Primed IFN-γ-Umbilical Cord Stem Cells Ameliorate Temporomandibular Joint Osteoarthritis

Abstract

Temporomandibular joint osteoarthritis (TMJOA) is a degenerative disorder affecting the temporomandibular joint (TMJ), marked by persistent inflammation and structural damage to the joint. Only symptomatic treatment is available for managing TMJOA. Human umbilical cord mesenchymal stem cells (hUC-MSCs) show potential for treating TMJOA via their immune-modulating actions in the disease area. In addition, stimulation of inflammatory cytokines such as interferon-gamma in hUC-MSCs improves the therapeutic activity of naïve stem cells. Emerging evidence indicates that macrophages play significant roles in regulating joint inflammation through diverse secreted mediators in the pathogenesis of TMJOA. This study was conducted to evaluate the effects of inflammatory cytokine-stimulated hUC-MSCs in repairing TMJOA-induced cartilage lesions and the role of macrophages in the disease. Our in vitro data showed that stimulated hUC-MSCs induce M2 polarization of macrophages and enhance the expression of anti-inflammatory molecules. These effects were subsequently validated in vivo. In a rat model of TMJOA, stimulated hUC-MSCs ameliorated inflammation and increased M2 macrophages ratio. Our results indicate that hUC-MSCs stimulated by inflammatory cytokines modulate the activation of M2 macrophages, thereby shifting the local osteoarthritis microenvironment toward a prochondrogenic state and facilitating cartilage repair in inflammatory conditions. Stimulating hUC-MSCs with inflammatory cytokines could potentially offer an effective therapeutic approach for TMJOA, with macrophages playing a pivotal role in immune modulation.

Impact Statement

Temporomandibular joint osteoarthritis (TMJOA) is marked by chronic inflammation and degeneration of the joint. This research focuses on human umbilical cord stem cells (hUC-MSCs), stimulated with inflammatory cytokines, to repair osteoarthritis (OA)-related cartilage lesions. In vitro results show that these stimulated cells promote M2 polarization of macrophages, leading to improved chondrocyte microenvironments and cartilage repair, validated in an in vivo rat model. This suggests a promising treatment strategy, as inflammatory cytokine-stimulated hUC-MSCs could shift the local OA environment toward cartilage repair, offering potential therapeutic benefits for TMJOA.

Introduction

Temporomandibular disorders (TMD) are a complex and challenging disease. Among the various diseases classified under TMD, temporomandibular joint osteoarthritis (TMJOA) is particularly serious, characterized by chronic progressive degeneration of the articular cartilage and inflammation of the joint.^1,2 Common symptoms of TMJOA include chronic pain, joint noise, and dysfunction, which often lead patients to seek medical care at orofacial pain clinics.³ Clinical treatment options for TMJOA are currently limited to surgical interventions or symptomatic approaches, such as therapy with nonsteroidal anti-inflammatory drugs.⁴ However, these treatments only provide temporary control of inflammation and pain relief without preventing cartilage destruction in TMJOA, as observed in osteoarthritis (OA) in other joints.^5,6 A key strategy for successfully treating degenerative TMJOA depends on progressive repair of the damaged articular cartilage. The development of TMJOA involves various pathological changes, including chondrocyte apoptosis and hypertrophy, as well as activation of innate immune cells, primarily macrophages.⁷ These changes progressively alter the articular microenvironment, which is critical for cartilage tissue repair. Therefore, to effectively treat TMJOA, it is crucial to alter the inflammatory microenvironment to promote an immunomodulatory effect that shifts toward a prochondrogenic state while reducing cell damage.⁸

Multipotent mesenchymal stem cells (MSCs) have been extensively investigated for their potential as cell-based therapies targeting immune-mediated, inflammatory, and degenerative diseases.^9,10 These cells exhibit inherent immunosuppression, immunomodulation, and tissue regeneration capabilities.^11,12 Human umbilical cord MSCs (hUC-MSCs) have several advantages over other MSCs, including easy availability, minimal immune rejection, and excellent immunomodulatory effects.¹³ In addition, these cells can be harvested from discarded tissue.^14,15 We previously reported the potential immunomodulatory and anti-inflammatory effects of hUC-MSCs for treating TMJOA.¹⁶ To enhance the immunomodulatory effect of MSCs, various priming methods are being investigated through the stimulation of MSCs in numerous recent studies as indicated by a review article.¹⁷ Among many methods, MSCs can be primed by treating them with proinflammatory cytokines or growth factors. This preparatory step induces a primed state in the MSCs, leading to the increased expression of immunomodulatory factors essential for cellular homeostasis.¹⁸ In this study, we primed hUC-MSCs with interferon-gamma (IFN-γ), which enhances the immunosuppressive properties of MSCs.¹⁹ This approach was used to enhance the immunosuppressive capacity of hUC-MSCs and augment their production of anti-inflammatory and immunomodulatory substances.

