}ASCs in vitro. (A) Photographs of representative pellets were obtained, and mean pellet sizes were evaluated after 21 days in chondrogenic culture. hASCs transfected with control vector (MC.RFP) were cultured with BM without any growth factor (negative control) or BM with TGF-β₂ and BMP-7 (positive control). Scale bar: 1 mm. (B) GAG levels in each pellet were evaluated after DNA normalization. Results are presented as mean ± standard deviation (n = 3 per group, *p < 0.05, **p < 0.01). (C) Safranin-O staining of chondrogenic pellets. Scale bar: 500 μm. (D) RT-qPCR for SOX-9, COL2A1, and aggrecan in pellets. Fold-changes versus untreated hASCs are shown (n = 3 per group, *p < 0.05, **p < 0.01). (E) Western blot for SOX-9, COL2A1, and aggrecan in pellets. BM, control vector-transfected hASCs cultured with BM only; TGF-β₂/BMP-7, control vector-transfected hASCs treated with TGF-β₂ and BMP-7; SOX-6, 9, ^{SOX-6, 9}ASCs. BM, base medium; DNA, deoxyribose nucleic acid; GAG, glycosaminoglycan; qPCR, quantitative PCR; ^{SOX-6, 9}ASCs, SOX-6, 9-transfected human adipose stem cells.

Retention time of ^{SOX-6, 9}ASCs in the knee joints of rats

Retention times of ^{SOX-6, 9}ASCs were investigated in rats by fluorescence imaging after IA injection. hASCs were labeled with two dyes, CellVue and DiD. The fluorescence signals of hASCs labeled with CellVue were undetectable at 7 days after injection, while those labeled with DiD produced fluorescent signals up to 28 days after injection (Fig. 3A).

FIG. 3.

Retention times and hASC biodistributions were measured after a single IA injection in SD rats. (A) Retention times of fluorescence dye-labeled hASCs in the knee joints of SD rats were obtained using CellVue (left knees) and DiD (right knees) at different times. The scale bar range is 0–2.6 × 10⁸ in fluorescence intensity. DiD-labeled hASCs showed significantly higher fluorescence intensity than CellVue-labeled hASCs (n = 3). (B) qPCR for the presence of human DNA (Alu and SOX-6) after injecting ^{SOX-6, 9}ASCs in SD rats. At day 15 postinjection, there was no sign of human DNA at sites of administration (n = 8). (C) Absence of hASCs in rat tissue by immunohistochemistry for human nuclear antigen (n = 6). Scale bar: 1 mm. IA, intra-articularly; SD, Sprague Dawley.

A 56-day study of ^{SOX-6, 9}ASCs was also conducted to establish the biodistribution of cells following a single IA injection in SD rats. Analysis of PCR data showed the presence of human SOX-6 in bone marrow (in one of eight animals), lymph nodes (in one of eight animals), and heart tissues (in one of eight animals) on day 1, but not any other tissue except for right knees (the site of administration) on day 2 (data not shown). qPCR was also performed to detect the presence of human DNA from ^{SOX-6, 9}ASCs. Human Alu and SOX-6 gradually decreased until day 8 and were not detected at sites of administration on day 14 (Fig. 3B) nor was any positive signal or persistence of human Alu or SOX-6 in any other tissue or blood beyond day 2. These results indicated that injected hASCs gradually perished from joints.

To further analyze the mode of action of ^{SOX-6, 9}ASCs at arresting OA progression, we investigated whether the injected ^{SOX-6, 9}ASCs persisted in the joint cavity of OA-induced rats by detecting HN by IHC. The human cells (^{SOX-6, 9}ASCs) were not detected in the joint at days 7 and 14 after ^{SOX-6, 9}ASC injection (Fig. 3C). These results suggest that the injected ^{SOX-6, 9}ASCs perished from the joint after probably exerting paracrine effects.

Gross findings of AC in the OA-induced goats treated with ^SOX ^{-6, 9}ASCs

AC statuses were assessed in both femoral and tibial sides of joint. Medial meniscectomy (MM) led to the development of OA lesions in medial knee joint compartments.

