Profiles of Exosomal microRNAs in Joint Cells and Candidate microRNAs for Cartilage Regeneration

Abstract

The activation of chondrogenic progenitor cells (CPCs) in articular cartilage during a traumatic injury is vital for cartilage regeneration. Although our understanding of the mechanisms underlying CPC chondrogenic activation remains incomplete, there is evidence that exosomal microRNAs (miRNAs or miRs) are involved in tissue healing due to their regulating role of posttranscriptional gene expressions. In this study, we profiled enriched and differential expression of miRNAs in exosomes derived from bovine joint cells (CPCs, chondrocytes, and synoviocytes) via Next Generation Sequencing analysis and validated the potential therapeutic effects of candidate exosomal miRNAs for cartilage regeneration. For CPC-based cartilage regeneration, we tested the impact of administering miR-107, miR-140, and miR-148a on CPCs because we found that these miRNAs were highly and differentially expressed in chondrocytes-derived exosomes (CC-Exo). We found that: (1) miR-140 induced chondrogenic gene expression including SRY-box transcription factor 9, collagen type 2A1, and aggrecan, and (2) miR-107 suppressed catabolic gene expression including matrix metalloproteinase 3, a disintegrin and metalloproteinase with thrombospondin motifs 5, and nitric oxide synthase 2. Our findings indicate that transfection of CPCs with specific chondrogenic miRNAs present in CC-Exo have the potential to promote CPC-based cartilage regeneration and could be an important component of posttraumatic osteoarthritis prevention.

Impact Statement

Chondrocytes, chondrogenic progenitor cells (CPCs), and synoviocytes secrete exosomal microRNAs (miRNAs) that contribute to joint health and disease. These miRNAs could also have important implications for improving cartilage repair and regeneration. In this study, we identified candidate miRNAs that were enriched in chondrocytes-derived exosomes and found that these miRNAs induced chondrogenic gene expression or suppressed catabolic gene expression in a CPC monolayer culture system. These findings suggest that miRNA-based cartilage repair strategies could be developed to regenerate damaged and diseased cartilage.

Introduction

Joint injuries can often cause focal cartilage lesions that expand over time and eventually result in cartilage degeneration and posttraumatic osteoarthritis (PTOA). PTOA, the most common disabling condition worldwide, is estimated to account for over 10% of all cases of osteoarthritis (OA).^1–3 Thus, early intervention to repair focal lesions is essential to preventing disease progression.⁴ Autologous chondrocyte transplantation is a clinical technique used to treat cartilage focal defects.^5–7 Besides autologous chondrocytes, mesenchymal stem cells (MSCs) such as bone marrow stromal cells,^8,9 adipose-derived stem cells (ADSCs),¹⁰ and umbilical cord MSCs^11,12 have also been investigated for their potential of cell-based cartilage regeneration. However, chondrocyte expansion is challenging because these cells quickly lose their chondrogenic phenotype in culture.¹³ Similarly, MSC transplantation can result in hypertrophic differentiation and subsequent endochondral ossification.¹⁴ A cell homing strategy that obviates the need for cell isolation and expansion by attracting endogenous host cells into the injured tissue is a promising approach. In the previous study, we found a distinct population of endogenous chondrogenic progenitor cells (CPCs) that spontaneously congregated at injured sites of bovine cartilage and differentiated into chondrocytes with proteoglycan-rich extracellular matrix (ECM) when exposed with exogenous chemotactic (stromal cell-derived factor 1 alpha: SDF-1α) and chondrogenic peptides (transforming growth factor beta 1: TGF-β1, insulin-like growth factor 1: IGF-1).^15–17 Thus, a CPC-based therapy that results in CPC activation for homing and differentiation could be a key strategy for cartilage regeneration.

Exosomes are small extracellular vesicles (approximately 30–150 nm) containing deoxyribonucleic acid (DNA), ribonucleic acid (RNA), lipids, and proteins, that facilitate intercellular communication.¹⁸ Scientific and clinical interest in exosomes secreted by stem and progenitor cells has grown rapidly in recent years due to their potential to promote the repair and regeneration of injured tissues.^19,20 In particular, exosomal microRNAs (miRNAs or miRs) play an important role in targeting regulatory-related gene messenger RNAs (mRNAs), regulating posttranscriptional gene expressions, contributing cell–cell communication, and cellular processes.^21–24 However, some researchers suspect their biological effects due to low copy numbers of miRNAs in exosomes.^25,26 Despite the concerns, numerous studies have been identified the potential of MSC-derived exosomes and exosomal miRNAs for cartilage regeneration and OA treatment.²⁷ For example, miR-140 is an attractive candidate that promotes chondrogenic differentiation, cartilage development and homeostasis, and OA prevention.^28,29

In this study, we characterized exosomes derived from different joint cells (CPCs, chondrocytes, and synoviocytes) with the hypothesis that these exosomes will have cell-specific characteristics and cargoes, especially with respect to exosomal miRNAs. We then validated the potential therapeutic effects of the candidate exosomal miRNAs we identified for CPCs-based cartilage regeneration.

Materials and Methods

Joint cell isolation

A total of 4 bovine stifle joints (15–24 months old) were used in this study due to their large size to isolate cells, ready availability from a local abattoir (Bud’s Custom Meats, Riverside, IA, USA), and feasibility for a defect-injury model. The joints with any sign of swelling/inflammation, traumatic injury, and abnormal tissue color change were excluded in this study. Primary chondrocytes and CPCs were isolated from the tibia plateau including the central loaded area of the articular surface, and synoviocytes were isolated from posterior joint capsules. Briefly, finely chopped cartilage fragments were digested overnight in a 0.25% (w/v) collagenase/proteinase (Sigma-Aldrich, St. Louis, MO, USA) cocktail to isolate chondrocytes. For CPC isolation, scratch injuries were created on the surface of osteochondral explants using a sterile 26-gauge needle.¹⁶ After 10–14 days incubation, CPCs were collected by 0.1% trypsin-ethylenediaminetetraacetic acid (EDTA; Thermo Fisher Scientific). The inner membrane of the joint capsule (i.e., intima) was scraped gently with a sterile scalpel immediately after opening the capsule, and synoviocytes were isolated after washing with Hanks’ Balanced Salt Solution (HBSS; Thermo Fisher Scientific, Waltham, MA, USA) and centrifuging. All cells were cultured in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12; Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific), 100 U/mL penicillin-streptomycin (Thermo Fisher Scientific) under hypoxic conditions (5% O₂/CO₂ at 37°C). Only cells of passage 1 through 4 were used in all experiments.

Exosome isolation

The joint cells were plated in T-75 flasks at a density of 2.1 × 10⁶ cells per flask. At 40–50% confluency, the plates were washed thrice with HBSS, and culture medium was replaced with DMEM/F-12 containing 10% exosome-depleted FBS (System Biosciences, Palo Alto, CA, USA) to avoid the contamination of bovine exosomes present in regular FBS. After 48 h (h), the conditioned media (CM) were collected for exosome isolation. Highly concentrated exosomes were isolated by a modified precipitation method using an ExoQuick-TC® ULTRA extracellular vesicle isolation kit (System Biosciences). Briefly, the CM was concentrated 20–35 folds using 10 kDa Amicon® Ultra Centrifugal Filters (MilliporeSigma, Burlington, MA, USA) and then mixed with 20% (v/v) ExoQuick-TC® solution. Following overnight incubation on ice, the mixture was centrifuged at 3,000 g for 10 minutes (min) and stored in −80°C for further studies.