Recent literature suggests that polarized macrophages have strong potential in OA therapeutics.²⁰ The ability to suppress M1 macrophages or induce M2 polarization can substantially alleviate OA symptoms.^21,22 Macrophages, as key players in innate immunity, possess a remarkable degree of plasticity.²³ hUC-MSCs can also promote the polarization of M2-type macrophages and the expression of anti-inflammation-related cytokines.^24,25

In this study, we explored whether inflammatory cytokine-stimulated hUC-MSCs (primed hUC-MSCs) have therapeutic effects on TMJOA and whether these MSCs can induce the conversion of macrophages to the anti-inflammatory M2 phenotype.²⁶ In addition, we investigated whether MSCs can shift to the M2 phenotype even in an inflammatory environment by stimulating macrophages with lipopolysaccharide (LPS).^27,28 We compared the effects of macrophage polarization between MSCs primed with IFN-γ and naïve MSCs. A TMJOA rat model and primed hUC-MSC injections were used to confirm these results in vivo.

Materials and Methods

Cell culture and treatment

RAW264.7 murine macrophages were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). These cells were cultured at 5% CO₂ at 37°C in Dulbecco’s modified Eagle medium/F12 supplemented with 10% fetal bovine serum and 1% penicillin streptomycin. The RAW264.7 cells were activated with IFN-γ (2.5 ng/mL) and LPS (200 ng/mL) to polarize the cells to M1-like macrophages.

hUC-MSCs were obtained from CELLnLIFE, Inc. (Seoul, Korea). hUC-MSCs expressed CD73, CD90, and CD105 (Supplementary Fig. S1). These cells were cultured with 5% CO₂ at 37°C in a minimum essential medium supplemented with 10% fetal bovine serum and 1% penicillin streptomycin. hUC-MSCs were stimulated with IFN-γ for 24 h. IFN-γ was diluted to a final concentration of 200 U/mL in the medium. hUC-MSCs from passages 3–6 were used in all experiments.

Flow cytometry analysis

We conducted flow cytometry analysis to assess cell membrane protein expression, following established protocols. hUC-MSCs were treated with antibodies in a cold-blocking buffer for 1 h. Antibodies against CD73-PE, CD45-PE, CD90-PE, CD105-PE, CD11b-PE, CD19-PE, and HLA-DR-PE (BD Biosciences, Franklin Lake, NJ, USA) were used. Data from 25,000 events were collected using BD FACS CANTO II (Becton Dickinson and Company, Franklin Lakes, NJ, USA).

Coculture of macrophages and hUC-MSCs

RAW264.7 cells were seeded into a 24-well plate at a density of 5 × 10⁴ cells/well. LPS (200 ng/mL) was used to activate the RAW264.7 cells in Dulbecco’s modified Eagle medium. Next, naïve hUC-MSCs and primed hUC-MSCs seeded in the trasnswell with activated RAW264.7 cells at a cell ratio of 1:1. After 24, 48, or 72 h, the cells were collected for RNA and protein extraction and analysis. Monocultures of activated-M1-like macrophages were used as controls.

Quantitative real-time polymerase chain reaction

Total RNA was extracted using an RNeasy^® Mini Kit (QIAGEN, Hilden, Germany). RNA was converted to cDNA using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA). Quantitative reverse transcription-polymerase chain reaction (PCR) was performed using Applied Biosystems™ Power SYBR™ Green Master Mix on an Applied Biosystems^® QuantStudio™ 6 Flex Real-Time PCR System (Foster City, CA, USA). PCR was performed using gene-specific primers for the M1-related genes inducible nitric oxide synthase (iNOS), interleukin 6 (Il-6), interleukin 12 beta (Il-12β), tumor necrosis factor-alpha (Tnf-α), and interleukin 1 beta (Il-1β) and M2-related genes arginase 1 (Arg1) and interleukin 10 (Il-10), as well as for glyceraldehyde 3-phosphate dehydrogenase (Table 1). The expression of all genes was normalized to that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

Table 1.

Murine Primers Used for PCR Amplification

Marker
M1-related genes
Tnf-α	CTCAGCGAGGACAGCAAGG	AGGGACAGAACCTGCCTGG	108 bp
Il-1β	TGAAGCAGCTATGGCAACTG	GGGTCCGTCAACTTCAAAGA	94 bp
Il-6	AACGATGATGCACTTGCAGA	GGTACTCCAGAAGACCAGAGGA	127 bp
Il-12β	GTGGAATGGCGTCTCTGTCT	GGTCTGGTTTGATGATGTCCCT	204 bp
iNOS	AACGGAGAACGTTGGATTTG	CAGCACAAGGGGTTTTCTTC	147 bp
M2-related genes
Arg-1	GACAGGGCTCCTTTCAGGAC	GCCAAGGTTAAAGCCACTGC	108 bp
Il-10	TGAATTCCCTGGGTGAGAAG	TGGCCTTGTAGACACCTTGG	147 bp
Housekeeping gene
GAPDH	TGGCAAAGTGGAGATTGTTGCC	AAGATGGTGATGGGCTTCCCG	156 bp

Enzyme-linked immunosorbent assay

RAW264.7 cells were placed in the transwell, whereas primed/naïve hUC-MSCs were placed in the 24-well plate. After coculture, the supernatants of primed/naïve hUC-MSCs were collected and quantitatively analyzed for indoleamine 2,3-dioxygenase (IDO) expression. IDO levels were measured using enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s protocol.