In negative control knees, only saline was injected. Three different doses of ^{SOX-6, 9}ASCs were injected, and to isolate the effect of hASCs per se, naive hASCs were also injected in one group. At 5 months after injection, OA changes, including denudation of AC and fibrillation of articular surface, were visible in the negative control. In the other groups, these changes were less pronounced, but to variable degrees, except in the high-dose group. The mid-dose group showed best AC preservation (Fig. 4A). OARSI macroscopic scores were significantly better for mid-dose ^{SOX-6, 9}ASCs than for negative controls in the femoral and tibial articular surfaces (Fig. 4B). At the time of sacrifice, joint fluid was collected and analyzed for the inflammatory cytokines IL-1β and TNF-α. TNF-α levels were significantly lower in the low-dose and mid-dose groups than in negative controls, and IL-1β levels were significantly lower in the mid-dose group than in negative controls (Fig. 4C).

FIG. 4.

Gross findings of AC and inflammatory cytokine levels of the synovial fluids in OA-induced goats. (A) A representative gross image of each of the five treatment groups; osteoarthritic lesions are denoted in red boxes. n = 6 per group. (B) Macroscopic scores of femoral and tibial articular surfaces. The OARSI scoring system takes into account the macroscopic findings of cartilage (score: 0–16) and osteophytes (score: 0–12) at four sites per knee joint. (C) IL-1β and TNF-α levels were analyzed in joint fluids at injection sites in OA-induced knees and normal knees (n = 6, from knees of unoperated goats) by ELISA. Negative controls were injected with vehicle (PBS), the hASC group was injected with 0.6 × 10⁷ naive hASCs, the low-dose group was injected with 0.18 × 10⁷ ^{SOX-6, 9}ASCs, the mid-dose group was injected with 0.6 × 10⁷ ^{SOX-6, 9}ASCs, and the high-dose group was injected with 1.8 × 10⁷ ^{SOX-6, 9}ASCs. *p < 0.05 versus negative control. AC, articular cartilage; ELISA, enzyme-linked immunosorbent assay; IL, interleukin; OA, osteoarthritis; OARSI, Osteoarthritis Research Society International; PBS, phosphate buffered saline; TNF, tumor necrosis factor.

Histological findings of AC in the OA-induced goats treated with ^{SOX-6, 9}ASCs

H&E and Safranin-O staining was performed after decalcifying harvested goat samples. Overall results corroborated gross examination findings. Surface fibrillation and loss of proteoglycan were observed more obviously in negative controls than in the other groups except the high-dose group. The mid-dose group exhibited relatively intact smooth surface with good extracellular matrix status, showing less OA progression than the other groups (Fig. 5A and Supplementary Fig. S5). OARSI microscopic scores indicated that mid-dose group achieved best results, and these scores were significantly lower than those of negative controls regarding structure, chondrocyte density, cell cloning in femoral articular surfaces, and chondrocyte density and proteoglycan staining in tibial articular surfaces (Fig. 5B).

FIG. 5.

Histological analysis and OARSI microscopic scores of AC in the OA-induced goats. Negative controls were injected with vehicle (PBS), the hASC group was injected with 0.6 × 10⁷ naive hASCs, the low-dose group was injected with 0.18 × 10^{7 SOX-6, 9}ASCs, the mid-dose group was injected with 0.6 × 10⁷ ^{SOX-6, 9}ASCs, and the high-dose group was injected with 1.8 × 10⁷ ^{SOX-6, 9}ASCs. (A) Histological findings obtained by Safranin-O staining AC (n = 6 per group). Scale bar: 3 mm. (B) Microscopic scores were determined from histology of femoral and tibial articular surfaces of OA-induced goats. Microscopic scores of cartilage were obtained by scoring the following; A, cartilage structure (score: 0–10); B, cell density (score: 0–4); C, cell cloning (score: 0–4); D, interterritorial proteoglycan staining (score: 0–4); and E, tidemark (score: 0–3). *p < 0.05 versus negative control.

Discussion

Although nonviral gene delivery is generally less efficient than viral delivery for gene transduction, it is less immunogenic, which makes it a safer tool for gene transfer.²⁴ Electroporation, a physical gene delivery method, has been widely used to introduce genes into various types of cells in vitro. During this process, an electrical pulse is used to create transient pores in cell membranes, facilitating the spontaneous movement of exogenous DNA into cells.^21,25

Our preliminary studies showed that transfection of SOX-6, 9 induced chondrogenesis to the same extent as the SOX-5, 6, 9 (Supplementary Fig. S1). While Yang et al. reported that single retroviral transduction of SOX-9 could induce ASC differentiation into chondrocyte-like cells,²⁶ our previous data clearly demonstrated that cotransduction of SOX-5, -6 together with SOX-9 led to much more effective chondrogenesis than single transfection of SOX-9 alone.^14,16