Characterization of exosomes

The characteristics of exosomes were confirmed by Nanoparticle Tracking Analysis (NTA), Scanning Electron Microscope (SEM), and exosome-specific antibody array. Multilaser NTA (ViewSizer 3000, HORIBA Scientific, Kyoto, Japan) was used to characterize the distribution and size of purified exosomes.³⁰ Latex beads with a 100 nm diameter (Sigma-Aldrich) were used as a reference. The exosomes stock was diluted in sterile Dulbecco’s Phosphate-Buffered Saline (DPBS, Thermo Fisher Scientific) for vesicle optimal capture and mechanically stirred for three seconds between video captures to ensure even dispersion.

For SEM imaging, silicon wafers (Ted Pella, Redding, CA, USA) were precoated with 1% aqueous poly-l-lysine solution (Thermo Fisher Scientific), dried on a 37°C sterile hot plate for up to an hour, and fixed on SEM aluminum stubs with double-sided carbon tape. A few microliters of well-mixed exosome concentrate diluted with DPBS were added to the surface-treated silicon wafers and air-dried for 15 min under sterile conditions. After coating with 5 µm-thick iridium sputters (Quorum Technologies, Sacramento, CA, USA) to improve surface conductivity, the final product was imaged in a high-resolution SEM (S-4800, Hitachi High-Tech, Ibaraki, Japan).

For exosome identification, 8 exosome markers including CD63, epithelial cell adhesion molecule (EpCAM), annexin A5 (ANXA5), tumor susceptibility gene 101 (TSG101), flotillin-1 (FLOT1), intercellular adhesion molecule 1 (ICAM), apoptosis-linked gene-2-interacting protein X (ALIX), and CD81 were evaluated using an Exo-Check^TM array (System Biosciences). Cis-golgi matrix protein (GM130) as a negative marker was used for cellular contamination during exosome isolation. The exosomes were labeled according to the manufacturer’s protocol,³¹ and the membrane was developed with WesternBright Sirius HRP substrate (Advansta, Menlo Park, CA, USA).

Next generation sequencing (NGS) analysis

Isolation of exosomal ribonucleic acids (RNAs)

Two batches (passage 1) of chondrocytes-derived exosomes (CC-Exo), synoviocytes-derived exosomes (SC-Exo), and CPC-derived exosomes (CPC-Exo) were processed for NGS analysis. Exosomes (approximately 1.5 x 10¹² particles) were isolated from the CM of a T-75 flask. Exosomal RNAs were extracted using an ExoQuick® Exosome RNA Column Purification kit (System Biosciences). Briefly, supernatant was carefully aspirated to retain only the exosomes pellet, which was then resuspended in 350 µL of lysis buffer and briefly vortexed. After adding 200 µL of 100% ethanol, the samples were vortexed again prior to column-based purification. Initial flow-though and the two washes from spin column were discarded. Up to 30 µL of elution buffer was applied and centrifuged at 2,000 rpm for 2 min to load the membrane with buffer, before increasing it to 13,000 rpm for 1 min to recover exosomal RNAs. The quality and quantity of extracted RNAs were checked with a Bioanalyzer RNA Pico kit (Agilent, Santa Clara, CA, USA). Mean value of total quantities/RNA Integrity Numbers (RINs) were 26.2 ng/2.75, 129.85 ng/9.7, and 66.2 ng/9.5 for CC-Exo, SC-Exo, and CPC-Exo, respectively.

Library generation and sequencing

One ng RNA was used as starting material in a small RNA library prep kit (Qiagen, Germantown, MD, USA). The final loading concentration was 1.45 pM, and no PhiX was added during this process. The dilution ratio used for the adaptors was as follows: 3′: 5× dilution, 5′: 2.5× dilution. Libraries were amplified by polymerase chain reaction (PCR; 22 cycles) and successful libraries were purified by gel extraction to ensure isolation of the correct size. A minimum final concentration of 1 nM was required to move on to the sequencing step. The sequencing was performed on NextSeq (Illumina, San Diego, CA, USA) with single-end reads (75 bp) at an approximate depth of 10–15 million reads per sample.

Bioinformatics analysis of small RNAs

Analysis of raw data was performed by the Bioinformatics Division of the Iowa Institute of Human Genetics according to the previous protocol.³¹ A nextflow-based workflow (https://github.com/nf-core/smrnaseq) was used to quantitate known small RNAs. Bovine (Bos taurus, build Btau_5.0.1) genomic sequence (GCA_000003205.6_Btau_5.0.1_genomic.fna) was downloaded from National Center for Biotechnology Information (NCBI). Genome annotation (build accession GCA_000003205.6) and the sequences for both mature and hairpin small RNAs were downloaded from miRBase. The adaptor protocol used was ‘qiaseq’, but the default values were used for all other parameters. To assess read quality and to confirm the presence of the expected adapters before trimming, we used FastQC (version 0.11.9). To trim adapters from the read sequences, Trim Galore! (version 0.6.6) was used with the following parameters: quality Phred score cutoff 20, maximum nucleotide length 40 bp, and minimum length 17 bp. FastQC was run again after trimming to confirm the efficient removal of adapter sequences. Bowtie (version 1.3.0) was used for aligning reads to small RNA sequences with the “best” parameter set to true to ensure that only alignments considered to be of the highest quality were reported. Read counts of all miRNAs with nonzero expression were imported into R (version 3.5.2) and normalized using DESeq2 (version 1.22.2). For visualization purposes, the data was log-transformed with the rlog function and Principal Components Analysis (PCA) was used to visualize the clustering of samples. To determine differential expression, a linear model incorporating all the experimental factors was created and Wald tests were used to compute statistical metrics. A small RNA was considered to have a statistically significant change in expression if the False Discovery Rate (FDR) was less than 10% and the absolute log2 fold-change was greater than 1. Results from the differential expression analysis were visualized using heatmaps created with the pHeatmap (version 1.0.12). To identify novel miRNAs, sequence read files (fastq) from samples in the same group were first concatenated together then ran through the same nf-core smrnaseq workflow as above with the mirDeep2 program (version 2.0.1.2) used for novel miRNA identification. The results from mirDeep2 were filtered to include only potential novel miRNAs with miRDeep2 scores greater than or equal to 4 (higher quality).

miRNA transfection

The pre-customed miRNA mimics for miR-107, miR-140, miR-148a, and a negative control were purchased from Thermo Fisher Scientific (mirVana^TM). The miRNAs at a final concentration of 50 nM were transfected in CPCs using a Lipofectamine RNAiMAX kit (Thermo Fisher Scientific). The CPCs (passage 1) were plated in 24-well plates at a density of 5 × 10⁴ cells per well (n = 3) and incubated in serum-free DMEM/F-12 supplemented with 10 µg/mL insulin/5.5 µg/mL transferrin/6.7 ng/mL selenium (ITS-G; Thermo Fisher Scientific), 50 µg/mL l-ascorbic acid (Thermo Fisher Scientific), 100 U/mL penicillin-streptomycin (Thermo Fisher Scientific), and 100 U/mL amphotericin B (Thermo Fisher Scientific).