Experimental animals

Sprague–Dawley rats (female, weighing 230 ± 13 g) were purchased from Orient Bio, Inc. (Seongnam, Korea). All rats were randomly divided into four groups: (1) normal group, (2) OA group, (3) naïve hUC-MSC injection (NM) group, and (4) primed hUC-MSC injection (PM) group. The OA model was induced using monoiodoacetate (MIA). The TMJs of rats were injected intra-articularly with 0.05 mL (0.5 mg/50 μL) of MIA once.²⁹ At 2 weeks after inducing TMJOA, the rats were injected intra-articularly with naïve or primed hUC-MSCs (10⁵ cells/0.05 mL). All rats were sacrificed at 2, 4, and 8 weeks after MSC injection.

In vivo microcomputed tomography images of the subchondral bone

Microcomputed tomography (CT) images of condyle were obtained using an in vivo animal scanner (SkyScan 1176; Bruker-microCT, Kontich, Belgium). Scanning was performed using the following settings: X-ray source voltage of 50 kVp, current of 500 μA, pixel size of 12.64 μm, and exposure time of 60 ms. Cross-sectional images were reconstructed using a filtered back-projection algorithm (NRecon, Skyscan, Bruker). To assess anatomical changes in the articular structures across groups, three-dimensional images were obtained using CTvox (Bruker).

Head withdrawal threshold measurement

The mechanical sensitivity of the rats was assessed using the von Frey microfilament method following established procedures with the use of Aesthesio^® Precisie tactile sensory evaluators (Danmic Global, LCC, CA, USA).^29,30 This method assesses the minimal force needed to trigger reflexive responses like head withdrawal, eye closure, or body shaking upon TMJ stimulation in rats. Beginning with the lowest force (filament gauge), a series of filaments was applied to the preauricular area to activate the TMJ position. The head withdrawal threshold (HWT) was determined as the lowest force required to elicit withdrawal at least three times. These evaluations were performed on a weekly basis, with the HWT calculated as the average value per joint from four rats per group. The experiment was performed twice by two researchers in a blinded manner regarding the group designations of the rats.

Histology staining and immunohistochemical analysis

The repaired cartilage tissues in the TMJ of rats were retrieved and underwent histopathological analysis. The collected specimens were fixed with 10% neutral buffered formalin and then decalcified with 0.5 M ethylene diamine tetra acetic acid (EDTA) for 28 days. The decalcified samples were embedded using paraffin wax. The cartilage was sectioned at 5 μm and stained with hematoxylin and eosin and Safranin O/Fast green. The alteration in TMJOA cartilage tissue was evaluated using a modified Mankin score (Table 2).^16,31 The histological score of the specimens was calculated by two researchers who were blinded to the experimental conditions. For immunohistochemical analysis, 5-μm-thick sections of cartilage tissue were treated with primary antibodies against CD68 (ab125212, Abcam, Cambridge, UK) as a macrophage total marker, and CD163 (ab182422, Abcam) and CD206 (ab64693, Abcam) as M2 markers.

Table 2.

Modified Mankin Score

Parameters	Grade
Pericellular Safranin O staining
Normal	0
Slightly enhanced	1
Intensely enhanced	2
Background Safranin O staining
Normal	0
Slightly increased or decreased	1
Severe increase or decrease	2
No staining	3
Arrangement of chondrocytes
Normal	0
Appearance of clustering	1
Hypocellularity	2
Cartilage structure
Normal	0
Fibrillation in the superficial layer	1
Fibrillation beyond the superficial layer	2
Missing articular cartilage	3

Statistical analysis

All data are presented as mean ± standard deviation. The statistical significance of the differences was evaluated using the t-test or ANOVA test. Correlation analysis and coefficient calculation were performed with GraphPad Prism (GraphPad Software version 10, CA, USA). ImageJ software (version 1.53t, NIH, Bethesda, MD, USA) was used to analyze and statistically process the images. A p value < 0.05 was considered to indicate a significant difference.

Experiment

Primed hUC-MSCs promote polarization to M2 macrophages in vitro

To determine an appropriate cell model for further experiments, we initially characterized M1-like macrophages by assessing the expression of typical markers. We induced RAW264.7 polarization to the M1 phenotype using LPS and IFN-γ, resulting in upregulation of the mRNA expression of Il-1β, Tnf-α, iNOS, Il-6, and Il-12β. In subsequent coculture experiments, we used activated-M1-like macrophages to mimic inflammatory conditions (Fig. 1a). Polarization of macrophages has been linked to OA progression.³² Therefore, we investigated the influence of naïve hUC-MSCs and primed hUC-MSCs on macrophage polarization using a coculture system with RAW264.7 cells (Fig. 1b). As shown in Figure 1c, stimulation by naïve and primed hUC-MSCs led to upregulation of Arg1 and Il-10 mRNA expression, which are markers of M2 macrophages. These results indicate that both hUC-MSC types promote the polarization of macrophages toward the M2-type. Primed hUC-MSCs more effectively induced M0 to M2 macrophage polarization than naïve hUC-MSCs, as indicated by stronger upregulation of Arg1.

