Impaired Vitamin D Activation and Association with CYP24A1 Haplotypes in Differentiated Thyroid Carcinoma

Abstract

Background:

Common polymorphisms of the vitamin D receptor gene have been reported to affect the risk of breast, colon, prostate, and differentiated thyroid cancer (DTC), but polymorphisms within the genes of vitamin D metabolizing enzymes have not been studied in DTC. The aim of the present study was to investigate the genes for vitamin D enzymes in patients with DTC and healthy controls (HC) as well as the vitamin D (25-hydroxyvitamin D₃, and 1,25-hydroxyvitamin) status.

Methods:

German patients (n=253) with DTC (papillary thyroid carcinoma [PTC] and follicular thyroid carcinoma [FTC]) and HC (n=302) were genotyped for polymorphisms within the vitamin D metabolizing enzymes such as 25-hydroxylase (CYP2R1[rs12794714, rs10741657]), 25-hydroxyvitamin D-1α-hydroxylase (CYP27B1[rs10877012, rs4646536]), and 25-hydroxyvitamin D 24-hydrolase (CYP24A1[rs927650, rs2248137, rs2296241]). Furthermore, the 25-hydroxyvitamin D₃ [25(OH)D₃] and 1,25-hydroxyvitamin [1,25(OH)₂D₃] plasma levels were measured by a radioimmunoassay.

Results:

There was no difference in the genotypes; however, the CYP24A1 haplotype analysis showed that rs2248137C/rs2296241A (13.1% vs. 19.1%; corrected p [pc]=0.04) was less frequent in the PTC, whereas the haplotypes rs2248137C/rs2296241G (56.0% vs. 41.9%; pc=0.03), rs927650C/rs2296241G (22.5% vs. 8.4%; pc=1.6×10⁻³), and rs927650C/rs2248137C/rs2296241G (21.1% vs. 7.3%; pc=1.5×10⁻³) were more frequent in the FTC compared with HC. Furthermore, if patients and controls were grouped according to four 25(OH)D₃ categories (severely deficient, deficient, insufficient, and sufficient), then the patients with both DTC subtypes had significantly lower levels of circulating 1,25(OH)₂D₃, especially in the group with a deficient 25(OH)D₃ status compared with the controls. Although the polymorphisms showed no differences stratified for the four 25(OH)D₃ categories, the activation status by 1,25(OH)₂D₃ differed significantly depending on the genotypes of the investigated CYP24A1 polymorphisms.

Conclusions:

A higher risk for DTC is conferred by haplotypes within the CYP24A1 gene, low circulating 25(OH)D₃ levels (deficiency), and a reduced conversion to 1,25(OH)₂D₃. These results confirm and extend previous observations and also support a role of the vitamin D system in the pathogenesis of DTC. How deficient 25(OH)D₃ levels in combination with certain CYP24A1 haplotypes affect vitamin D activation is the subject of future studies.

Introduction

T hyroid cancer is the most common malignancy of the endocrine system, representing ∼1% of all neoplasias (1). Among them, differentiated thyroid carcinoma (DTC) includes papillary (85% of cases) and follicular (10% of cases) subtypes as the most frequent (2). Thyroid carcinogenesis is a multistep process involving a multifactorial interplay between genetic and environmental factors. Environmental exposure to lower levels of ultraviolet (UV) radiation, which is essential for the synthesis of vitamin D, may be a risk factor for higher cancer incidence of many types (3). Furthermore, we earlier reported an altered vitamin D system in DTC, including lower circulating 1,25-hydroxyvitamin D as well as an association with vitamin D receptor (VDR) polymorphisms (4). This led us to investigate whether vitamin D status is useful to link genetic factors and the environment in the pathogenesis of thyroid malignancies. Specific enzymes regulate the synthesis and degradation of 25-hydroxyvitamin D₃ [calcidiol; 25(OH)D₃] and 1,25 hydroxyvitamin D₃ [calcitriol; 1,25(OH)₂D₃], whose genetic polymorphisms may modify the risk for DTC by changing the bioavailability of 25(OH)D₃ and 1,25(OH)₂D₃.

The photochemical synthesis of vitamin D₃ (cholecalciferol) occurs cutaneously, where provitamin D₃ (7-dehydrocholesterol) is converted to previtamin D₃ in response to UV sunlight exposure. Vitamin D₃ obtained from the isomerization of previtamin D₃ is hydroxylated in the liver through the cytochrome P450 enzyme, 25-hydroxylase (CYP2R1) to form 25(OH)D₃, the major circulating form of vitamin D (5). In the kidney, 25(OH)D₃ is activated by 1α-hydroxylase (CYP27B1) to the metabolite 1,25(OH)₂D₃ (6). 1,25(OH)₂D₃ binds to the nuclear VDR in target organs, forming heterodimers with the retinoid X receptor and recruiting other transcriptional cofactors that regulate target gene transcription, including those involved in cell proliferation, differentiation, and apoptosis (7 –9). The final step in the vitamin D metabolism pathway is the degradation of 25(OH)D₃ and 1,25(OH)₂D₃ to 24,25(OH)D₃ and 24,25(OH)₂D₃, respectively, which occurs through 24-hydroxylation by 25-hydroxyvitamin D 24-hydrolase (CYP24A1) (10). The aim of this study was to investigate the polymorphisms within the vitamin D metabolizing genes CYP2R1 (rs12794714, rs10741657), CYP27B1 (rs10877012, rs4646536), and CYP24A1 (rs927650, rs2248137, rs2296241) and their influence on vitamin D levels [25(OH)D₃ and 1,25(OH)₂D₃] in DTC.

