Development of a Novel Three-Dimensional,Automatable and Integrated Bioprocess for the Differentiation of Embryonic Stem Cells into Pulmonary Alveolar Cells in a Rotating Vessel Bioreactor System

Abstract

Application of stem cells for cell therapy of respiratory diseases is a developing field. We have previously established several protocols for the differentiation of embryonic stem cells (ESC) into alveolar epithelial cells, which require a high degree of operator interference and result in a low yield of target cells. Herein, we have shown that, by provision of a medium conditioned using A549 cells and by integration of classic steps of ESC differentiation into a single step through encapsulation in hydrogels (three-dimensional) and culture in a rotary bioreactor, murine ESC (mESC) could be directed to differentiate into distal respiratory epithelial cells. Type I and II pneumocytes (with a yield of 50% for type II) and Clara cells were demonstrated by the expression of aquaporin 5, surfactant protein C, and Clara cell secretory protein, respectively. We identified target cells as early as day 5 of culture and stably maintained our differentiated cells in vitro for 100 days. Electron microscopy demonstrated microvilli and intracellular lamellar bodies (LB), and fluorescent staining confirmed the active process of exocytosis of these LB in differentiated type II cells. When these cells were decapsulated and cultured in static conditions in flask cultures (two-dimensional), they retained their characteristic type II phenotype and morphology. In conclusion, our protocol offers integrated bioprocessing, shorter time of differentiation, lower cost, no use of growth factors, high reproducibility, and high phenotypic and functional stability, as well as being amenable to automation and being scalable, which would move this field closer to future clinical applications.

Introduction

Damage to the lung alveolar epithelium can interfere with gas exchange through the respiratory membrane. Two distinct epithelial cells, type I and type II pneumocytes, line the alveolar surface of the lung. Type I cells are flat and line most of the alveolar surface; through them, respiratory gas exchange takes place. Type II cells are cuboidal cells secreting pulmonary surfactant, which reduces surface tension and prevents alveolar collapse. These cells are considered to be alveolar epithelial progenitors because they play an important role in re-epithelialization after alveolar injury. A number of studies have shown that local delivery of type II cells can promote lung regeneration in animal injury models.^1–3 Accordingly, several groups have focused on the development of protocols to enable scalable production of transplantable type II pneumocytes for cell therapy of respiratory diseases. Most of these protocols have concentrated on derivation of type II cells from stem cells, in particular from embryonic stem cells (ESC).^3–5

Several strategies have been designed to direct differentiation of ESC into pulmonary epithelial cells, including provision of a commercial medium designed for in vitro maintenance of distal airway epithelium,^4–9 predifferentiation into definitive endoderm,¹⁰ co-culture with fetal lung mesenchyme,¹¹ use of mature epithelial cells cytoplasmic extract,¹² use of basement membrane components,¹³ use of different growth factors,¹⁴ and genetic modification,¹⁵ but the yield of target cells is low in most of these protocols, and the ESC should go through multiple differentiation steps, which are costly and labor intensive, require a long time to complete, and are not amenable to automation or scale-up.

The differentiation steps in the majority of these protocols include expansion of undifferentiated ESC, embryoid body (EB) formation, and terminal differentiation toward the desired cell type. EBs are spherical structures resulting from proliferation and differentiation of ESC in nonadherent culture conditions. EB are composed of a collection of cells of the three germ layers. Their formation resembles the development of embryonic tissues in vivo but limits the differentiation process because of the variations in size and differentiation state.¹⁶ Furthermore, the formation of cystic EB needs operator intervention that complicates the process of automation. These steps are adopted in the majority of protocols designed for directing the differentiation of ESC into most cellular lineages.

Encapsulation of cells within a hydrogel is attractive because it facilitates and enhances cell–cell and cell–matrix interactions, can provide a customized three-dimensional (3D) cell growth environment, and can support high cell densities with fewer mass transport limitations, resulting in cellular behaviors that more closely resemble cellular behavior in natural tissue. Ease of handling and lack of manual passaging are other added benefits. We have previously shown that, by encapsulating of ESC in alginate hydrogels and providing a specifically designed microenvironment in a high-aspect-ratio vessel (HARV) bioreactor, we can maintain pluripotent ESC without passaging for longer than 120 days¹⁷ and integrate the maintenance and differentiation stages toward the osteogenic lineage.^18,19 This integration can facilitate the process of automation and scale-up when the cells are intended to be commercially processed for clinical applications.

Successful integration of multiple steps of differentiation protocol of ESC in 3D culture conditions could be attributed to the development of cell–cell and cell–matrix interactions that resemble the natural physiologic state more closely than 2D cultures do. Provision of a suitable matrix is necessary to enable culture of anchorage-dependent cells under 3D conditions. Of the different matrices used for this purpose, alginate has been proven to be a suitable material. Semipermeability of alginate allows diffusion of oxygen and nutrients to the cells and elimination of waste products after encapsulation of cells in this hydrogel.²⁰ Furthermore, the HARV bioreactor, which facilitates enhanced mass transport over static cultures without exposing cells to turbulence and high shear stress, can provide the greater metabolic demands of cells due to growth and differentiation.^21,22 The simulated microgravity generated in a HARV improves 3D cell–cell interaction, which is an important factor in differentiation of ESC.

Although differentiation of encapsulated ESC has been reported in a wide range of cellular lineages, such as cartilage, bone, and pancreatic cells, to our knowledge, no study has been performed for the differentiation of encapsulated ESC into lung epithelial cells. Herein, we describe an integrated, single-step culture technique that results in enhanced differentiation of murine ESC (mESC) into alveolar epithelial cells using encapsulation and a HARV bioreactor. The yield of pulmonary epithelial cells resulting from the nongenetic modification protocol was higher than most protocols in literature. This integrated 3D culture technology to derive distal epithelial lung cells is scalable and automatable, so translation of this technology may offer an advanced therapeutic option for the management of individuals with severe respiratory diseases.