FIG. 1.

hUC-MSCs promote the transformation of macrophages from M0 and M1 to M2 type. (a) RAW264.7 stimulated by LPS polarize to M1-like macrophages. Relative mRNA expression of the M1-related genes Tnf- α, Il-1β, iNOS, Il-6, and Il-12 β was determined using quantitative RT-PCR. (b) Schematic representation of the in vitro coculture system. hUC-MSCs were cultured on the upper transwell inserts in multiwell plates containing RAW264.7 cells. (c) RAW264.7 was shifted from the M0 state to the M2 state. Relative mRNA expression of the critical genes Arg-1 and Il-10 was determined in polarized macrophages using quantitative RT-PCR. (d) RAW264.7 cells polarized from M1 to M2 types. Relative mRNA expression of the critical genes Arg1, Il-10, Il-6, Il-1β, and iNOS was determined in polarized macrophages using quantitative RT-PCR. (e) ELISA. Determination of IDO in supernatants. Data from triplicate experiments are presented as the mean ± S.D. *p < 0.05, **p < 0.01, and ***p < 0.005. ELISA, enzyme-linked immunosorbent assay; hUC-MSC, human umbilical cord mesenchymal stem cell; IDO, indoleamine 2,3-dieoxygenase; LPS, lipopolysaccharide; RT-PCR, reverse transcription polymerase chain reaction.

In the OA environment, M1 macrophages secrete proinflammatory factors. To investigate whether naïve and primed hUC-MSCs affect the polarization of M1 to M2 macrophages, we separately cocultured these cells with M1-like macrophages. As shown in Figure 1d, stimulation by both naïve and primed hUC-MSCs upregulated the expression of the M2 markers Arg1 and IL-10 mRNA while noticeably downregulating the mRNA expression of the M1 markers Il-1β, iNOS, and Il-6. These results indicate that both naïve and primed hUC-MSCs can promote the polarization of M1 macrophages towards the M2-type. Notably, macrophages cocultured with primed hUC-MSCs exhibited higher upregulation Arg-1 mRNA expression (M2-related gene) and greater downregulation of Il-1b and iNOS mRNA expression (M1-related gene) compared with those cocultured with naïve hUC-MSCs. This result demonstrates that primed hUC-MSCs are more efficient than naïve hUC-MSCs in polarizing macrophage from the M1 to the M2-type. There was no significant difference in Il-10 and Il-6 mRNA expression.

Comparing the mRNA expression levels of Arg-1 and Il-10 in Figure 1c and Figure 1d, respectively, it can be observed that both types of hUC-MSCs exhibit more effective M0–M2 polarization than M1–M2 polarization.

MSCs secrete the immunoregulatory factor IDO, which suppresses T-cell responses. IDO secretion was quantified using ELISA, revealing that IDO secretion from primed hUC-MSCs was approximately eightfold higher than that from naïve hUC-MSCs (Fig. 1e). To predict the responses of primed/naïve hUC-MSCs in an inflammatory environment, we used a coculture system with RAW264.7 cells. Both naïve and primed hUC-MSC exhibited a twofold increase in IDO secretion compared with that under monoculture conditions.

Primed hUC-MSCs increased the ratio of M2 macrophages in vivo

M2 macrophages exert anti-inflammatory effects that contribute to tissue repair and alleviate inflammation.³³ Immunostaining was conducted to analyze the immunomodulation ability of primed hUC-MSCs and naïve hUC-MSCs on macrophage polarization to M2 in the MIA-induced TMJOA model. After inducing TMJOA by injecting MIA, in the OA, NM, and PM groups, the total number of macrophages (CD68) increased compared with the normal group (Fig. 2a). As shown in Figure 2b, injection of both hUC-MSCs remarkably promoted M2 macrophage polarization in contrast to in the OA group. This effect was substantiated by the elevated expression of CD163 and CD206 (Supplementary Fig. S2), which were evident in the synovial tissue of both the primed and naïve hUC-MSC treatment groups. Notably, compared with the naïve hUC-MSC group, the primed hUC-MSC group exhibited greater enhancement of M2 macrophage ratio (Fig. 2c). Immunostaining showed that primed hUC-MSCs mitigated inflammation and protected against cartilage degradation in the TMJOA model by inducing M2 macrophage polarization.

FIG. 2.

M2/macrophage ratio increased in the PM group. (a) Detection of CD68 (macrophage marker) using immunohistochemistry in RAW264.7 cells and statistical results. Scale bar: 50 μm. ImageJ analysis for CD68. (b) Detection of CD163 (M2 marker) using immunohistochemistry in RAW264.7 cells and statistical results. Scale bar: 20 μm. ImageJ analysis for CD163. (c) M2/macrophage (M1 + M2) ratio; average values were obtained by analyzing photos of three samples per group using ImageJ software. *p < 0.05, **p < 0.01, and ***p < 0.005.