Gene expression

After 6 days, total RNAs were extracted from CPCs with TRIzol reagent (Life Technologies, Carlsbad, CA, USA)¹⁶ and Direct-zol RNA kit (Zymo Research, Irvine, CA, USA) as the manufacturer’s instructions. A microvolume spectrometer, NanoDrop 2000 (Thermo Fisher Scientific), was used to assess the yield and purification of extracted RNAs. Quantitative reverse transcription PCR (qRT-PCR) was performed with a PrimeTime® One-Step RT-qPCR Master Mix (Integrated DNA Technologies, Coralville, IA, USA) and TaqMan® probes (Applied Biosystems, Waltham, MA, USA) using QuantStudio™ 3 System (Applied Biosystems) as recommended by the manufacturer. Premade probes (Thermo Fisher Scientific) related to chondrogenic markers, SRY-box transcription factor 9 (SOX9; Bt07108872_m1), collagen type 2A1 (COL2A1; Bt03251861_m1), and aggrecan (ACAN; Bt03212186_m1)) and catabolic markers, matrix metalloproteinase 3 (MMP3; Bt04259490_m1), a disintegrin and metalloproteinase with thrombospondin motifs 5 (ADAMTS5; Bt04230785_m1), nitric oxide synthase 2 (NOS2; Bt03249599_m1) were prepared, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Bt03210913_g1) was used as a housekeeping gene. The relative changes in gene expression levels were calculated by a delta-delta-cycle threshold (Ct) method.³² In order to estimate the stability of housekeeping gene, coefficient of variances (CVs) of Ct values were calculated by dividing the standard deviation of the Ct values by their mean (expressed as a percentage).³³ Scatter plots of gene expression depicting mean values and standard deviation were prepared using GraphPad Prism (Version 10.1.2; San Diego, CA, USA). Data analysis was performed by one-way analysis of variance (ANOVA) with the Tukey posthoc test using SPSS Statistics software (Version 29; IBM, Armonk, NY, USA). Statistical significance was set at p < 0.05.

Results

Characterization of exosomes

In NTA (Fig. 1a), latex beads as a reference control were on average 94.3 ± 1.5 nm in diameter. 50% of these particles (D50) were smaller than 91 nm. All exosomes were monomodal distributed with average size of approximately 70–90 nm, but each type had slightly different particle size and distribution. The average particle diameters of CC-Exo, SC-Exo, and CPC-Exo were 86.6 ± 2.5 nm, 76.3 ± 1.5 nm, and 69.9 ± 2.0 nm, respectively. SEM images provided visual confirmation of spheroid-like morphology (Fig. 1b). In Exo-Check^TM antibody array, exosomes in all groups showed positive expressions of CD63, ANXA5, TSG101, FLOT1, ICAM, ALIX, and CD81 as exosome positive markers, and a negative expression of GM130 as a exosome negative marker (Fig. 1c).

FIG. 1.

Characterization of exosomes. (a) Nanoparticle tracking analysis (NTA) for exosome distribution and size (n = 3). A red line represents the average of 3 samples (dashed black lines). D10/50/90: % of particles under the reported particle size. (b) Scanning Electron Microscope (SEM) images of exosomes. Scale bar = 500 nm. (c) Exosome antibody array having eight positive markers (CD63, EpCAM: epithelial cell adhesion molecule, ANXA5: annexin A5, TSG101: tumor susceptibility gene 101, FLOT1: flotillin-1, ICAM: intercellular adhesion molecule 1, ALIX: apoptosis-linked gene-2-interacting protein X, and CD81) and four controls including cis-golgi matrix protein (GM130) as a negative marker for cellular contamination, two positive controls (+ Ctrl), and a blank control (Blank). CC-Exo: chondrocytes-derived exosomes, SC-Exo: synoviocytes-derived exosomes, CPC-Exo: chondrogenic progenitor cells-derived exosomes.

miRNA profiles

In NGS analysis, individuals in a Principal Component Analysis (PCA) plot were clustered together in the same groups, indicating unique characteristics of each exosome group (Fig. 2a). We found a total of 382, 568, 464 mature miRNAs in CC-Exo, SC-Exo, and CPC-Exo, respectively. Table 1 shows the list of the 30 most prevalent mature miRNAs. In particular, 3 miRNAs (bta-let-7b: 9.25%, bta-miR-3596: 9.25%, bta-let-7a-5p: 9.09%) in CC-Exo, 1 miRNA (bta-miR-21-5p: 9.74%) in SC-Exo, and 3 miRNAs (bta-let-7a-5p: 13.01%, bta-let-7b: 9.48%, bta-miR-3596: 9.48%) in CPC-Exo represented 9% or more of all miRNAs sequenced in a sample. Among the highly expressed miRNAs, unique and common miRNAs across the 3 kinds of exosomes were visualized in a Venn diagram (Fig. 2a). miRNAs common to all three exosomes sources included bta-let-7a-5p/−7b/−7f/−7i, bta-miR-16a, bta-miR-21-5p, bta-miR-23a/b-3p, bta-miR-24-3p, bta-miR-25, bta-miR-27b, bta-miR-29a, bta-miR-122, bta-miR-125a/b, bta-miR-148a/c, bta-miR-152, bta-miR-199a-3p, bta-miR-221, bta-miR-423-5p, bta-miR-3596, bta-miR-3604, and bta-miR-10174-3p. The miRNAs unique to a given type of exosome were bta-miR-140 (1.22%) and bta-miR-103 (0.48%) in CC-Exo, bta-miR-143 (1.00%) in SC-Exo, and bta-miR-29b (0.46%), bta-miR-26b (0.41%), and bta-miR-99b (0.40%) in CPC-Exo.

FIG. 2.

Next Generation Sequencing (NGS) analysis. (a) A combined plot of Principal Component Analysis (PCA: n = 2) and Venn diagram. (b) Heatmap with hierarchical clustering of exosomal microRNAs (miRNA or miR) (n = 2). (c) Differentially expressed mature miRNAs based on comparison analysis. For example, 8 miRNAs (bta-miR-103, bta-miR-107, bta-miR-140, bta-miR-148a, bta-miR-148b, bta-miR-320a, bta-miR-2388-3p, and bta-miR-12034) were up-regulated in CC-Exo when compared with both SC-Exo and CPC-Exo. CC-Exo: chondrocytes-derived exosomes, SC-Exo: synoviocytes-derived exosomes, CPC-Exo: chondrogenic progenitor cells-derived exosomes.

Table 1.