Rat model was used for cell tracking because it was not possible to monitor injected cells in goats. Of note, injected cells gradually disappeared within 2 weeks of injection in knee joints of rats. IHC for HN in OA-induced rat samples also demonstrated the absence of injected ^{SOX-6, 9}ASCs. These results suggest that injected human ASCs disappear after exerting paracrine effects and that the differentiation of injected ^{SOX-6, 9}ASCs into articular chondrocytes did not occur. Given that this gene-cell therapy works in a paracrine effect mode, there is a question as to whether multiple injections are necessary to achieve best results. While most of reported cell injections to treat OA used a single injection, there is a report that multiple injections are necessary to maintain viable cells and inhibit OA progression by secretion of trophic factors.²⁷ Although multiple injections are likely to enhance the chondroprotective effect of treatment, increased costs and higher risks of immune reactions must also be considered. While the paracrine action of ASCs was not investigated in detail in the current OA study, it may be mediated by exosomes that reduce the production of inflammatory mediators from OA chondrocytes.²⁸ hASCs can also downregulate inflammatory factors (IL-1β) in the SF through paracrine pathway.²⁹

Reduction of IL-1β-mediated inflammation and oxidative stress may promote chondrogenesis-associated gene expressions in hASCs in OA environments.³⁰ Besides, when cocultured with OA chondrocytes, ASCs protect chondrocytes from degeneration associated with OA by reducing apoptosis and inducing hepatocyte growth factor.³¹ In contrast, hASC-derived conditioned medium has a limited ability to decrease IL-1β, TNF-α, and matrix-degrading enzymes compared with ASCs per se.³²

The surgically-induced OA model used in the present study was established in our previous study, in which we compared MM alone with MM plus ACL transection. Contrary to expectation, MM alone more reproducibly led to the development of OA.³³ In a former study, we found that the effect of hASC xenografting to treat OA was not different between immunosuppressed and nonimmunosuppressed goats with respect to AC status and synovial inflammation, possibly due to the immune-protected status of synovial joints.³³ Good chondroprotective effects were also demonstrated with xenografting of ^{SOX-6, 9}ASCs in the current study, which would provide a supportive data for human trial in the future. At present, there is limited clinical proof of ASC therapy for OA because most studies are not well controlled and used stromal vascular fraction rather than cultured and characterized ASCs.^34,35 A recent single center, randomized, double-blind, placebo-controlled, single ascending dose study showed that single injection of ASCs to OA knees led to significant symptomatic relief and arrested cartilage volume loss.³⁶ A systematic review of nonhomologous ASC therapies also showed improved functional, radiographic, and histological scores in OA with very few serious adverse events.³⁷ From our data, it is surmised that ^{SOX-6, 9}ASCs would be more effective than naive ASCs in human OA.

Overall the results obtained in the present study showed that a single injection of ^{SOX-6, 9}ASCs at a mid dose of 0.6 × 10⁷ ^{SOX-6, 9}ASCs effectively arrested OA progression in surgically-induced OA and to significantly greater extents than ^{SOX-6, 9}ASCs at low dose of 0.18 × 10⁷ ^{SOX-6, 9}ASCs. Interestingly, the high dose of 1.8 × 10⁷ ^{SOX-6, 9}ASCs, as well as low dose, was less effective in this respect than the mid dose, indicating the presence of an optimal dose of ^{SOX-6, 9}ASCs for the treatment of OA. It is uncertain why ^{SOX-6, 9}ASCs at high dosage resulted in no effects. Melief et al. showed that ASCs secreted a higher level of cytokines (IL-6 and transforming growth factor-β1) implicated in the immunomodulation compared with BMSCs, correlating with higher metabolic activity of ASCs which may lead to imbalance of cartilage metabolism.³⁸ In addition, Pigott et al. reported that greater level of inflammatory cytokine was released from peripheral blood mononuclear cells when xeno-MSCs were cocultured than when auto- or allo-MSCs were cocultured.³⁹ We speculate that the greater level of inflammation within the synovial joint in the high-dose group than in the mid-dose group may be associated with inferior gross and histological results in the group.