Primed hUC-MSCs and naïve hUC-MSCs effectively alleviated pain in the TMJOA rat model

To investigate the effects of primed and naïve hUC-MSCs on TMJOA in vivo, we established a TMJOA rat model using MIA for an observation period of 10 weeks (Fig. 3a). Measurement of the HWT (Fig. 3b) showed that in the OA group, pain responses gradually eased over time. Notably, the groups injected with primed and naïve hUC-MSCs experienced faster pain relief compared with that in the OA group. However, there was no significant difference between the NM and PM groups.

FIG. 3.

Pain response over time in the TMJOA rat model. (a) In vivo schematic diagram. (b) TMJ HWT measurement graph. NM and PM groups experienced faster pain relief compared with that in the OA group; Biological replicates: n = 4; technical replicates: n = 2. Data are represented as the mean ± S.D. *p < 0.05, **p < 0.01, and ***p < 0.005 between OA and NM groups. ^#p < 0.05, ^##p < 0.01, and ^###p < 0.005 compared between OA group and PM group. HWT, head withdrawal threshold; NM, naïve MSC injection; OA, osteoarthritis; PM, primed MSC injection; TMJ, temporomandibular joint; TMJOA, temporomandibular joint osteoarthritis.

Primed hUC-MSCs promote TMJ recovery in a TMJOA rat cartilage

Safranin O/Fast green staining revealed extensive proteoglycan loss in the OA group (Fig. 4a). In contrast, proteoglycans in the naïve and primed hUC-MSC groups were increased at 2, 4, and 8 weeks compared with those in the OA groups. Importantly, the primed hUC-MSC group exhibited higher proteoglycan production than the naïve hUC-MSC group, suggesting that primed hUC-MSCs ameliorated TMJOA progression caused by MIA, resulting in a superior therapeutic effect compared with that of naïve hUC-MSCs. In addition, hematoxylin and eosin staining confirmed severe cartilage erosion in the OA group, whereas both the naïve and primed hUC-MSC groups showed smooth and intact cartilage surfaces. Notably, the PM group exhibited a more improved cartilage surface compared with that in the NM group (Fig. 4b). Morphological changes in the TMJ articular cartilage were assessed based on the modified Mankin score (Table 2).^16,31 As shown in Figure 4c, the PM group showed the lowest scores among all groups, except for the normal group. These results indicate that primed hUC-MSCs strongly alleviate OA in vivo.

FIG. 4.

Cartilage regeneration after injection of primed hUC-MSCs. (a) Representative images of Safranin O and Fast green staining in synovial tissue. Scale bar: 100 μm. (b) Representative images of H&E staining in synovial tissue. Scale bar: 100 μm. (c) Cartilage destruction evaluated using the modified Mankin score. Average values were obtained by analyzing safranin O-stained images of three samples per group; technical replicates: n = 2. *p < 0.05, **p < 0.01, and ***p < 0.005. H&E, hematoxylin and eosin; hUC-MSC, human umbilical cord mesenchymal stem cell.

As shown in Figure 5a, MIA-injected rats exhibited characteristic morphological changes of TMJOA, including cartilage surface erosion and subchondral bone damage, compared with normal rats. However, in the PM group, the TMJ cartilage was significantly recovered. In contrast, the OA group displayed limited improvement in the articular cartilage surfaces of TMJOA rats.

FIG. 5.

In vivo microcomputed tomography three-dimensional images of rat TMJ condylar head. Normal TMJ of rat image, MIA-induced TMJOA of rat model image at 2, 4, and 8 weeks in NM or PM groups. hUC-MSC, human umbilical cord mesenchymal stem cell; MIA, monoiodoacetate; NM, naïve MSC injection; PM, primed MSC injection; TMJ, temporomandibular joint; TMJOA, temporomandibular joint osteoarthritis.

Discussion

TMJOA is characterized by cartilage degradation, subchondral bone remodeling, and persistent synovial inflammation. Inflammatory cytokines disrupt the metabolic balance of articular chondrocytes as OA progresses, leading to cell death and extracellular matrix breakdown.³⁴ In addition, chronic inflammation can compromise the adaptive capacity of the TMJ.³⁵ Therefore, counteracting inflammation is crucial in preventing OA development, with the synovial macrophage phenotype closely linked to inflammation.^36,37

Macrophages are immune cells present in nearly all tissues. Their principal function is maintaining tissue homeostasis and safeguarding against infections. Macrophages can polarize into two phenotypes: M1 (proinflammatory) and M2 (anti-inflammatory) types. Fahy et al. demonstrated that M1 macrophages in OA synovial tissue hinder the chondrogenic differentiation of MSCs in vitro via IL-6.³⁸ Ding et al. indicated that M2 macrophages counteract inflammation by releasing IL-10, promoting cartilage graft viability.³⁹ Strategies aimed at curbing M1 macrophages or promoting M2 polarization show considerable potential for alleviating OA symptoms. hUC-MSCs have the potential to induce M2-type macrophage activation and the expression of anti-inflammatory cytokines. We primed hUC-MSCs with IFN-γ to enhance their anti-inflammatory capabilities and promote a more effective M2 shift, after which we compared the therapeutic effects of primed and naïve hUC-MSCs on TMJOA.