Methods and Materials

Culture of mESC

E14Tg2a mESC line (American Type Culture Collection (ATCC, VA)) was cultured in high-glucose Dulbecco's modified Eagle medium (DMEM) without sodium pyruvate (Invitrogen, United Kingdom) and supplemented with 10% (v/v) fetal bovine serum (FBS, PAA, United Kingdom), 100 IU/mL of penicillin, and 100 μg/mL of streptomycin, 2mM L-glutamine, 0.1mM 2-mercaptoethanol (all supplied by Invitrogen, United Kingdom), and 1,000 U/mL leukocyte inhibitory factor (Chemicon, United Kingdom). The mESC line was routinely passaged on 0.1% gelatin-coated (Sigma-Aldrich, United Kingdom) tissue culture plastic in a humidified incubator set at 37°C and 5% carbon dioxide. Undifferentiated mESC (<passage 20) were passaged with trypsin–ethylenediaminetetraacetic acid (EDTA, Invitrogen) every 2 or 3 days and fed every day.

Encapsulation of mESC

Undifferentiated mESC were passaged with trypsin-EDTA (Invitrogen). The cell pellets were resuspended in 1.1% (w/v) low-viscosity alginic acid and 0.1% (v/v) gelatin (both Sigma) solution at room temperature (in phosphate buffered saline (PBS) at pH 7.4). Using a peristaltic pump (Amersham Biosciences, United Kingdom) from a drop height of 3 cm, the cell–gel solution was passed through a 25-G needle (Becton Dickinson, United Kingdom) into a sterile 100mM aclcium chloride (CaCl₂) (Sigma) 10-mM N-(2-hydroxyethyl) piperazine-N-(2-ethane sulfonic acid) (HEPES, Sigma) solution (pH 7.4). Gelation was instant on contact with the CaCl₂ solution, resulting in the formation of spherical beads (approximately 2.3–2.5 mm in diameter after swelling). Each bead contained 20,000 cells. The beads remained in the gently stirred CaCl₂ solution for 6 to 10 minutes at room temperature. The beads were washed three times in PBS and cultured in mESC maintenance medium (as described above) with 3- to 4-day feeding cycles. Any changes in the structure and morphology of the encapsulated cells were evaluated using an inverted microscope (Olympus, Southall, United Kingdom) attached with a color CoolPix 950 digital camera (Nikon, Kingston-upon-Thames, United Kingdom) and recorded.

A549 conditioned medium

A549 is a human type II pneumocyte tumor cell line (# CCL 183, ATCC). The cells were grown in F12K medium supplemented with 10% (v/v) FBS and 2mM L-glutamine (all supplied by Invitrogen) to confluence in T75 flasks (Orange Scientific, Braine-l'Alleud, Belgium) for 2 to 3 days. On day 3, the conditioned medium was collected from the flasks, passed through a 0.22-μm filter (Millipore, United Kingdom), and kept at 4°C before use.

Culture of mESC in HARV

After encapsulation of murine mESC in alginate hydrogels, as described above, 500 alginate beads were placed in a 50-mL HARV bioreactor (Synthecon), shown in Fig. 1d, and cultured for 24 hours in the maintenance medium. Two groups were employed: the control, in which the bioreactor was cultured with maintenance medium (described above), and the experimental group, in which the bioreactor was cultured with A549 conditioned medium (50:50 v/v with maintenance medium). The rotating speed was maintained at 17 revolutions per minute, and the cultures were fed every 2 to 3 days. The beads were collected at days 7, 11, and 15 for flow cytometric analysis and at days 5, 10, 15, 20, 25, and 30 for other phenotypic characterizations.

FIG. 1.

Cell aggregates were formed as early as day 5 in beads cultured in a high-aspect-ratio vessel (HARV) bioreactor in conditioned medium (a). Hematoxylin and eosin staining of the cell aggregates at day 10 (b). Immunocytochemistry of the same aggregates shown in (b); a merged image of green for prosurfactant protein C (pro-SPC), blue for actin, and red for nuclei (c). Schematic representation of the HARV bioreactor set-up (d) showing alginate beads in suspension (arrow). Color images available online at www.liebertonline.com/tec

Histology

For immunocytochemistry, beads were collected and fixed overnight in 4% (w/v) formaldehyde (Sigma-Aldrich) at 4°C. After the beads were rinsed with PBS, they were incubated overnight with 30% sucrose (w/v) (Sigma-Aldrich) at 4°C. The next day, the beads were washed twice with PBS, immersed in optimal cutting temperature (OCT) compound (VWR International Ltd, United Kingdom), and frozen in liquid nitrogen–cooled isopentane (Sigma-Aldrich) for 1 to 2 minutes until the OCT compound solidified. The frozen beads were kept at −80°C overnight or at least 1 hour before sectioning at a thickness of 7 μm. Sections were picked up on poly-L-lysine-coated glass slides (VWR International Ltd) and kept in slide box at −20°C for long storage. Then the sections were permeabilized with 0.1% (v/v) Triton X-100 (Sigma-Aldrich) and incubated with normal rabbit serum (1:25) as a blocking agent for 30 minutes at room temperature. Primary rabbit polyclonal antibodies against prosurfactant protein C (pro-SPC) were applied at a dilution of 1:1,000 (Millipore, Chemicon, Upstate, United Kingdom) and left overnight at 4°C. The following day, cells were washed with PBS and incubated with secondary goat fluorescein isothiocyanate (FITC)-conjugated anti-rabbit immunoglobulin (Ig)G antibody (1:200) (Millipore, Chemicon) for 1 hour at room temperature. To stain for actin, cells were washed with PBS and incubated with rhodamine-conjugated phalloidin (Sigma-Aldrich) at room temperature for another 30 minutes. Nuclei were counterstained by mounting with Vectashield Mounting Medium (Vector Laboratories, Peterborough, United Kingdom) containing 4′,6-diamidino-2-phenylindole (DAPI). For hematoxylin and eosin (H&E) staining, the beads were frozen and sectioned as above and placed on poly-L-lysine-coated glass slides (VWR International Ltd). The sections were fixed in a solution containing 70% ethanol (Fisher, United Kingdom), 4% formalin (Sigma-Aldrich), and 5% glacial acetic acid (Sigma-Aldrich) and microscopically (Olympus BH-2 microscope, Olympus, Southall, United Kingdom) evaluated after conventional H&E staining.