While this study is a large-animal study that demonstrated effectiveness and safety, as well as mechanism of action in IA ^{SOX-6, 9}ASC therapy, there are shortcomings. First one includes inability to perform IHC in histological sections for inflammatory cytokines and enzymes related with OA pathogenesis because primary antibodies for goats were not available. In addition, to further investigate mode of action, isolation and IA injection of ^{SOX-6, 9}ASC-derived exosomes would have confirmed the pilot observation results of high-dose ASC treatment. In addition, the effect of multiple IA injection which was reported to be safe in an allogeneic equine model may be investigated in future studies.⁴⁰

In conclusion, SOX-6, 9-transfection led to in vitro chondrogenesis of ASCs comparable to that achieved by growth factor treatment. IA injection of ^SOX-6, ⁹ASCs in optimal dose reduced the progression of surgically-induced OA in goats. We suggest that IA ^{SOX-6, 9}ASCs be considered a novel potential strategy to treat OA.

Footnotes

Acknowledgment

This study was supported by the National Research Foundation (NRF) funded by the Korean Government (2017M3A9B4064777, 2016R1C1B1008616).

Disclosure Statement

No competing financial interests exist.

References

Kang

M.L.

, and Im

G.I.

Drug delivery systems for intra-articular treatment of osteoarthritis. Expert Opin Drug Deliv, 11, 269, 2014.

Beiser

I.H.

, and Kanat

I.O.

Subchondral bone drilling: a treatment for cartilage defects. J Foot Surg, 29, 595, 1990.

Tuan

R.S.

A second-generation autologous chondrocyte implantation approach to the treatment of focal articular cartilage defects. Arthritis Res Ther, 9, 109, 2007.

Lefebvre

, Li

, and De Crombrugghe

A new long form of Sox5 (L-Sox5), Sox6 and Sox9 are coexpressed in chondrogenesis and cooperatively activate the type II collagen gene. EMBO J, 17, 5718, 1998.

Lefebvre

, Behringer

R.R.

, and De Crombrugghe

L-Sox5, Sox6 and Sox9 control essential steps of the chondrocyte differentiation pathway. Osteoarthritis Cartilage, 9, S69, 2001.

Lefebvre

, Huang

, Harley

V.R.

, Goodfellow

P.N.

, and De Crombrugghe

SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro alpha1 (II) collagen gene. Mol Cell Biol, 17, 2336, 1997.

Zhao

, Eberspaecher

, Lefebvre

, and De Crombrugghe

Parallel expression of Sox9 and Col2a1 in cells undergoing chondrogenesis. Dev Dyn, 209, 377, 1997.

Smits

, Dy

, Mitra

, and Lefebvre

Sox5 and Sox6 are needed to develop and maintain source, columnar, and hypertrophic chondrocytes in the cartilage growth plate. J Cell Biol, 164, 747, 2004.

Smits

, Li

, Mandel

, et al. The transcription factors L-Sox5 and Sox6 are essential for cartilage formation. Dev Cell, 1, 277, 2001.

10.

Cucchiarini

, Thurn

, Weimer

, Kohn

, Terwilliger

E.F.

, and Madry

Restoration of the extracellular matrix in human osteoarthritic articular cartilage by overexpression of the transcription factor SOX9. Arthritis Rheum, 56, 158, 2007.

11.

Tew

S.R.

, Li

, Pothacharoen

, Tweats

L.M.

, Hawkins

R.E.

, and Hardingham

T.E.

Retroviral transduction with SOX9 enhances re-expression of the chondrocyte phenotype in passaged osteoarthritic human articular chondrocytes. Osteoarthritis Cartilage, 13, 80, 2005.

12.

Tsuchiya

, Kitoh

, Sugiura

, and Ishiguro

Chondrogenesis enhanced by overexpression of sox9 gene in mouse bone marrow-derived mesenchymal stem cells. Biochem Biophys Res Commun, 301, 338, 2003.

13.

Ikeda

, Kamekura

, Mabuchi

, et al. The combination of SOX5, SOX6, and SOX9 (the SOX trio) provides signals sufficient for induction of permanent cartilage. Arthritis Rheumat, 50, 3561, 2004.

14.

G.-I.

, and Kim

H.-J.

Electroporation-mediated gene transfer of SOX trio to enhance chondrogenesis in adipose stem cells. Osteoarthritis Cartilage, 19, 449, 2011.

15.

Kim

H.J.

, and Im

G.I.

Electroporation-mediated transfer of SOX trio genes (SOX-5, SOX-6, and SOX-9) to enhance the chondrogenesis of mesenchymal stem cells. Stem Cells Dev, 20, 2103, 2011.

16.

G.I.

, Kim

H.J.