List of 30 Most Prevalent Mature microRNAs

CC-Exo			SC-Exo			CPC-Exo
miRNA	Reads	%	miRNA	Reads	%	miRNA	Reads	%
bta-let-7b	27,178.0	9.25	bta-miR-21-5p	27,051.1	9.74	bta-let-7a-5p	42,656.8	13.01
bta-miR-3596	27,178.0	9.25	bta-miR-199a-3p	19,145.8	6.90	bta-let-7b	31,078.0	9.48
bta-let-7a-5p	26,703.1	9.09	bta-miR-3604	19,145.8	6.90	bta-miR-3596	31,078.0	9.48
bta-miR-199a-3p	22,015.9	7.49	bta-let-7a-5p	18,624.1	6.71	bta-miR-125b	28,483.4	8.68
bta-miR-3604	22,015.9	7.49	bta-let-7b	17,291.6	6.23	bta-let-7i	16,308.2	4.97
bta-miR-125b	17,300.3	5.89	bta-miR-3596	17,291.6	6.23	bta-miR-199a-3p	16,103.2	4.91
bta-miR-16a	10,240.3	3.48	bta-let-7i	17,161.6	6.18	bta-miR-3604	16,103.2	4.91
bta-let-7i	10,091.0	3.43	bta-miR-125b	12,027.4	4.33	bta-miR-21-5p	13,800.8	4.21
bta-miR-23a	9,055.9	3.08	bta-miR-23a	8,932.2	3.22	bta-let-7f	11,800.6	3.60
bta-miR-21-5p	8,318.4	2.83	bta-miR-122	8,552.5	3.08	bta-miR-16a	11,607.9	3.54
bta-miR-148a	8,273.9	2.82	bta-let-7f	7,731.7	2.78	bta-miR-27b	10,877.2	3.32
bta-miR-423-5p	7,534.4	2.56	bta-miR-16a	7,375.0	2.66	bta-miR-29a	6,432.5	1.96
bta-let-7f	7,141.5	2.43	bta-miR-24-3p	6,623.4	2.39	bta-miR-221	6,415.4	1.96
bta-miR-24-3p	6,023.4	2.05	bta-miR-423-5p	6,466.4	2.33	bta-miR-23a	5,374.5	1.64
bta-miR-10174-3p	5,596.2	1.90	bta-miR-29a	6,133.0	2.21	bta-miR-24-3p	4,835.4	1.47
bta-miR-23b-3p	5,488.2	1.87	bta-miR-27b	4,440.4	1.60	bta-miR-10174-3p	4,205.1	1.28
bta-miR-27b	4,567.5	1.55	bta-miR-125a	4,095.8	1.48	bta-miR-25	3,990.8	1.22
bta-miR-29a	4,169.5	1.42	bta-miR-148a	4,031.5	1.45	bta-miR-125a	3,754.7	1.14
bta-miR-122	3,722.2	1.27	bta-miR-10174-3p	3,877.2	1.40	bta-miR-23b-3p	3,677.7	1.12
bta-miR-140	3,592.5	1.22	bta-miR-23b-3p	3,754.2	1.35	bta-miR-423-5p	3,361.7	1.02
bta-miR-320a	3,418.8	1.16	bta-miR-221	2,985.0	1.08	bta-miR-122	3,017.8	0.92
bta-let-7c	2,754.1	0.94	bta-miR-92a	2,953.9	1.06	bta-miR-148a	2,751.2	0.84
bta-miR-221	2,683.3	0.91	bta-miR-143	2,779.5	1.00	bta-miR-152	2,215.2	0.68
bta-miR-125a	2,204.0	0.75	bta-let-7c	2,600.9	0.94	bta-miR-92a	2,134.2	0.65
bta-miR-152	2,139.6	0.73	bta-miR-25	2,497.3	0.90	bta-miR-148c	2,043.5	0.62
bta-miR-148c	2,013.9	0.69	bta-miR-342	2,372.3	0.85	bta-miR-29b	1,503.4	0.46
bta-miR-26a	1,962.1	0.67	bta-miR-26a	1,656.0	0.60	bta-miR-320a	1,481.5	0.45
bta-miR-26c	1,962.1	0.67	bta-miR-26c	1,656.0	0.60	bta-miR-342	1,436.7	0.44
bta-miR-25	1,920.7	0.65	bta-miR-152	1,629.4	0.59	bta-miR-26b	1,355.5	0.41
bta-miR-103	1,422.1	0.48	bta-miR-148c	1,556.6	0.56	bta-miR-99b	1,327.0	0.40

bta, Bos taurus; CC-Exo, chondrocytes-derived exosomes; CPC-Exo, chondrogenic progenitor cells-derived exosomes; miR, microRNA; SS-Exo, synoviocytes-derived exosomes; %, percentage of total reads.

All differentially abundant mature miRNAs are listed in Table 2. In the comparison of log2 fold changes, CC-Exo had 2.27- and 5.56-times higher expression of bta-miR-140 than CPC-Exo and SC-Exo, respectively. Similarly, SC-Exo and CPC-Exo had significantly higher expression of bta-miR-30a-5p (2.44-times higher than CC-Exo and 2.83-times higher than CPC-Exo) and bta-miR-99b (2.86-times higher than CC-Exo and 1.34-times higher than SC-Exo), respecively. All lists were visualized by a heatmap with hierarchical clustering (Fig. 2b) and summarized in Figure 2c. For example, 8 miRNAs (bta-miR-103, bta-miR-107, bta-miR-140, bta-miR-148a, bta-miR-148b, bta-miR-320a, bta-miR-2388-3p, and bta-miR-12034) were up-regulated in CC-Exo when compared with both SC-Exo and CPC-Exo, and 3 miRNAs (bta-miR-126-3p, bta-miR-126-5p, and bta-miR-2478) were up-regulated in CC-Exo when compared with SC-Exo (low expression in CPC-Exo) (Fig. 2c).

Table 2.

List of Significantly up/down-Expressed Mature microRNAs (≥ 0.1% Population)