Decapsulation of differentiated mESC

After differentiation in the HARV bioreactor, as described above, the hydrogel beads were depolymerized for 5 minutes at 37°C using a sterile dissolution buffer consisting of 50mM trisodium citrate dihydrate (Fluka, United Kingdom), 77mM sodium chloride (BDH Laboratory Supplies, United Kingdom), and 10mM HEPES (Sigma) in PBS. The cells were gently shaken a few times and were recovered by centrifugation at 1,200 rpm for 5 minutes. The cell pellets were washed with PBS and centrifuged again at 1,000 rpm for 5 minutes.

Flow cytometry for 3D cultivation in HARV

Hydrogel beads from the control and experimental groups were depolymerized, as described above, and the cell pellets were fixed in 4% formaldehyde (w/v) (Sigma-Aldrich) for 20 minutes at room temperature. While being fixed, the cell aggregates were resuspended a few times and sieved using a 40-μm cell strainer (VWR International Ltd., United Kingdom). Then the cells were centrifuged at 1,000 rpm for 5 minutes, rinsed with PBS, and centrifuged twice. Subsequently, the cells were divided into separate tubes for pro-SPC and aquaporin 5 (AQP5) flow cytometric analysis. After being rinsed with PBS (Invitrogen), the cells were incubated for 15 minutes at room temperature in a blocking agent consisting of 5% goat or rabbit serum (where appropriate) diluted in PBS and 0.1% Triton-X (Sigma-Aldrich). After being blocked, the cells were incubated with polyclonal antirabbit pro-SPC antibody (1:500) and polyclonal antigoat AQP5 antibody (1:300) (both from Chemicon, Upstate, United Kingdom) for 2 hours. Then the cells were rinsed with PBS and incubated with FITC-conjugated secondary antibodies (1:300), goat antirabbit for pro-SPC and rabbit anti-goat AQP5 (both from Chemicon). After being washed with PBS, the cells were analyzed using a Beckman Coulter Epic Altra Flow Cytometer (Coulter Corporation, FL) by collecting more than 20,000 events. Data were further processed using Expo32 MultiCOMP software.

Transmission electron microscopy

The hydrogel beads collected from the HARV bioreactor were rinsed with PBS and washed in a buffer containing 0.1M phosphate and 0.1M sucrose. They were rinsed with PBS again and then fixed with 3% (v/v) glutaraldehyde in cacodylate buffer (pH 7.2) for 30 minutes. Then, the samples were postfixed in 1% osmium tetroxide in 0.1M cacodylate buffer, transferred to 50% ethanol, and centrifuged. The resultant samples were encased in molten agar. The agar blocks were dehydrated and infiltrated with Araldite epoxy resin (Taab Laboratories Ltd, Reading, United Kingdom) and embedded in molds. The resin was polymerized at 60°C for 24 hours, and semithin (1 μm) and ultrathin (60-80 nm) sections were cut using a Reichert-Jung Ultracut E ultramicrotome (Leica Microsystems Nussloch GmbH,Wetzlar, Germany). For selection of areas of interest on light microscopy, the semithin sections were stained using a solution of 0.8% toluidine blue (Agar Scientific, Stansted, United Kingdom) in 0.8% borax containing 0.16% pyronin Y. The ultrathin sections were stained sequentially with a saturated solution of uranyl acetate in 50% ethanol and Reynold's lead citrate. Ultrathin sections were observed using a transmission electron microscope (Philips CM10, Amsterdam, The Netherlands).

RNA isolation and reverse transcriptase polymerase chain reaction

To determine phenotype, reverse transcriptase polymerase chain reaction (RT-PCR) was performed on samples taken at days 5, 10, 15, 20, and 25 of differentiation in the A549 cell-conditioned medium. Beads were depolymerized as described above. Dissolution of the beads maintained for longer than 10 days in culture was more difficult than at earlier time points. This could be attributed to secretion of extracellular matrix from the cells within the alginate beads. The cells were recovered from these beads after vigorous shaking, although the alginate hydrogel was not entirely dissolved. Total RNA isolation was performed using the RNeasy kit (Qiagen, United Kingdom) according to the manufacturer's instructions, and RT-PCR was performed using the ThermoScript RT-PCR system (Invitrogen Ltd., Paisley, United Kingdom). Oligo(dT)₂₀ was used to prime RT reactions for synthesis of complementary DNA (cDNA) from 1 μg of total RNA in a final volume of 20 μL. The same reaction performed in the absence of cDNA template was considered the negative control. Total lung RNA (Ambion, Inc.) was used for the positive control reaction. PCR primers (Table 1) were designed using Primer Express 2 software (Applied Biosystems, Warrington, United Kingdom). In the 50-μL PCR reaction mix, the final concentration of magnesium chloride and deoxyribonucleotide triphosphate mix were 3mM and 10mM, respectively. DNA amplification was performed in an Eppendorf Thermal Cycler (Eppendorf AG, Hamburg, Germany). DNA denaturation and activation of Taq DNA Polymerase (Fermentas, York, United Kingdom) was performed at 94°C for 10 minutes, followed by 40 cycles of template denaturation at 94°C (5 seconds), primer annealing at 56°C, and primer extension at 72°C (30 seconds). PCR products were separated on 2% (w/v) agarose gel and visualized using ethidium bromide (both Sigma-Aldrich). The size of products was determined using 50 and 100-bp ladders (Fermentas). Digital images of ethidium bromide–stained gels were captured using the Bio-Rad Fluor-S MultiImager system (Hemel Hempstead, United Kingdom).