, and Lee

J.H.

Chondrogenesis of adipose stem cells in a porous PLGA scaffold impregnated with plasmid DNA containing SOX trio (SOX-5, -6 and-9) genes. Biomaterials, 32, 4385, 2011.

17.

Lee

J.M.

, and Im

G.I.

SOX trio-co-transduced adipose stem cells in fibrin gel to enhance cartilage repair and delay the progression of osteoarthritis in the rat. Biomaterials, 33, 2016, 2012.

18.

Liu

C.F.

, and Lefebvre

The transcription factors SOX9 and SOX5/SOX6 cooperate genome-wide through super-enhancers to drive chondrogenesis. Nucleic Acids Res, 43, 8183, 2015.

19.

Chen

Z.Y.

, He

C.Y.

, Ehrhardt

, and Kay

M.A.

Minicircle DNA vectors devoid of bacterial DNA result in persistent and high-level transgene expression in vivo. Mol Ther, 8, 495, 2003.

20.

Kim

H.J.

, and Im

G.I.

Combination of transforming growth factor-beta2 and bone morphogenetic protein 7 enhances chondrogenesis from adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A, 15, 1543, 2009.

21.

Aluigi

, Fogli

, Curti

, et al. Nucleofection is an efficient nonviral transfection technique for human bone marrow–derived mesenchymal stem cells. Stem Cells, 24, 454, 2006.

22.

Proffen

B.L.

, McElfresh

, Fleming

B.C.

, and Murray

M.M.

A comparative anatomical study of the human knee and six animal species. Knee, 19, 493, 2012.

23.

Little

C.B.

, Smith

M.M.

, Cake

M.A.

, Read

R.A.

, Murphy

M.J.

, and Barry

F.P.

The OARSI histopathology initiative—recommendations for histological assessments of osteoarthritis in sheep and goats. Osteoarthritis Cartilage, 18(Suppl. 3), S80, 2010.

24.

Mellott

A.J.

, Forrest

M.L.

, and Detamore

M.S.

Physical non-viral gene delivery methods for tissue engineering. Ann Biomed Eng, 41, 446, 2013.

25.

Baum

, Forster

, Hegewisch-Becker

, and Harbers

An optimized electroporation protocol applicable to a wide range of cell lines. Biotechniques, 17, 1058, 1994.

26.

Yang

, Huang

C.Y.

, Candiotti

K.A.

, et al. Sox-9 facilitates differentiation of adipose tissue-derived stem cells into a chondrocyte-like phenotype in vitro. J Orthop Res, 29, 1291, 2011.

27.

Ozeki

, Muneta

, Koga

, et al. Not single but periodic injections of synovial mesenchymal stem cells maintain viable cells in knees and inhibit osteoarthritis progression in rats. Osteoarthritis Cartilage, 24, 1061, 2016.

28.

Tofiño-Vian

, Guillén

M.I.

, Pérez Del Caz

M.D.

, Silvestre

, and Alcaraz

M.J.

Microvesicles from human adipose tissue-derived mesenchymal stem cells as a new protective strategy in osteoarthritic chondrocytes. Cell Physiol Biochem, 47, 11, 2018.

29.

ter Huurne

, Schelbergen

, Blattes

, et al. Antiinflammatory and chondroprotective effects of intraarticular injection of adipose-derived stem cells in experimental osteoarthritis. Arthritis Rheum, 64, 3604, 2012.

30.

Bahrampour Juybari

, Kamarul

, Najafi

, Jafari

, and Sharifi

A.M.

Restoring the IL/-1β/NF-κB-induced impaired chondrogenesis by diallyl disulfide in human adipose-derived mesenchymal stem cells via attenuation of reactive oxygen species and elevation of antioxidant enzymes. Cell Tissue Res, 373, 407, 2018.

31.

Maumus

, Manferdini

, Toupet

, et al. Adipose mesenchymal stem cells protect chondrocytes from degeneration associated with osteoarthritis. Stem Cell Res, 11, 834, 2013.

32.

Manferdini

, Maumus

, Gabusi

, et al. Lack of anti-inflammatory and anti-catabolic effects on basal inflamed osteoarthritic chondrocytes or synoviocytes by adipose stem cell-conditioned medium. Osteoarthritis Cartilage, 23, 2045, 2015.

33.

J.Y.

, Lee

, and Im

G.I.

Intra-articular xenotransplantation of adipose-derived stromal cells to treat osteoarthritis in a goat model. Tissue Eng Regen Med, 14, 65, 2017.