CC-Exo versus SC-Exo			CPC-Exo versus SC-Exo			CC-Exo versus CPC-Exo
miRNA	Log2 (fold change)	p value	miRNA	Log2 (fold change)	p value	miRNA	Log2 (fold change)	p value
bta-miR-140	5.56	0.0000	bta-miR-140	3.28	0.0000	bta-miR-99a-5p	3.87	0.0000
bta-miR-2388-3p	5.38	0.0000	bta-miR-11987	2.26	0.0000	bta-miR-12034	3.68	0.0000
bta-miR-12034	4.75	0.0000	bta-miR-574	2.22	0.0000	bta-miR-148d	3.35	0.0000
bta-miR-11987	2.88	0.0000	bta-miR-100	2.14	0.0000	bta-miR-195	3.05	0.0000
bta-miR-2478	2.57	0.0006	bta-miR-12030	2.06	0.0029	bta-miR-107	2.59	0.0000
bta-miR-126-5p	2.40	0.0010	bta-miR-130b	1.54	0.0132	bta-miR-2388-3p	2.46	0.0000
bta-miR-126-3p	2.24	0.0039	bta-miR-1246	1.49	0.0028	bta-miR-140	2.27	0.0000
bta-miR-100	2.14	0.0000	bta-miR-99b	1.34	0.0016	bta-miR-1468	2.12	0.0005
bta-miR-148d	1.89	0.0001	bta-miR-34a	1.30	0.0050	bta-miR-101	1.91	0.0000
bta-miR-107	1.78	0.0002	bta-miR-27b	1.29	0.0009	bta-miR-146a	1.70	0.0070
bta-miR-320a	1.40	0.0010	bta-miR-125b	1.24	0.0006	bta-miR-148a	1.59	0.0000
bta-miR-103	1.14	0.0131	bta-miR-29b	1.20	0.0133	bta-miR-29c	1.58	0.0053
bta-miR-148a	1.04	0.0089	bta-let-7a-5p	1.20	0.0031	bta-miR-320a	1.21	0.0046
						bta-miR-103	1.19	0.0105
bta-miR-92a	−1.09	0.0125	bta-miR-101	−1.30	0.0040	bta-miR-423-5p	1.16	0.0038
bta-miR-122	−1.20	0.0151	bta-miR-122	−1.50	0.0023	bta-let-7c	1.09	0.0100
bta-miR-99b	−1.51	0.0007	bta-miR-146a	−1.87	0.0027
bta-miR-2285aj-5p	−1.66	0.0036	bta-miR-30a-5p	−2.83	0.0000	bta-miR-25	−1.06	0.0063
bta-miR-21-5p	−1.70	0.0000	bta-miR-196a	−2.87	0.0000	bta-miR-151-3p	−1.07	0.0122
bta-miR-30a-5p	−2.44	0.0000				bta-miR-27b	−1.25	0.0013
bta-miR-378	−2.69	0.0000				bta-miR-221	−1.26	0.0149
bta-miR-34a	−2.86	0.0000				bta-miR-574	−1.44	0.0058
bta-miR-155	−2.87	0.0000				bta-miR-29b	−1.64	0.0009
bta-miR-143	−2.89	0.0160				bta-miR-155	−2.29	0.0000
bta-miR-184	−4.52	0.0000				bta-miR-99b	−2.86	0.0000
						bta-miR-12030	−3.61	0.0000
						bta-miR-184	−3.69	0.0000
						bta-miR-34a	−4.16	0.0000

CC-Exo, chondrocytes-derived exosomes; SS-Exo, synoviocytes-derived exosomes; CPC-Exo, chondrogenic progenitor cells-derived exosomes; bta, Bos taurus.

Besides mature miRNAs, we identified 2, 10, and 7 novel miRNAs in CC-Exo, SC-Exo, and CPC-Exo, respectively (Table 3). Especially, 2 novel miRNAs were highly detected with miRDeep2 scores greater than 5,000 in both SC-Exo (GACCCGCGGGCG CTCTCCAGTCCT) and CPC-Exo (GACCCGCGGGCG CTCTCCAGTCCT).

Table 3.

List of Novel microRNAs (miR; ≥ 4.0 miRDeep2 Score)

CC-Exo		SC-Exo		CPC-Exo
Sequence	Score	Sequence	Score	Sequence	Score
GACCCGCGGGCG CTCTCCAGTCCT	241.8	GACCCGCGGGCG CTCTCCAGTCCT	6,567.2	GACCCGCGGGCG CTCTCCAGTCCT	5,422.7
AGCGAATGATTA GAGGTCTTGGG	130.8	GGGTTTGATCCT GGCTCAGA	518.6	TGGGTCGCGACC TCTCCCTGGT	9.8
		TGGGTTAGAATC AACAGGAGC	84.6	TCCATCTTGATG TCTTTCCCAG	8.5
		TCCGTAGGTCCC TGGTTC	17.5	TGGTTCGATTCC AGGGTCGC	6.8
		TGGGGTCACAAA GAGTCGGA	16.5	GAGGGGTCTGGA GAGACCACGTCCA	5.1
		GTGAGTGAGAAG GCCCGCCCTG	10.7	TGACCTTAGAGC GAGCTGCCCAG	4.4
		AGGAGCTGACCA ATGAGTTGT	5.6	TGACCTTAGAGC GAGCTGCCCAG	4.4
		TCTCCTCCCGTC TGTCCCGCAG	5.6
		CTGGCCGTGCGC TTCGCC	5.4
		AAGAAGTTCGTT CAGGTTTTT	4.5

CC-Exo, chondrocytes-derived exosomes; CPC-Exo, chondrogenic progenitor cells-derived exosomes; SS-Exo, synoviocytes-derived exosomes.

Potential therapeutic application of exosomal miRNAs for cartilage regeneration

As a stable housekeeping gene, GAPDH indicated 4.6% and 4.4% CV in chondrogenic (Fig. 3a) and catabolic markers (Fig. 3b), respectively. Based on NGS data that miR-107, miR-140, and miR-148a were the most differentially expressed miRNA found in CC and CPC exosomes, we evaluated potential therapeutic effects of each miRNA. The qPCR analysis of gene expression in CPCs transfected with miR-140 showed induction of canonical markers of chondrocyte differentiation, SOX9 (3.4-times higher versus control), COL2A1 (47.7-times higher versus control), and ACAN (3.5-times higher versus control), but transfection did not suppress catabolic markers, MMP3 (5.0-times lower versus control), ADAMTS5 (4.8-times lower versus control), and NOS2 (6.7-times lower versus control) (Fig. 3). Conversely, miR-107 transfection suppressed the catabolic markers.

FIG. 3.

Effect of targeted microRNAs (miRNAs or miR) on chondrogenesis and anticatabolism. Chondrogenic progenitor cells were transfected with miR-107, miR-140, or miR-148a (n = 3). After 6 days, the expressions of chondrogenic (a) and catabolic (b) markers were analyzed by quantitative polymerase chain reaction (qPCR). No Tx: no treatment control of miRNA, Control (-): negative control, SOX9: SRY-box transcription factor 9, COL2A1: collagen type 2A1, ACAN: aggrecan, MMP: matrix metalloproteinase, ADAMTS5: a disintegrin and metalloproteinase with thrombospondin motifs 5, NOS2: nitric oxide synthase 2. Data are represented as mean ± standard deviation.

Discussion

Mounting evidence indicates that chemokines,^34,35 growth factors,³⁶ and cytokines³⁷ can stimulate the cellular activation. Besides these factors, miRNAs as an epigenetic factor play a crucial role in cartilage development, homeostasis, and pathology.³⁸ miRNAs consisting of approximately 18–25 nucleotides are small, single-stranded, highly conserved noncoding RNA molecules that function in regulating gene expression. Because exosomes contain these miRNAs, analysis of exosomal miRNA profiles was conducted to identify differential expression of miRNAs in joint cells in this study. In NGS analysis, enriched exosomal miRNAs were listed in Table 1, and common and unique miRNAs were summarized in Figure 2b. Among the unique miRNAs, both miR-29b strands were highly expressed in CPC-Exo (Fig. 2a and c). Although we were unable to distinguish between arm/strands (5′ or 3′) within our samples, the distinction has biological significance, as the strands can have different biological functionality and stability. For example, the expression of miR-29b-5p was down-regulated in an anterior cruciate ligament transection (ACLT) rat model.³⁹ Interestingly, sustained delivery of agomir-29b-5p in self-assembling peptide nanofiber hydrogels enhanced cartilage regeneration.³⁹ In contrast, miR-140 and miR-107 were highly and differentially expressed in CC-Exo. Several studies reported both prochondrogenic and anti-inflammatory effects of miR-140 which is the most highly detected miRNA in healthy cartilage and down-regulated in OA cartilage.^28,40,41 For OA treatment, targeting miR-103a-3p up-regulation inhibited chondrocyte apoptosis and inflammation.⁴² Thus, specific miRNAs can be differently expressed depending on the cell type and its function, and engineered modifications of miRNA content in exosomes or miRNA itself can be therapeutically used in tissue engineering and regenerative medicine.²⁷