Table 1.

Reverse Transcriptase–Polymerase Chain Reaction Primer Sequences

Gene	Primer sequence (5′→3′)	Annealing temperature, °C	Amplicon size, bp
Surfactant protein C	CAGCTCCAGGAACCTACTGC CACAGCAAGGCCTAGGAAAG	63	200
Forkhead box A2	TGGTCACTGGGGACAAGGGAA GCAACAACAGCAATAGAGAAC	59	189
Aquaporin 5	ACTGCCACAGCTCAGACCTCA AACGCCCAACCCGAATACC	58	267
Clara cell secretory protein	GCCTCCAACCTCTACCATGA CTCTTGTGGGAGGGTATCCA	55	241
Glyceraldehyde 3-phosphate dehydrogenase	TGTGTCCGTCGTGGATCTGA CCTGCTTCACCACCTTCTTGA	59	76

2D culture of decapsulated differentiated ESC

To analyze the functionality of the differentiated mESC cultured in the 3D alginate beads in the HARV bioreactor system, day 10 beads were dissolved as mentioned above. Then, the decapsulated single cells were plated in flask cultures (2D), passaged a few times after confluence, and grown for 100 days in F12K medium supplemented with 15% FBS. After harvest, the cells were characterized using immunocytochemistry, RT-PCR, transmission electron microscopy (TEM), and flow cytometry, as described above. For Western blotting, the cells were lysed using radioimmunoprecipitation assay buffer, and proteins were denatured using sodium dodecyl sulfate and boiling. Antibodies against glyceraldehyde 3-phosphate dehydrogenase and pro-SPC (Millipore) were used for detection of relevant proteins. To show the process of exocytosis of lamellar bodies (LB), fluorescent staining with LysoTracker Green DND-26 (LTG) and FM 1-43 Green dyes was performed. LTG stains intracellular LB and FM 1-43 Green stains LB fused with plasma membrane (those being exocytosed). The staining protocol was adapted from previous published reports.^23–26 Decapsulated cells were cultured on 2D surfaces (Sterilin Petri dishes, Bibbt Sterilin Ltd, Stone, Staffs, United Kingdom) as described above. The cells were incubated for 30 minutes at 37°C in DMEM containing 50 nmol/L of LTG (Invitrogen). Then, in half of the dishes (stimulated group), the medium was replaced with DMEM containing adenosine triphosphate (ATP) and isoproterenol (both from Sigma-Aldrich, United Kingdom) at a concentration of 10 μmol/L for both. ATP and isoproterenol stimulate exocytosis of LB and release of intracellular surfactant from type II cells.²⁷ In the other half of the Petri dishes (unstimulated group), the medium was replaced with the maintenance medium (F12 K supplemented with 10% (v/v) FBS and 2mM L-glutamine). Exocytosed LB were stained in stimulated and unstimulated groups in the continuous presence of FM 1-43 Green (Invitrogen) at a concentration of 4 μmol/L. Any fluorescence changes were viewed and recorded using an inverted microscope (Olympus, Southall, United Kingdom) at the fluorescence excitation and emission maxima of approximately 504 and 511 nm, respectively equipped with a color CoolPix 950 digital camera (Nikon, Kingston-upon-Thames, United Kingdom).

Results

3D integrated lung bioprocessing

Initially, different cell densities of undifferentiated mESC were encapsulated within the alginate hydrogels as a single-cell suspension (Fig. 1a). It was found that 20,000 cells per bead was an ideal starting point (data not shown) because it provided both with sufficient cellular interactions and space for cell growth. As the cultures progressed within the HARV bioreactor (Fig. 1d), cell aggregates were formed as early as day 5 of culture. The size of the aggregates increased daily, and as H&E staining illustrated, they were dispersed within the beads and achieved various sizes, the largest being approximately 450 μm long (Fig. 1b).

To test differentiation into the type II pneumocytes within the hydrogel beads, thin sections were stained with pro-SPC and counterstained for actin using rhodamine-conjugated phalloidin and for nuclei using DAPI. The cell aggregates cultured showed positive pro-SPC expression from day 10 on (Fig. 1c). Flow cytometry further confirmed the immunocytochemistry results. Specifically, FITC-conjugated antibodies were used for detection of pneumocyte type II pro-SPC and type I cell AQP5 expression. Positive antibody reaction was detected as early as day 5 for pro-SPC (9.5%) and AQP5 (1.6%). At day 7, expression increased to 38.75% for pro-SPC and 5.84% for AQP5 expression. The highest pro-SPC expression was detected at day 11, with 51.08% positive cells but decreased to 20.00% at day 15. AQP5 expression was observed to be constant from day 5 to 15 (1–6%; Fig. 2a, b).

FIG. 2.