To achieve a therapeutic effect by alleviating inflammation in TMJOA, we verified the relationship between this finding and M2 transition through in vitro experiments using a coculture system with hUC-MSCs. Our results showed that hUC-MSCs can shift from the M0 and M1 states to the M2 state. Following coculture, M2 markers such as Arg-1 and Il-10 were increased. ARG-1 functions in wound healing, and IL-10 has a prochondrogenic effect, which may have therapeutic implications for TMJOA. Moreover, in activated RAW264.7 cells (M1), the M1 state was inhibited, as evidenced by the reduction in inflammatory molecules (M1 markers), including Il-6, Il-1β, and iNOS. This shift resulted in suppression of inflammatory cytokine expression and augmentation of anti-inflammatory cytokine expression. Furthermore, primed hUC-MSCs had a more pronounced effect on macrophage polarization compared with that of naïve MSCs.

Kanglu et al. demonstrated that extracellular vesicles derived from hUC-MSCs can promote the polarization of M2 macrophages in vitro.⁴⁰ In our study, we demonstrated that hUC-MSCs enhance M2 macrophage polarization through paracrine effect. According to our results, these were supported by the secretion of IDO. The expression intensity of IDO modulates macrophage differentiation.⁴¹ After stimulating hUC-MSCs with IFN-γ, secretion of the immunoregulatory molecule IDO was increased. When we cocultured naïve or primed hUC-MSCs with RAW264.7 cells activated into M1, the secretion of IDO was increased. This result indicates that primed hUC-MSCs exhibited an even more pronounced boost, and even naïve hUC-MSCs influenced the inflammatory environment. Elevated IDO secretion may enhance the immunosuppressive capacity of hUC-MSCs, which in turn may impact the suppression of M1 macrophages and differentiation into M2 macrophages.

In addition, in the in vivo experiment, the ratio of M2 marker-positive cells increased more significantly in the PM group compared with that in the NM group. This observation confirms that primed hUC-MSCs are more effective in driving the macrophage polarization toward the M2 type.

In the in vivo TMJOA rat model, the pain response in the OA group was gradually alleviated over time, indicating a self-healing process. Rats injected with naïve and primed hUC-MSCs exhibited faster pain relief compared with that in the OA group. These results confirm the effectiveness of primed and naïve hUC-MSCs injection in treating TMJOA. Although there was no significant difference in the pain response between groups, notable distinctions were apparent in the morphological changes of the TMJ. Remarkably, the PM group showed accelerated TMJ recovery compared with that in the NM group, as demonstrated by faster and more effective recovery of the cartilage and subchondral bone and the production of proteoglycans in the primed hUC-MSC group compared with that in the naïve hUC-MSC group. These findings support that primed hUC-MSCs promoted TMJ recovery and facilitated the conversion of macrophages into the M2-type. We demonstrated that primed hUC-MSCs may have therapeutic effects on TMJOA.

Conclusion

hUC-MSCs stimulated with IFN-γ-modulated macrophage polarization, creating an anti-inflammatory microenvironment that supported cartilage repair. These results demonstrate the promising role of these cells in TMJOA treatment, offering a novel avenue for OA management.

Footnotes

Acknowledgments

The authors thank members of their laboratory for their analysis and comments on the article.

Ethics statement

hUC-MSCs were obtained from CELLnLIFE, Inc. (Seoul, Korea). This study received approval from the Public Institutional Bioethics Committee designated by the Ministry of Health & Welfare (IRB No.2020-1825-011). All animal experiments adhered to the relevant guidelines and regulations set forth by the Institutional Animal Care and Use Committee of the Asan Institute for Life Sciences, Asan Medical Center (IACUC, Approval No. 2021-12-208).

Authorship Contribution Statements

Y.K.: Conducting research, executing the study, managing data, and drafting the article. H.K.: Designing the study and conducting research. S.-Y.Y.: Executing the study. B.-K.L.: Corresponding author, conceptualizing and designing the study, and drafting and critically revising the article. All authors reviewed and approved the final article.

Authors Disclosure Statements

The authors have no competing interests to disclose.

Funding Information

This research was supported by a grant from the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health & Welfare, Republic of Korea (grant number: H21C0168).

Supplementary Material

References

Liu

, Zhao

, Jiang

, et al. ALPK1 aggravates TMJOA cartilage degradation via NF-κB and ERK1/2 signaling. J Dent Res, 2022; 101(12):1499–1509; doi: 10.1177/00220345221100179

Gauer

, Semidey

. Diagnosis and treatment of temporomandibular disorders. Am Fam Physician, 2015; 91(6):378–386.