In this study, we aimed to evaluate candidate miRNAs for CPC-based cartilage regeneration. Based on gene expression profiles, CPCs significantly over-expressed chemokines (interleukin 8 and C-C motif ligand 2) associating with inflammatory response against cartilage injury, while down-expressed cartilage matrix genes.⁴³ Our supplementary data could also support the gene expression differences of chondrogenic markers: 5.4-, 2,628.2-, and 5.8-times higher expression of SOX9, COL2A1, and ACAN, respectively, in chondrocytes versus CPCs (Supplementary Fig. S1). Therefore, we focused on differentiated miRNAs between CPC-Exo and CC-Exo (Table 2 and Fig. 2), and selected miR-107,^44,45 miR-140,^28,41 and miR-148a⁴⁶ which showed strong evidence for cartilage regeneration in the previous studies. In gene expression analysis, miR-140 and miR-107 showed predominant effects on anabolic (SOX9, COL2A1, and ACAN) and anticatabolic (MMP3, ADAMTS5, and NOS2) activities for cartilage regeneration, respectively (Fig. 3). On the other hand, CPCs transfected miR-148a induced over-expression of catabolic genes related to cartilage degradation unlike the outcomes of Vonk and colleagues.⁴³ We assume that the miRNA may affect differently to the target cells (CPCs versus OA chondrocytes). Although we tested only 3 miRNAs, other miRNAs (miR-99a-5p,^47,48 miR-103,⁴⁹ miR-126-3p,⁵⁰ and miR-320a^51,52) as well as novel miRNAs (GACCCGCGGGCGCTCTCCAGTCCT and AGCGAATGATTAGAGGTCTTGGG) can also be valuable candidates for cartilage regeneration (Fig. 2 and Table 3).

Because synovium (synovial membrane) is a thin primary barrier that lines the inside of joints, synoviocytes (synovial cells) are closely correlated to the onset and progression of joint disease including pain, inflammation, and cartilage destruction.⁵³ Therefore, therapeutics targeting synovium and synoviocytes are an attractive strategy for cartilage repair and inflammation inhibition.⁵⁴ In particular, exosomes derived from synovial MSCs (SMSCs) suppressed OA development and enhanced cartilage regeneration,^55,56 and exosomes derived from miR-140-5p-rich SMSCs promoted cell migration and proliferation without ECM damage.²⁹ Therefore, the miRNA profiling of SC-Exo can identify enriched and differentiated miRNAs and underlying mechanisms of cellular function. For example, the up-regulation of miR-143, which was detected in SC-Exo (Table 1 and Fig. 2b), in MSC-derived exosomes inhibited the apoptosis of OA cells.⁵⁷ Moreover, SC-Exo contained higher levels of miR-92a⁵⁸ and miR-122⁵⁹ related to prochondrogenesis and anti-inflammation, respectively, compared to CC-Exo and CPC-Exo (Fig. 2a and c). In the future, it will be an interesting approach to compare the miRNA profiles of inflammation-induced synoviocytes to identify the changes of miRNAs contents under pathological condition like synovitis.

In this study, we firstly examined the miRNA profiles of CPC-Exo by comparing with CC-Exo and SC-Exo and identified candidate miRNAs for CPC-based cartilage regeneration. Potential limitations of our research include the confirmation of protein and RNA contamination during exosome isolation,⁶⁰ low sample size of NGS and validation of NGS data (Sanger sequencing or qRT-PCR),⁶¹ monolayer culture for chondrogenic induction, dosage-dependent effect of miRNAs, validation of miRNA effects with an antagomir, and targeting only 3 miRNA candidates. However, our findings provide a foundation for the design of exosome-based strategies for cartilage regeneration as well as PTOA prevention.

Conclusions

This study evaluated miRNA profiles of CPC-Exo with the aim to find candidate miRNAs that could be therapeutically beneficial for cartilage regeneration. In the comparison analysis of NGS data, we identified unique mature miRNAs, highly detected in CC-Exo, to be used in targeting of miRNAs via CPC transfection. In particular, miR-140 induced chondrogenic gene expression including SOX9, COL2A1, ACAN, and miR-107 suppressed catabolic gene expression including MMP3, ADAMTS5, and NOS2. These findings suggest that pairing miR-140 and miR-107 would have complimentary effects on cartilage regeneration (Fig. 4).

FIG. 4.

Overall summary of exosomal microRNA (miRNA or miR), miR-107 and miR-140, for cartilage regeneration. SOX9: SRY-box transcription factor 9, COL2A1: collagen type 2A1, ACAN: aggrecan, MMP3: matrix metalloproteinase 3, ADAMTS5: a disintegrin and metalloproteinase with thrombospondin motifs 5, NOS2: nitric oxide synthase 2.

Footnotes

Acknowledgment

The authors thank Amelia Hurley-Novatny & Hongshuai Li for helping with the exosome antibody array and Abigail Smith & Jaycie Pergler for invaluable administrative support.

Authors’ Contributions

V.G.: Conceptualization, methodology, data curation, and writing-review and editing, visualization. R.H.: Methodology, data curation, and writing—review and editing. H.L.K.: Software, data curation, and writing-review and editing. A.K.S.: Resources, and writing—review and editing. E.A.S.: Writing-review and editing. K.S.: Resources, and writing—review and editing. J.A.M.: Conceptualization, writing—review and editing, and supervision. D.S.: Conceptualization, data curation, writing-original draft, visualization, and supervision.

Author Disclosure Statement

The authors declare no competing interest.

Funding Information

This work was supported by the Department of Orthopedics and Rehabilitation at the University of Iowa.

Supplementary Material

References

Bank

, Sanghvi

, Hecht

2nd , et al. The epidemiology of posttraumatic osteoarthritis of the knee in the United States: An analysis of 948,853 patients from 2000 to 2022. J Am Acad Orthop Surg, 2024; 32(7):e313–e320; doi: 10.5435/JAAOS-D-23-00662

Brown

, Johnston

, Saltzman

, et al. Posttraumatic osteoarthritis: A first estimate of incidence, prevalence, and burden of disease. J Orthop Trauma, 2006; 20(10):739–744; doi: 10.1097/01.bot.0000246468.80635.ef

Thomas

, Hubbard-Turner

, Wikstrom

, et al. Epidemiology of Posttraumatic Osteoarthritis. J Athl Train, 2017; 52(6):491–496; doi: 10.4085/1062-6050-51.5.08

Anderson

, Chubinskaya

, Guilak

, et al. Post-traumatic osteoarthritis: Improved understanding and opportunities for early intervention. J Orthop Res, 2011; 29(6):802–809; doi: 10.1002/jor.21359

Brittberg

. Autologous chondrocyte transplantation. Clin Orthop Relat Res, 1999(367 Suppl):S147–S155; doi: 10.1097/00003086-199910001-00016

Brittberg

, Lindahl

, Nilsson

, et al. Treatment of deep cartilage defects in the knee with autologous chondrocyte transplantation. N Engl J Med, 1994; 331(14):889–895; doi: 10.1056/NEJM199410063311401

Gillogly

, Voight

, Blackburn

. Treatment of articular cartilage defects of the knee with autologous chondrocyte implantation. J Orthop Sports Phys Ther, 1998; 28(4):241–251; doi: 10.2519/jospt.1998.28.4.241

Davatchi

, Abdollahi

, Mohyeddin

, et al. Mesenchymal stem cell therapy for knee osteoarthritis. Preliminary report of four patients. Int J Rheum Dis, 2011; 14(2):211–215; doi: 10.1111/j.1756-185X.2011.01599.x

Pittenger

, Mackay

, Beck

, et al. Multilineage potential of adult human mesenchymal stem cells. Science, 1999; 284(5411):143–147; doi: 10.1126/science.284.5411.143

10.