Positive antibody reaction was detected as early as day 5 for pro-SPC with 9.5% expression and for aquaporin 5 (AQP5) with 1.6%. At day 7, expression increased to 38.75% for pro-SPC and 5.84% for AQP5 (a). The highest pro-SPC expression (51.08%) was detected at day 11 (a, b) and 7.11% for AQP5 (a). Pro-SPC expression decreased to 20.00% at day 15. AQP5 expression from day 5 to 15 was observed to be constant (1–7%) (a). Color images available online at www.liebertonline.com/tec

Ultrastructural analysis of the 3D cell aggregates confirmed that differentiation of the mESC to airway epithelium occurred as early as day 7 in the experimental group. Transmission electron micrographs revealed the typical features of type II pneumocytes, with abundant LB and microvilli, as shown in Fig. 3a to c. In certain instances, some of the aggregates became large enough to escape the confines of the hydrogel beads; TEM study of these aggregates also showed typical features of alveolar type II cells (data not shown). In contrast, TEM of mESC from the control group (cultured in maintenance medium) did not display any pneumocyte-specific cytoplasmic organelles. Furthermore, the control group included many cells with condensed nuclei compatible with apoptosis (Fig. 3d).

FIG. 3.

From day 7 in A549-conditioned medium in a HARV, the alveolar type II–like cells could be detected consisting mostly of spherical to cuboidal cells with lamellar bodies (LB) (a-c) and surface microvilli (mv) (c). In contrast, cells cultured in maintenance medium did not show any features of alveolar cells at day 10, but degenerating cells with condensed nuclei were observed (d).

Gene expression analysis using RT-PCR confirmed the expression of SPC (type II cell marker), AQP5 (type I cell marker), Clara cell secretory protein (Clara cell marker), and the endodermal transcription factor forkhead box A2 (Foxa2) in encapsulated differentiated mESC cultured in the HARV bioreactor as early as day 5 (Fig. 4). A temporal expression profile was evident, with the intensity of the SPC band at day 10 being higher than at other time points, corresponding with the flow cytometry results (Fig. 2).

FIG. 4.

Reverse transcriptase polymerase chain reaction (RT-PCR) results confirmed the expression of SPC (type II cell marker), AQP5 (type I cell marker), and Clara cell secretory protein (CCSP) and the endodermal transcription factor Foxa2 in encapsulated mESC cultured in the HARV integrated system. These findings were observed as early as day 5 in culture. +ve positive control; −ve negative control.

2D culture of decapsulated differentiated mESC

After the differentiation of the mESC in the hydrogel beads and to expose the differentiated cells to the traditional flask (2D) culture environment, we dissolved the beads and cultured the collected cells for up to 100 days in the absence of the A549-conditioned medium. Phase contrast microscopy of the decapsulated cells showed a homogenous cell population with a flat morphology (Fig. 5a), which is not the typical cobblestone morphology of type II pneumocytes. Immunocytochemistry confirmed the expression of surfactant protein C by the differentiated cells, which is a characteristic feature of type II pneumocytes, until day 100 in culture (Fig. 5b). Despite the presence of abundant LB, as demonstrated using TEM, microvilli were not observed (Fig. 5c), which could be attributed to the absence of the A549-conditioned medium. LTG/FM 1-43 staining revealed intracellular LB that fused with the cell membrane in differentiated cells (Fig. 5d). Accumulation of LTG in intracellular LB yielded bright green fluorescent spots in the control and experimental cells. FM 1-43 does not diffuse through the plasma membrane. It is nonfluorescent in aqueous solutions but emits fluorescence upon intercalating with lipids.²⁴ An intense green fluorescence (Fig. 5d) was observed only in the experimental group, which showed LB fused with plasma membrane allowing permeation of FM 1-43 through the exocytosis fusion pores. This confirms functionality of the process of exocytosis of LB in the differentiated cells. Flow cytometry for pro-SPC (and AQP5) proteins demonstrated that 39.93% and 4.06% of the cells were pro-SPC and AQP5 positive, respectively, at day 100 of 2D culture (Fig. 5e). Finally, RT-PCR confirmed SPC mRNA expression (Fig. 5f) at days 10 and 100 of 2D culture, with expression of the SPC protein being confirmed using Western blotting, as shown in Fig. 5g.

FIG. 5.

Characterization of decapsulated cells grown in two-dimensional flask cultures in static conditions for 100 days. Phase contrast microscopy showing a flat morphology (a); immunocytochemistry showing pro-SPC (green) and nuclei (blue) (b); transmission electron microscopy showing LB and few mv (c); intracellular LB were stained with LTG (faint green) after staining of LB fused with cell membrane with FM 1-43 (intense green, white arrows) after stimulation with adenosine triphosphate and isoproterenol (d); flow cytometry analysis demonstrating 39.75% pro-SPC expression (e); RT-PCR for SPC messenger RNA expression. +ve, positive control using A549 cell line; -ve, negative control using water; D10, cells harvested on day 10; D100, cells harvested on day 100) (f); Western blotting (-ve, negative control using human foreskin fibroblast cell line; +ve, positive control using A549 cell line; D100, cells harvested on day 100) (g). Color images available online at www.liebertonline.com/tec

Discussion

ESC are a potential cell source for cell replacement therapies for a variety of diseases, although there is a strong ethical debate on the methods of their acquisition, which is closely linked to debates over abortion (see²⁸). These controversies should be addressed before widespread clinical application of ESC-derived products; alternatively, different sources of pluripotent stem cells, such as induced pluripotent stem cells are being developed that do not present the same ethical considerations (see²⁹). The potential clinical use of stem–cell–derived cells will require the generation of sufficient numbers of high-quality cells for engraftment.