Jiang

, Xu

, Liu

, et al. Chronic pain causes peripheral and central responses in MIA-induced TMJOA rats. Cell Mol Neurobiol, 2021; 42(5):1441–1451; doi: 10.1007/s10571-020-01033-8

Machon

, Hirjak

, Lukas

. Therapy of the osteoarthritis of the temporomandibular joint. J Craniomaxillofac Surg, 2011; 39(2):127–130; doi: 10.1016/j.jcms.2010.04.010

Doherty

. Risk factors for progression of knee osteoarthritis. Lancet, 2001; 358(9284):775–776; doi: 10.1016/S0140-6736(01)06006-8

Utomo

, Bastiaansen-Jenniskens

, Verhaar

, et al. Cartilage inflammation and degeneration is enhanced by pro-inflammatory (M1) macrophages in vitro, but not inhibited directly by anti-inflammatory (M2) macrophages. Osteoarthritis Cartilage, 2016; 24(12):2162–2170; doi: 10.1016/j.joca.2016.07.018

Van der Kraan

, Van den Berg

. Chondrocyte hypertrophy and osteoarthritis: Role in initiation and progression of cartilage degeneration? Osteoarthritis Cartilage, 2012; 20(3):223–232; doi: 10.1016/j.joca.2011.12.003

Dai

, Sui

, Xue

, et al. Cartilage repair in degenerative osteoarthritis mediated by squid type II collagen via immunomodulating activation of M2 macrophages, inhibiting apoptosis and hypertrophy of chondrocytes. Biomaterials, 2018; 180:91–103; doi: 10.1016/j.biomaterials.2018.07.011

Sala

, Genua

, Pett

, et al. Mesenchymal stem cells reduce colitis in mice via release of TSG6, independently of their localization to the intestine. Gastroenterology, 2015; 149(1):163–176; doi: 10.1053/j.gastro.2015.03.013

10.

Soler

, Orozco

, Munar

, et al. Final results of a phase I–II trial using ex vivo expanded autologous mesenchymal stromal cells for the treatment of osteoarthritis of the knee confirming safety and suggesting cartilage regeneration. Knee, 2016; 23(4):647–654; doi: 10.1016/j.knee.2015.08.013

11.

Regmi

, Pathak

, Kim

, et al. Mesenchymal stem cell therapy for the treatment of inflammatory diseases: Challenges, opportunities, and future perspectives. Eur J Cell Biol, 2019; 98(5–8):151041; doi: 10.1016/j.ejcb.2019.04.002

12.

, Wang

, Nian

, et al. Mesenchymal stem cells for treating autoimmune dacryoadenitis. Stem Cell Res Ther, 2017; 8(1):126; doi: 10.1186/s13287-017-0593-3

13.

Ding

, Chang

, Shyu

, et al. Human umbilical cord mesenchymal stem cells: A new era for stem cell therapy. Cell Transplant, 2015; 24(3):339–347; doi: 10.3727/096368915X686841

14.

, Chai

, Jeong

, et al. Intra-articular injection of mesenchymal stem cells for the treatment of osteoarthritis of the knee: A 2-year follow-up study. Am J Sports Med, 2017; 45(12):2774–2783; doi: 10.1177/0363546517716641

15.

Liu

, He

, Zheng

, et al. Human umbilical cord mesenchymal stem cells ameliorate acute liver failure by inhibiting apoptosis, inflammation and pyroptosis. Ann Transl Med, 2021; 9(21):1615; doi: 10.21037/atm-21-2885

16.

Kim

, Yang

, Park

, et al. Therapeutic effect of mesenchymal stem cells derived from human umbilical cord in rabbit temporomandibular joint model of osteoarthritis. Sci Rep, 2019; 9(1):13854; doi: 10.1038/s41598-019-50435-2

17.

Noronha

NDC

, Mizukami

, Caliári-Oliveira

, et al. Priming approaches to improve the efficacy of mesenchymal stromal cell-based therapies. Stem Cell Res Ther, 2019; 10(1):131; doi: 10.1186/s13287-019-1224-y

18.

Prasanna

, Gopalakrishnan

, Shankar

, et al. Pro-inflammatory cytokines, IFNγ and TNFα, influence immune properties of human bone marrow and Wharton jelly mesenchymal stem cells differentially. PLoS One, 2010; 5(2):e9016; doi: 10.1371/journal.pone.0009016

19.

Sivanathan

, Gronthos

, Rojas-Canales

, et al. Interferon-gamma modification of mesenchymal stem cells: Implications of autologous and allogeneic mesenchymal stem cell therapy in allotransplantation. Stem Cell Rev Rep, 2014; 10(3):351–375; doi: 10.1007/s12015-014-9495-2

20.

Zhang

, Cai

, Bai

. Macrophages regulate the progression of osteoarthritis. Osteoarthritis Cartilage, 2020; 28(5):555–561; doi: 10.1016/j.joca.2020.01.007

21.

Liu

, Zhang

, Zhao

, et al. Imbalance of M1/M2 macrophages is linked to severity level of knee osteoarthritis. Exp Ther Med, 2018; 16(6):5009–5014; doi: 10.3892/etm.2018.6852

22.

, Gui

, Zhou

, et al. Quercetin alleviates rat osteoarthritis by inhibiting inflammation and apoptosis of chondrocytes, modulating synovial macrophages polarization to M2 macrophages. Free Radic Biol Med, 2019; 145:146–160; doi: 10.1016/j.freeradbiomed.2019.09.024

23.