. Regeneration of articular cartilage using adipose stem cells. J Biomed Mater Res A, 2016; 104(7):1830–1844; doi: 10.1002/jbm.a.35705

11.

Sadlik

, Jaroslawski

, Gladysz

, et al. Knee Cartilage Regeneration with Umbilical Cord Mesenchymal Stem Cells Embedded in Collagen Scaffold Using Dry Arthroscopy Technique. Adv Exp Med Biol, 2017; 1020:113–122; doi: 10.1007/5584_2017_9

12.

Song

, Hong

, Kong

, et al. High tibial osteotomy with human umbilical cord blood-derived mesenchymal stem cells implantation for knee cartilage regeneration. World J Stem Cells, 2020; 12(6):514–526; doi: 10.4252/wjsc.v12.i6.514

13.

Barbero

, Ploegert

, Heberer

, et al. Plasticity of clonal populations of dedifferentiated adult human articular chondrocytes. Arthritis Rheum, 2003; 48(5):1315–1325; doi: 10.1002/art.10950

14.

Mueller

, Fischer

, Zellner

, et al. Hypertrophy in mesenchymal stem cell chondrogenesis: Effect of TGF-beta isoforms and chondrogenic conditioning. Cells Tissues Organs, 2010; 192(3):158–166; doi: 10.1159/000313399

15.

Koelling

, Kruegel

, Irmer

, et al. Migratory chondrogenic progenitor cells from repair tissue during the later stages of human osteoarthritis. Cell Stem Cell, 2009; 4(4):324–335; doi: 10.1016/j.stem.2009.01.015

16.

Seol

, McCabe

, Choe

, et al. Chondrogenic progenitor cells respond to cartilage injury. Arthritis Rheum, 2012; 64(11):3626–3637; doi: 10.1002/art.34613

17.

, Brouillette

, Seol

, et al. Use of recombinant human stromal cell-derived factor 1alpha-loaded fibrin/hyaluronic acid hydrogel networks to achieve functional repair of full-thickness bovine articular cartilage via homing of chondrogenic progenitor cells. Arthritis Rheumatol, 2015; 67(5):1274–1285; doi: 10.1002/art.39049

18.

Raposo

, Stoorvogel

. Extracellular vesicles: Exosomes, microvesicles, and friends. J Cell Biol, 2013; 200(4):373–383; doi: 10.1083/jcb.201211138

19.

Margiana

, Markov

, Zekiy

, et al. Clinical application of mesenchymal stem cell in regenerative medicine: A narrative review. Stem Cell Res Ther, 2022; 13(1):366; doi: 10.1186/s13287-022-03054-0

20.

Wan

, Hussain

, Behfar

, et al. The therapeutic potential of exosomes in soft tissue repair and regeneration. Int J Mol Sci, 2022; 23(7); doi: 10.3390/ijms23073869

21.

Asgarpour

, Shojaei

, Amiri

, et al. Exosomal microRNAs derived from mesenchymal stem cells: Cell-to-cell messages. Cell Commun Signal, 2020; 18(1):149; doi: 10.1186/s12964-020-00650-6

22.

Henke

, Goergen

, Zheng

, et al. microRNA-122 stimulates translation of hepatitis C virus RNA. Embo J, 2008; 27(24):3300–3310; doi: 10.1038/emboj.2008.244

23.

Nail

, Chiu

, Leung

, et al. Exosomal miRNA-mediated intercellular communications and immunomodulatory effects in tumor microenvironments. J Biomed Sci, 2023; 30(1):69; doi: 10.1186/s12929-023-00964-w

24.

Pourhanifeh

, Mahjoubin-Tehran

, Shafiee

, et al. MicroRNAs and exosomes: Small molecules with big actions in multiple myeloma pathogenesis. IUBMB Life, 2020; 72(3):314–333; doi: 10.1002/iub.2211

25.

Albanese

, Chen

, Huls

, et al. MicroRNAs are minor constituents of extracellular vesicles that are rarely delivered to target cells. PLoS Genet, 2021; 17(12):e1009951; doi: 10.1371/journal.pgen.1009951

26.

Askenase

. Exosomes provide unappreciated carrier effects that assist transfers of their miRNAs to targeted cells; I. They are ‘The Elephant in the Room’. RNA Biol, 2021; 18(11):2038–2053; doi: 10.1080/15476286.2021.1885189

27.

Foo

, Looi

, How

, et al. Mesenchymal stem cell-derived exosomes and MicroRNAs in cartilage regeneration: Biogenesis, efficacy, miRNA enrichment and delivery. Pharmaceuticals (Basel), 2021; 14(11); doi: 10.3390/ph14111093

28.

Miyaki

, Sato

, Inoue

, et al. MicroRNA-140 plays dual roles in both cartilage development and homeostasis. Genes Dev, 2010; 24(11):1173–1185; doi: 10.1101/gad.1915510

29.

Tao

, Yuan

, Zhang

, et al. Exosomes derived from miR-140-5p-overexpressing human synovial mesenchymal stem cells enhance cartilage tissue regeneration and prevent osteoarthritis of the knee in a rat model. Theranostics, 2017; 7(1):180–195; doi: 10.7150/thno.17133

30.

Comfort

, Cai

, Bloomquist

, et al. Nanoparticle tracking analysis for the quantification and size determination of extracellular vesicles. J Vis Exp, 2021(169); doi: 10.3791/62447

31.

Ganesh

, Seol

, Gomez-Contreras

, et al. Exosome-Based cell homing and angiogenic differentiation for dental pulp regeneration. Int J Mol Sci, 2022; 24(1); doi: 10.3390/ijms24010466

32.

Livak

, Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001; 25(4):402–408; doi: 10.1006/meth.2001.1262

33.

de Jonge

, Fehrmann

, de Bont

, et al. Evidence based selection of housekeeping genes. PLoS One, 2007; 2(9):e898; doi: 10.1371/journal.pone.0000898

34.

Ding

, Gao

, Gu

, et al. HMGB1 can activate cartilage progenitor cells in response to cartilage injury through the CXCL12/CXCR4 pathway. Endokrynol Pol, 2023; 74(1):74–82; doi: 10.5603/EP.a2022.0084

35.

, He

, Yin

, et al. Administration of signalling molecules dictates stem cell homing for in situ regeneration. J Cell Mol Med, 2017; 21(12):3162–3177; doi: 10.1111/jcmm.13286

36.