From a bioprocessing point of view, this translates into the implementation of robust and reproducible culture conditions and the development of automatable and scalable culture systems that are controllable, can be monitored, and provide the required optimal culture environment.²⁵ Alveolar type II cells represent suitable candidates for lung cell–based therapies because they secrete pulmonary surfactant, which reduces surface tension and prevents alveolar collapse, and these cells are considered to be alveolar epithelial progenitors because they play an important role in re-epithelialization after alveolar injury. In this study, we demonstrated a bioprocess that involves 3D culture using hydrogel encapsulation, use of A549 cell-conditioned medium, and culture in a HARV bioreactor that results in a significant number (≈50%) of mESC differentiated into pulmonary type II (with a lesser percentage being type I cells). Application of the A549-conditioned medium on mESC differentiation into alveolar epithelium has been reported before.^4,30 In particular, Roszell et al. reported that disaggregated mESC plated under 2D conditions and maintained in A549-conditioned medium for 11 days generated 11.3±7.6% SPC-positive cells, which is lower than the approximately 50% yield achieved in the 3D culture system reported herein. Furthermore, the 3D culture system resulted in type II cells with a more-defined morphology, as evidenced by the more-pronounced microvilli exhibited than under 2D culture.⁴ When mESC were cultured in the absence of A549-conditioned medium, the number of SPC-positive cells was reduced to 3.1±1.2% in serum-free and 1.5±1.6% in serum-containing media, which is similar to what has been reported elsewhere.⁷

It has been reported for many years that isolated alveolar type II cells cultured in vitro under 2D conditions lose their main phenotypic characteristics after a few days.^31–33 To assess whether the microenvironment generated by cell population within the hydrogel beads influences the duration of phenotypic maintenance of ESC-derived type II cells under 2D conditions, the hydrogel beads were dissolved, and the decapsulated cells were cultured under 2D conditions in the absence of the A549-conditioned medium. Generated type II cells maintained their major phenotypic characteristics for longer than 3 months in 2D culture, which suggests that cells not differentiated into alveolar epithelial cells play a critical role in the continuous phenotypic maintenance of type II cells. The identification of the phenotype and nature of these “other cells” may provide important clues for further optimization of the culture conditions. Continued 3D culture in the bioreactor in the absence of the A549-conditioned medium supported continued differentiation, albeit at a lower level, resulting in a more-heterogeneous cell population (data not shown).

Cell–cell and cell–matrix interactions are important factors for the generation of efficient differentiation signals; consequently, mESC were encapsulated in alginate–gelatin hydrogels to provide them with a 3D culture environment that does not suffer from the same mass transport limitations as traditional scaffolds. Furthermore, the HARV bioreactor was used to provide an enhanced mass transfer environment with low shear stress required for cell growth. The combination of cell encapsulation and a low shear stress bioreactor appear to provide a suitable cell growth environment. In addition, the HARV system promotes cell–cell interaction.^26,34,35 In recent years, we and others have attempted to derive pneumocytes from murine and human ESC using a number of techniques that commonly require extensive operator interventions and expensive culture conditions.^{6,8,10,12,36,37} These pose difficulties for the large-scale expansion and automation of the differentiation process of ESC into pulmonary epithelial cells. Furthermore, there has been no report of the functionality or phenotypic stability of the derived cells in prolonged culture. For example, Wang et al. reported an essentially pure (>99%) population of type II pneumocytes can be differentiated from ESC within 15 days using genetic manipulation and that survive for at least 2 days in culture,¹⁵ but we were able to obtain differentiated type II cells as early as day 5 and to maintain these cells stably in vitro for 100 days after decapsulation and culture under 2D conditions. The maximum number of SPC-positive cells was achieved at day 11 of culture, which could represent the optimum time point of application of these cells for in vivo experiments. Demonstration of the process of exocytosis of LB after 100 days is significant evidence of functionality of these cells and shows the potential of the present system for clinical applications.

Gene expression and ultrastructural results corresponded with immunocytochemistry and flow cytometry showing that the highest SPC expression was 51%, which was obtained on day 11 of culture. SPC expression was observed in a temporal manner. Positive antibody reaction was detected as early as day 5 for pro-SPC and AQP5. AQP5 expression from day 5 to 15 seemed to be constant, but the expression of SPC decreased from day 10 to 15. In contrast, TEM of the hydrogel beads cultured in the maintenance medium showed apoptotic cells with condensed nuclei on day 10, indicating that our 3D culture system needs further optimization and fine tuning to sustain the high level of phenotypic expression over a long period of time and avoid the start of any regressive changes. The other phenomenon that should be noted is the smaller number of microvilli seen under TEM of cells cultured under 2D conditions. This could be another indication of the greater ability of 3D than 2D cultures to confer optimal phenotypic features to differentiating cells.

Identification of type I cells in the differentiating cell population shows that the derived type II cells can fulfill not only their secretory function, but also their function as progenitor cells, which are responsible for the maintenance of type I cell pool. Foxa2 is an endodermal transcription factor involved in the process of differentiation of Clara cells.³⁸ RT-PCR confirmation of expression of Foxa2 and Clara cell secretory protein genes shows that our protocol directs mESC to differentiate not only into alveolar epithelial cells, but also into other respiratory epithelial cells, including Clara cells. The use of the A549-conditioned (a human type II pneumocyte tumor cell line) medium is not expected to support enhanced differentiation toward Clara cells, which caused us not to evaluate the yield of these cells using flow cytometry, a point that needs to be addressed in the future.