Rőszer

. Understanding the mysterious M2 macrophage through activation markers and effector mechanisms. Mediators Inflamm, 2015; 2015:816460; doi: 10.1155/2015/816460

24.

Liu

, Qiu

, Xue

, et al. MSC-secreted TGF-β regulates lipopolysaccharide-stimulated macrophage M2-like polarization via the Akt/FoxO1 pathway. Stem Cell Res Ther, 2019; 10(1):315–345; doi: 10.1186/s13287-019-1447-y

25.

Vasandan

, Jahnavi

, Shashank

, et al. Human mesenchymal stem cells program macrophage plasticity by altering their metabolic status via a PGE2-dependent mechanism. Sci Rep, 2016; 6(1):38308; doi: 10.1038/srep38308

26.

Fernandes

, Gomoll

, Lattermann

, et al. Macrophage: A potential target on cartilage regeneration. Front Immunol, 2020; 11:111; doi: 10.3389/fimmu.2020.00111

27.

Jin

, Kim

, Na

, et al. Anti-inflammatory effects of mesenchymal stem cell-conditioned media inhibited macrophages activation in vitro. Sci Rep, 2022; 12(1):4754; doi: 10.1038/s41598-022-08398-4

28.

Song

, Kang

, Hong

, et al. Umbilical cord-derived mesenchymal stem cell extracts reduce colitis in mice by re-polarizing intestinal macrophages. Sci Rep, 2017; 7(1):9412; doi: 10.1038/s41598-017-09827-5

29.

Yun

, Kim

, et al. Effective technical protocol for producing a mono-iodoacetate-induced temporomandibular joint osteoarthritis in a rat model. Tissue Eng Part C Methods, 2023; 29(9):438–445; doi: 10.1089/ten.tec.2023.0066

30.

Ren

. An improved method for assessing mechanical allodynia in the rat. Physiol Behav, 1999; 67(5):711–716; doi: 10.1016/S0031-9384(99)00136-5

31.

Shen

, Jiao

, Zheng

, et al. Injecting vascular endothelial growth factor into the temporomandibular joint induces osteoarthritis in mice. Sci Rep, 2015; 5:16244; doi: 10.1038/srep16244

32.

Chen

, Jiang

, Yong

, et al. Macrophages in osteoarthritis: Pathophysiology and therapeutics. Am J Transl Res, 2020; 12(1):261–268.

33.

Ummarino

, Gambaro

, Kon

, et al. Therapeutic manipulation of macrophages using nanotechnological approaches for the treatment of osteoarthritis. Nanomaterials (Basel), 2020; 10(8):1562; doi: 10.3390/nano10081562

34.

Lieberthal

, Sambamurthy

, Scanzello

. Inflammation in joint injury and post-traumatic osteoarthritis. Osteoarthritis Cartilage, 2015; 23(11):1825–1834; doi: 10.1016/j.joca.2015.08.015

35.

Wang

, Zhang

, Gan

, et al. Current understanding of pathogenesis and treatment of TMJ osteoarthritis. J Dent Res, 2015; 94(5):666–673; doi: 10.1177/0022034515574770

36.

Sun

, Zuo

, Kuang

. An emerging target in the battle against osteoarthritis: Macrophage polarization. Int J Mol Sci, 2020; 21(22):8513; doi: 10.3390/ijms21228513

37.

Liu

, Zhang

, Zhu

, et al. Sinomenine inhibits the progression of rheumatoid arthritis by regulating the secretion of inflammatory cytokines and monocyte/macrophage subsets. Front Immunol, 2018; 9:2228; doi: 10.3389/fimmu.2018.02228

38.

Fahy

, De Vries-Van Melle

, Lehmann

, et al. Human osteoarthritic synovium impacts chondrogenic differentiation of mesenchymal stem cells via macrophage polarisation state. Osteoarthritis Cartilage, 2014; 22(8):1167–1175; doi: 10.1016/j.joca.2014.05.021

39.

Jinping

, Chen

, Tao

, et al. Bone marrow mesenchymal stem cell-based engineered cartilage ameliorates polyglycolic acid/polylactic acid scaffold-induced inflammation through M2 polarization of macrophages in a pig model. Stem Cells Transl Med, 2016; 5(8):1079–1089; doi: 10.5966/sctm.2015-0263

40.

, Yan

, Huang

, et al. Anti-inflammatory and immunomodulatory effects of the extracellular vesicles derived from human umbilical cord mesenchymal stem cells on osteoarthritis via M2 macrophages. J Nanobiotechnology, 2022; 20(1):20–38; doi: 10.1186/s12951-021-01236-1

41.

Wang

, Wang

, et al. The role of indoleamine 2, 3-dioxygenase (IDO) in immune tolerance: Focus on macrophage polarization of THP-1 cells. Cell Immunol, 2014; 289(1–2):42–48; doi: 10.1016/j.cellimm.2014.02.005

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

1.20 MB

0.00 MB