Danisovic

, Varga

, Polak

. Growth factors and chondrogenic differentiation of mesenchymal stem cells. Tissue Cell, 2012; 44(2):69–73; doi: 10.1016/j.tice.2011.11.005

37.

Edderkaoui

. Chemokines in cartilage regeneration and degradation: New insights. Int J Mol Sci, 2023; 25(1); doi: 10.3390/ijms25010381

38.

Mirzamohammadi

, Papaioannou

, Kobayashi

. MicroRNAs in cartilage development, homeostasis, and disease. Curr Osteoporos Rep, 2014; 12(4):410–419; doi: 10.1007/s11914-014-0229-9

39.

Zhu

, Yang

, Qi

, et al. Stem cell-homing hydrogel-based miR-29b-5p delivery promotes cartilage regeneration by suppressing senescence in an osteoarthritis rat model. Sci Adv, 2022; 8(13):eabk0011; doi: 10.1126/sciadv.abk0011

40.

Al-Modawi

, Brinchmann

, Karlsen

. Multi-pathway protective effects of MicroRNAs on human chondrocytes in an in vitro model of osteoarthritis. Mol Ther Nucleic Acids, 2019; 17:776–790; doi: 10.1016/j.omtn.2019.07.011

41.

Miyaki

, Nakasa

, Otsuki

, et al. MicroRNA-140 is expressed in differentiated human articular chondrocytes and modulates interleukin-1 responses. Arthritis Rheum, 2009; 60(9):2723–2730; doi: 10.1002/art.24745

42.

Cheng

, Wang

. Downregulation of HMGB1 by miR-103a-3p promotes cell proliferation, alleviates apoptosis and in flammation in a cell model of osteoarthritis. Iran J Biotechnol, 2020; 18(1):e2255; doi: 10.30498/IJB.2020.129470.2255

43.

Zhou

, Zheng

, Seol

, et al. Gene expression profiles reveal that chondrogenic progenitor cells and synovial cells are closely related. J Orthop Res, 2014; 32(8):981–988; doi: 10.1002/jor.22641

44.

Qian

, Fu

, Li

, et al. miR-107 affects cartilage matrix degradation in the pathogenesis of knee osteoarthritis by regulating caspase-1. J Orthop Surg Res, 2021; 16(1):40; doi: 10.1186/s13018-020-02121-7

45.

Tian

, Wang

, Zhang

, et al. miR-107 modulates chondrocyte proliferation, apoptosis, and extracellular matrix synthesis by targeting PTEN. Int J Clin Exp Pathol, 2019; 12(2):488–497.

46.

Vonk

, Kragten

, Dhert

, et al. Overexpression of hsa-miR-148a promotes cartilage production and inhibits cartilage degradation by osteoarthritic chondrocytes. Osteoarthritis Cartilage, 2014; 22(1):145–153; doi: 10.1016/j.joca.2013.11.006

47.

Griffiths

, Woods

, Cheng

, et al. The transcription Factor-microRNA regulatory network during hESC-chondrogenesis. Sci Rep, 2020; 10(1):4744; doi: 10.1038/s41598-020-61734-4

48.

Wang

, Zheng

, Luo

, et al. MiR-99a alleviates apoptosis and extracellular matrix degradation in experimentally induced spine osteoarthritis by targeting FZD8. BMC Musculoskelet Disord, 2022; 23(1):872; doi: 10.1186/s12891-022-05822-8

49.

Chen

, Wu

. MicroRNA-103 contributes to osteoarthritis development by targeting Sox6. Biomed Pharmacother, 2019; 118:109186; doi: 10.1016/j.biopha.2019.109186

50.

Zhou

, Ming

, Li

, et al. Exosomes derived from miR-126-3p-overexpressing synovial fibroblasts suppress chondrocyte inflammation and cartilage degradation in a rat model of osteoarthritis. Cell Death Discov, 2021; 7(1):37; doi: 10.1038/s41420-021-00418-y

51.

Jin

, Chen

, Gao

, et al. The role of miR-320a and IL-1beta in human chondrocyte degradation. Bone Joint Res, 2017; 6(4):196–203; doi: 10.1302/2046-3758.64.BJR-2016-0224.R1

52.

Meng

, Zhang

, Chen

, et al. MicroRNA-320 regulates matrix metalloproteinase-13 expression in chondrogenesis and interleukin-1beta-induced chondrocyte responses. Osteoarthritis Cartilage, 2016; 24(5):932–941; doi: 10.1016/j.joca.2015.12.012

53.

Zou

, Li

, Yu

, et al. The potential role of synovial cells in the progression and treatment of osteoarthritis. Exploration (Beijing), 2023; 3(5):20220132; doi: 10.1002/EXP.20220132

54.

, Gao

, Mi

, et al. Synovial membrane mesenchymal stem cells: Past life, current situation, and application in bone and joint diseases. Stem Cell Res Ther, 2020; 11(1):381; doi: 10.1186/s13287-020-01885-3

55.

Koizumi

, Ebina

, Hart

, et al. Synovial mesenchymal stem cells from osteo- or rheumatoid arthritis joints exhibit good potential for cartilage repair using a scaffold-free tissue engineering approach. Osteoarthritis Cartilage, 2016; 24(8):1413–1422; doi: 10.1016/j.joca.2016.03.006

56.

Zhu

, Wang

, Zhao

, et al. Comparison of exosomes secreted by induced pluripotent stem cell-derived mesenchymal stem cells and synovial membrane-derived mesenchymal stem cells for the treatment of osteoarthritis. Stem Cell Res Ther, 2017; 8(1):64; doi: 10.1186/s13287-017-0510-9

57.

Qiu

, Xu

, Yi

, et al. Curcumin reinforces MSC-derived exosomes in attenuating osteoarthritis via modulating the miR-124/NF-kB and miR-143/ROCK1/TLR9 signalling pathways. J Cell Mol Med, 2020; 24(18):10855–10865; doi: 10.1111/jcmm.15714

58.

Mao

, Zhang

, Hu

, et al. Exosomes derived from miR-92a-3p-overexpressing human mesenchymal stem cells enhance chondrogenesis and suppress cartilage degradation via targeting WNT5A. Stem Cell Res Ther, 2018; 9(1):247; doi: 10.1186/s13287-018-1004-0

59.

Scott

, Cohen

, Hays

, et al. Regulation of inflammatory and catabolic responses to IL-1beta in rat articular chondrocytes by microRNAs miR-122 and miR-451. Osteoarthritis Cartilage, 2021; 29(1):113–123; doi: 10.1016/j.joca.2020.09.004

60.

Yang

, Wang

, Wei

, et al. Extracellular vesicles isolated by size-exclusion chromatography present suitability for RNomics analysis in plasma. J Transl Med, 2021; 19(1):104; doi: 10.1186/s12967-021-02775-9

61.

Jennings

, Arcila

, Corless

, et al. Guidelines for validation of next-generation sequencing-based oncology panels: A joint consensus recommendation of the association for molecular pathology and college of American pathologists. J Mol Diagn, 2017; 19(3):341–365; doi: 10.1016/j.jmoldx.2017.01.011