Use of our approach in a clinical setting requires that several challenges be addressed, including removal of any residual undifferentiated cells that can lead to teratoma formation, consideration of immune rejection and the need for immunosuppressive therapy, and achieving current good manufacturing practices for the production of the cellular products, including defined culture conditions (see³⁹). In conclusion, in this study, we were able to produce pneumocyte-like cells (type I and II) from mESC by designing a novel protocol, which has several advantages over the previous differentiation protocols: shorter differentiation time (differentiation could be achieved as early as day 5 after the start of differentiation), cheaper overall cost (growth factors were not used), high reproducibility (the cells can be cultured in many passages), high phenotypic stability in two or three dimensions, significantly higher yield of target cells (more than 50% of the differentiating cells),) high functional stability of type II cells (detection of type I cells in culture and exocytosis in LB after 100 days in culture), and amenability to automation (the requirement for operator intervention is minimal). The present study reports a novel stem cell bioprocess for production of the main regenerative cellular components of the peripheral lungs.

Footnotes

Acknowledgments

The authors would like to acknowledge the financial support for this project from the Department of Trade and Industry in the United Kingdom and the Rosetrees Foundation.

Author Disclosure Statement

No competing financial interests exist.

References

Serrano-Mollar

, Nacher

, Gay-Jordi

, Closa

, Xaubet

, Bulbena

Intratracheal transplantation of alveolar type II cells reverses bleomycin-induced lung fibrosis. Am J Respir Crit Care Med, 176:1261. 2007.

Guillamat Prats

, Sánchez-López

, Sirenko

, Xaubet

, Bulbena

, Serrano-Mollar

Transplant of alveolar type II cells restore pulmonary surfactant levels in lung fibrosis. Am J Respir Crit Care Med, 181:A3987. 2010.

Wang

, Morales

J.E.

, Calame

D.G.

, Alcorn

J.L.

, Wetsel

R.A.

Transplantation of human embryonic stem cell-derived alveolar epithelial type II cells abrogates acute lung injury in mice. Mol Ther, 18:625. 2010.

Roszell

B.R.

, Mondrinos

M.J.

, Seaton

, Simons

D.M.

, Koutzaki

S.H.

, Fong

G.H.

, Lelkes

P.I.

, Finck

C.M.

Efficient derivation of alveolar type II cells from embryonic stem cells for in vivo application. Tissue Eng Part A, 15:3351. 2009.

Samadikuchaksaraei

, Bishop

A.E.

Derivation and characterization of alveolar epithelial cells from murine embryonic stem cells in vitro. Methods Mol Biol, 330:233. 2006.

Samadikuchaksaraei

, Cohen

, Isaac

, Rippon

H.J.

, Polak

J.M.

, Bielby

R.C.

, Bishop

A.E.

Derivation of distal airway epithelium from human embryonic stem cells. Tissue Eng, 12:867. 2006.

Samadikuchaksaraei

, Bishop

A.E.

Effects of growth factors on the differentiation of murine ESC into type II pneumocytes. Cloning Stem Cells, 9:407. 2007.

Rippon

H.J.

, Ali

N.N.

, Polak

J.M.

, Bishop

A.E.

Initial observations on the effect of medium composition on the differentiation of murine embryonic stem cells to alveolar type II cells. Cloning Stem Cells, 6:49. 2004.

Cohen

, Samadikuchaksaraei

, Polak

J.M.

, Bishop

A.E.

Antibiotics reduce the growth rate and differentiation of embryonic stem cell cultures. Tissue Eng, 12:2025. 2006.

10.

Rippon

H.J.

, Polak

J.M.

, Qin

, Bishop

A.E.

Derivation of distal lung epithelial progenitors from murine embryonic stem cells using a novel three-step differentiation protocol. Stem Cells, 24:1389. 2006.

11.

Van Vranken

B.E.

, Rippon

H.J.

, Samadikuchaksaraei

, Trounson

A.O.

, Bishop

A.E.

The differentiation of distal lung epithelium from embryonic stem cells. Curr Protoc Stem Cell Biol, Chapter 1:1. 2007.

12.

Qin

, Tai

, Collas

, Polak

J.M.

, Bishop

A.E.

Cell extract-derived differentiation of embryonic stem cells. Stem Cells, 23:712. 2005.

13.

Lin

Y.M.

, Zhang

, Rippon

H.J.

, Bismarck

, Bishop

A.E.

Tissue engineering of lung: the effect of extracellular matrix on the differentiation of embryonic stem cells to pneumocytes. Tissue Eng Part A, 16:1515. 2010.

14.

Lin

Y.M.

, Zhang

, Bismarck

, Bishop

A.E.

Effects of fibroblast growth factors on the differentiation of the pulmonary progenitors from murine embryonic stem cells. Exp Lung Res, 36:307. 2010.

15.

Wang

, Haviland

D.L.

, Burns

A.R.

, Zsigmond

, Wetsel

R.A.

A pure population of lung alveolar epithelial type II cells derived from human embryonic stem cells. Proc Natl Acad Sci U S A, 104:4449. 2007.

16.

Magyar

J.P.

, Nemir

, Ehler

, Suter

, Perriard

J.C.

, Eppenberger

H.M.

Mass production of embryoid bodies in microbeads. Ann N Y Acad Sci, 944:135. 2001.

17.

Siti-Ismail

, Bishop

A.E.

, Polak

J.M.

, Mantalaris

The benefit of human embryonic stem cell encapsulation for prolonged feeder-free maintenance. Biomaterials, 29:3946. 2008.

18.

Randle

W.L.

, Cha

J.M.

, Hwang

Y.S.

, Chan

K.L.

, Kazarian

S.G.

, Polak

J.M.

, Mantalaris

Integrated 3-dimensional expansion and osteogenic differentiation of murine embryonic stem cells. Tissue Eng, 13:2957. 2007.

19.

Hwang

Y.S.

, Cho

, Tay

, Heng

J.Y.