Methods

Subjects

In total, 253 patients (167 women and 86 men) with a pathologically confirmed diagnosis of DTC (205 papillary: 137 women and 68 men and 48 follicular: 30 women and 18 men) and known tumor-node-metastasis stage were recruited from the Departments of Medicine 1 and of Nuclear Medicine in the University Hospital as well as from the Department of Surgery, Bürgerhospital, Frankfurt am Main, Germany. Healthy controls (HC; n=302, 138 women and 164 men) were volunteer blood donors from the staff or medical students without a family history of thyroid carcinoma. All participants were of German origin and inhabitants of the area surrounding Frankfurt am Main, Germany. The median age of the patients with DTC and HC was 55 and 38 years, respectively. The study protocol was approved by the ethics committee of the University Hospital Frankfurt am Main, and informed consent was obtained from all participants.

Genes and polymorphisms

In total, seven polymorphisms were investigated: two for 11p15/CYP2R1 (length 15.5 kb, 5 exons), two for 12q13/CYP27B1 (length 4.8 kb, 9 exons), and three for 20q13/CYP24A1 (length 20.5 kb, 12 exons) were selected. Polymorphism positions are given according to the National Center for Biotechnology Information (NCBI; www.ncbi.nlm.nih.gov): The rs12794714 (T/C, Ser→Ser) is a synonymous polymorphism in exon 2 of CYP2R1, whereas the polymorphism rs10741657 (G/C) is mapped to a 2-kb mRNA transcript. The rs10877012 polymorphism within the CYP27B1 (−1260 C/A) is located in the promoter region, exactly in the AP-2 transcription-factor binding motif and the rs4646536 polymorphism (+2838 C/T) in intron 6. While the rs927650 (C/T) and rs2248137 (C/G) are intronic polymorphisms, the rs2296241 (A/G) is synonymous in exon 4 of the CYP24A1 gene.

Genotyping

Genomic DNA was extracted from whole blood by the salting-out procedure (11) and was used for restriction fragment length polymorphism and real-time polymerase chain reaction (PCR) methods. For the CYP2R1 (rs12794714, rs10741657), the DNA was amplified with the primer pairs and PCR conditions as previously described (12). The CYP24A1 rs927650 polymorphism was examined using the primers 5′-TGGTTGCATAACACAAACCTA-3′ and 5′-CTGAAAGCCAGTAACAATGGT-3′. The annealing temperature was 59°C. The amplified DNA for rs12794714 and rs10741657 polymorphisms (288-bp and 303-bp, respectively) were digested with enzymes (MnII and FokI, respectively; New England Biolabs^®) according to the manufacturer's instructions. The resulting 311-bp PCR product for rs927650 was digested with BgLII and revealed two fragments of 210-bp and 101-bp if the allele T was present. The digestion products were separated on 3% agarose gel visualized by ethidiumbromide staining. The polymorphisms within the CYP24A1 gene (rs2248137/C_1915659; rs2296241/C_1915656_30) and CYP27B1 gene (rs4646536/C_25623453; rs10877012/assay-by-design) were analyzed using Taqman assays in an ABI 7300 PCR system under the conditions recommended by the manufacturer (Applied Biosystems). Finally, the CYP27B1 rs10877012 promoter polymorphism was studied using the following primer and probe sequences: forward, GGGAGTAAGGAGCAGAGAGGTAAA; reverse, AACAGAGAGAGGGCCTGTCT; FAM-labelled probe for C allele, TGTGGGAGATTCTTTTA; VIC-labeled probe for A allele, CTGTGGGAGATTATTTTA (13). In order to confirm the accuracy of the methods, random samples of the studied polymorphism were genotyped twice with a concordance of 98%.

Measurement of 25(OH)D₃ and 1,25(OH)₂D₃

25(OH)D₃ and 1,25(OH)₂D₃ were measured by a radioimmunoassay (DiaSorin and IDS, respectively) in the plasma of patients with DTC and HC. For the determination of both metabolites, fresh ethylenediaminetetraacetic acid blood samples were immediately centrifuged at 600 g for 10 minutes, and separated plasma was stored at −20°C. The blood samples of the patients and controls were obtained in the period from October 2006 to December 2008 and from April 2007 to September 2009, respectively. We defined German seasons as winter (November–March) and summer (April–October). Patients with papillary thyroid cancer (PTC) and follicular thyroid carcinoma (FTC) as well as control subjects were sampled more frequently in the summer (67%, 71%, and 83%, respectively). Circulating levels of 25(OH)D₃ were defined as being severely deficient (<10 ng/mL or <25 nM), deficient (10–20 ng/mL or 25–50 nM), insufficient (20–30 ng/mL or 50–75 nM), and sufficient (>30 ng/mL or >75 nM) (14). The plasma concentration of 1,25(OH)₂D₃ was considered normal in the range of 19.9–67 pg/mL according to the manufacturer's instructions.