34.

Kuah

, Sivell

, Longworth

, et al. Safety, tolerability and efficacy of intra-articular Progenza in knee osteoarthritis: a randomized double-blind placebo-controlled single ascending dose study. J Transl Med, 16, 49, 2018.

35.

Hurley

E.T.

, Yasui

, Gianakos

A.L.

, et al. Limited evidence for adipose-derived stem cell therapy on the treatment of osteoarthritis. Knee Surg Sports Traumatol Arthrosc, 26, 3499, 2018.

36.

Jevotovsky

D.S.

, Alfonso

A.R.

, Einhorn

T.A.

, and Chiu

E.S.

Osteoarthritis and stem cell therapy in humans: a systematic review. Osteoarthritis Cartilage, 26, 711, 2018.

37.

Bateman

M.E.

, Strong

A.L.

, Gimble

J.M.

, and Bunnell

B.A.

Concise review: using fat to fight disease: a systematic review of nonhomologous adipose-derived stromal/stem cell therapies. Stem Cells, 36, 1311, 2018.

38.

Melief

S.M.

, Zwaginga

J.J.

, Fibbe

W.E.

, and Roelofs

Adipose tissue-derived multipotent stromal cells have a higher immunomodulatory capacity than their bone marrow-derived counterparts. Stem Cells Transl Med, 2, 455, 2013.

39.

Pigott

J.H.

, Ishihara

, Wellman

M.L.

, Russell

D.S.

, and Bertone

A.L.

Investigation of the immune response to autologous, allogeneic, and xenogeneic mesenchymal stem cells after intra-articular injection in horses. Vet Immunol Immunopathol, 156, 99, 2013.

40.

Mariñas-Pardo

, García-Castro

, Rodríguez-Hurtado

, Rodríguez-García

M.I.

, Núñez-Naveira

, and Hermida-Prieto

Allogeneic adipose-derived mesenchymal stem cells (Horse Allo 20) for the treatment of osteoarthritis-associated lameness in horses: characterization, safety, and efficacy of intra-articular treatment. Stem Cells Dev, 27, 1147, 2018.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.18 MB

0.11 MB

0.04 MB

0.08 MB

0.14 MB

0.00 MB

SOX - 6,9 -Transfected Adipose Stem Cells to Treat Surgically-Induced Osteoarthritis in Goats

Abstract

Impact Statement

Introduction

Materials and Methods

Construction of SOX-6, 9 minicircle parental plasmids

Production of MC vector

Preparation of hASCs

Transfection by electroporation

Characterization of SOX-6, 9ASCs

Chondrogenic pellet culture of transfected hASCs

Analysis of glycosaminoglycan contents

Reverse transcription-polymerase chain reaction

Western blot analysis

In vivo tracking of injected SOX-6, 9ASCs in rats

IA injection of SOX-6, 9ASCs in OA-induced rats

In vivo efficacy of SOX-6, 9ASC injection in goats

Surgically induced caprine OA model

Injection of SOX-6, 9ASCs into the knee joints of OA-induced goats

Autopsies and visual/histopathological examinations of treated joints

Enzyme-linked immunosorbent assay results for inflammatory cytokines in goat synovial fluid

Statistical analyses

Results

Construction of SOX-6, 9 MC vector

In vitro chondrogenic potential of SOX-6, 9ASCs

Retention time of SOX-6, 9ASCs in the knee joints of rats

Gross findings of AC in the OA-induced goats treated with SOX -6, 9ASCs

Histological findings of AC in the OA-induced goats treated with SOX-6, 9ASCs

Discussion

Footnotes

Acknowledgment

Disclosure Statement

References

Supplementary Material

Characterization of ^{SOX-6, 9}ASCs

In vivo tracking of injected ^{SOX-6, 9}ASCs in rats

IA injection of ^{SOX-6, 9}ASCs in OA-induced rats

In vivo efficacy of ^{SOX-6, 9}ASC injection in goats

Injection of ^{SOX-6, 9}ASCs into the knee joints of OA-induced goats

In vitro chondrogenic potential of ^{SOX-6, 9}ASCs

Retention time of ^{SOX-6, 9}ASCs in the knee joints of rats

Gross findings of AC in the OA-induced goats treated with ^SOX ^{-6, 9}ASCs

Histological findings of AC in the OA-induced goats treated with ^{SOX-6, 9}ASCs