, Ho

, Kazarian

S.G.

, Williams

D.R.

, Boccaccini

A.R.

, Polak

J.M.

, Mantalaris

The use of murine embryonic stem cells, alginate encapsulation, and rotary microgravity bioreactor in bone tissue engineering. Biomaterials, 30:499. 2009.

20.

Miranda

J.P.

, Rodrigues

, Tostoes

R.M.

, Leite

, Zimmerman

, Carrondo

M.J.

, Alves

P.M.

Extending hepatocyte functionality for drug-testing applications using high-viscosity alginate-encapsulated three-dimensional cultures in bioreactors. Tissue Eng Part C Methods, 16:1223. 2010.

21.

Hammond

T.G.

, Hammond

J.M.

Optimized suspension culture: the rotating-wall vessel. Am J Physiol Renal Physiol, 281:F12. 2001.

22.

Ayyaswamy

P.S.

, Mukundakrishnan

. Optimal conditions for simulating microgravity employing NASA designed rotating wall vessels. Acta Astronaut, 60:397. 2002.

23.

Bertrand

C.A.

, Laboisse

, Hopfer

, Bridges

R.J.

, Frizzell

R.A.

Methods for detecting internalized, FM 1-43 stained particles in epithelial cells and monolayers. Biophys J, 91:3872. 2006.

24.

Jennings

, Bertocchi

, Frick

, Haller

, Pfaller

, Dietl

Ca2+ induced surfactant secretion in alveolar type II cultures isolated from the H-2Kb-tsA58 transgenic mouse. Cell Physiol Biochem, 15:159. 2005.

25.

Placzek

M.R.

, Chung

I.M.

, Macedo

H.M.

, Ismail

, Mortera

B.T.

, Lim

, Cha

J.M.

, Fauzi

, Kang

, Yeo

D.C.

, Ma

C.Y.

, Polak

J.M.

, Panoskaltsis

, Mantalaris

Stem cell bioprocessing: fundamentals and principles. J R Soc Interface, 6:209. 2009.

26.

Low

H.P.

, Savarese

T.M.

, Schwartz

W.J.

Neural precursor cells form rudimentary tissue-like structures in a rotating-wall vessel bioreactor. In Vitro Cell Dev Biol Anim, 37:141. 2001.

27.

Haller

, Ortmayr

, Friedrich

, Volkl

, Dietl

Dynamics of surfactant release in alveolar type II cells. Proc Natl Acad Sci U S A, 95:1579. 1998.

28.

, Parham

. Ethical issues in stem cell research. Endocr Rev, 30:204. 2009.

29.

Suaudeau

From embryonic stem cells to iPS—an ethical perspective. Cell Prolif, 44,Suppl 1:70. 2011.

30.

Rippon

H.J.

, Lane

, Qin

, Ismail

N.S.

, Wilson

M.R.

, Takata

, Bishop

A.E.

Embryonic stem cells as a source of pulmonary epithelium in vitro and in vivo. Proc Am Thorac Soc, 5:717. 2008.

31.

Rice

W.R.

, Conkright

J.J.

, Na

C.L.

, Ikegami

, Shannon

J.M.

, Weaver

T.E.

Maintenance of the mouse type II cell phenotype in vitro. Am J Physiol Lung Cell Mol Physiol, 283:L256. 2002.

32.

Wang

, Edeen

, Manzer

, Chang

, Wang

, Chen

, Funk

C.J.

, Cosgrove

G.P.

, Fang

, Mason

R.J.

Differentiated human alveolar epithelial cells and reversibility of their phenotype in vitro. Am J Respir Cell Mol Biol, 36:661. 2007.

33.

Witherden

I.R.

, Vanden Bon

E.J.

, Goldstraw

, Ratcliffe

, Pastorino

, Tetley

T.D.

Primary human alveolar type II epithelial cell chemokine release: effects of cigarette smoke and neutrophil elastase. Am J Respir Cell Mol Biol, 30:500. 2004.

34.

Nickerson

C.A.

, Ott

C.M.

, Wilson

J.W.

, Ramamurthy

, Pierson

D.L.

Microbial responses to microgravity and other low-shear environments. Microbiol Mol Biol Rev, 68:345. 2004.

35.

Botta

G.P.

, Manley

, Miller

, Lelkes

P.I.

Real-time assessment of three-dimensional cell aggregation in rotating wall vessel bioreactors in vitro. Nat Protoc, 1:2116. 2006.

36.

Ali

N.N.

, Edgar

A.J.

, Samadikuchaksaraei

, Timson

C.M.

, Romanska

H.M.

, Polak

J.M.

, Bishop

A.E.

Derivation of type II alveolar epithelial cells from murine embryonic stem cells. Tissue Eng, 8:541. 2002.

37.

Van Vranken

B.E.

, Romanska

H.M.

, Polak

J.M.

, Rippon

H.J.

, Shannon

J.M.

, Bishop

A.E.

Coculture of embryonic stem cells with pulmonary mesenchyme: a microenvironment that promotes differentiation of pulmonary epithelium. Tissue Eng, 11:1177. 2005.

38.

Yoshimi

, Nakamura

, Shimada

, Iguchi

, Hashimoto

, Mochitate

, Takahashi

, Miura

Homeobox B3, FoxA1 and FoxA2 interactions in epithelial lung cell differentiation of the multipotent M3E3/C3 cell line. Eur J Cell Biol, 84:555. 2005.

39.

Malgieri

, Novelli

, Sangiuolo

Potential clinical applications of embryonic stem cells. Atwood

Embryonic Stem Cells: Recent Advances in Pluripotent Stem Cell-Based Regenerative Medicine. Rijeka, Croatia: InTech, 2011; 21–48.