Clinical parameters

The parathyroid hormone levels were not available for the patients with DTC. For the evaluation of the renal function, creatinine values (patients: n=136) were documented and found to be normal (median=0.9 mg/dL; normal range 0.66–1.09 mg/dL). The calcium values of 172 patients were provided. The calcium concentration was in a normal range (2.1–2.55 mM) in most of the patients with DTC (90%). Hypocalcemia (<2.1 mM) was found in 15 patients (8.7%), and hypercalcemia (>2.55 mM) was found in 2 patients (1.3%). The determination of creatinine and calcium was performed using the Cobas^® analyzer (Roche Diagnostics). The reference range was obtained from the manufacturer of the measuring system.

Statistical analysis

Deviation from the Hardy–Weinberg equilibrium, differences in genotype, and allele distributions between groups were evaluated by χ²-test (BiAS software, package 9.08; Epsilon). The haplotype frequencies for the CYP2R1, CYP27B1, and CYP24A1 polymorphisms as well as the linkage disequilibrium (LD) between markers were estimated using Haploview software version 3.11 (www.broad.mit.edu/mpg/haploview). The odds ratio (OR) and its 95% confidence interval (CI) were estimated by unconditional logistic regression as a measure of the associations between haplotypes and thyroid cancer risk. The p-values were corrected by multiplication with the number of genotypes, alleles, or haplotypes tested (Bonferroni correction). Power calculation for each group was performed assuming an allele frequency of 41.7% (derived from controls used in this study) and a type 1 error rate of 5%. On the basis of these assumptions, we estimate that we have a power >80% to detect an allelic OR >2.40 or <0.38 (FTC) and >1.66 or <0.59 (PTC) for disease susceptibility in the case/control data set by using the software Power and Sample Size Calculations 2.1.30 (http://biostat.mc.vanderbilt.edu/PowerSampleSize). Since the 25(OH)D₃ and 1,25(OH)₂D₃ concentrations were not usually distributed according to the Kolmogoroff–Smirnoff test; nonparametric tests were used for the comparisons between the groups (Wilcoxon–Mann–Whitney and Kruskal–Wallis test; BiAS software). Furthermore, vitamin D levels were correlated with genotypes. These comparisons were performed using the Kruskal–Wallis test. In case the p-value of the Kruskal–Wallis test was <0.05, then a multiple Conover–Iman comparison between the groups was performed, and the p-values were corrected (Bonferroni correction). A p-value of <0.05 was considered significant.

Results

Genotype analysis

All samples were in the Hardy–Weinberg Equilibrium (p>0.05) for each polymorphism. No significant differences were observed in the genotype (Table 1) and allele (data not shown) frequencies between patients with PTC, FTC, and HC for the CYP2R1 (rs12794714, rs10741657), CYP27B1 (rs10877012, rs4646536), and CYP24A1 (rs927650, rs2248137) polymorphisms. In addition, no differences were observed when stratifying the polymorphisms for gender (data not shown). While the CYP24A1 rs2296241 polymorphism in the PTC group revealed no difference in the distribution compared with HC, the FTC group showed that the genotype AA for the CYP24A1 rs2296241 polymorphism was less frequent (18.8% vs. 29.5%), whereas the GG genotype was more frequent (35.4% vs. 20.5%) in patients with FTC compared with those with HC (p=0.05, corrected [pc]=0.15; Table 1). In addition, the distribution of allele frequencies for the CYP24A1 rs2296241 polymorphism differed between FTC patients and controls (allele A: 41.7% vs. 54.5%, OR 0.6 [95% CI, 0.39–0.92]; allele G: 58.3% vs. 45.5%, OR 1.67 [95% CI, 1.08–2.59]; p=0.03, pc _trend=0.06). A similar trend was observed in men (data not shown) but after adjusting for multiple comparisons, these associations also were no longer significant.

Table 1.

Distribution of CYP2R1 (rs12794714, rs10741657), CYP27B1 (rs10877012, rs4646536), and CYP24A1 (rs927650, rs2248137, and rs2296241) Gene Polymorphisms in Patients with Papillary Thyroid Cancer, Follicular Thyroid Cancer, and Healthy Controls

	HC, n=302		PTC, n=205				FTC, n=48
Genotypes	n	%	n	%	p	pc	n	%	p	pc
CYP2R1 rs12794714
GG	94	31.1	65	31.7			13	27.1
AG	144	47.7	104	50.7	0.59	1.77	26	54.2	0.70	2.1
AA	64	21.2	36	17.6			9	18.7
CYP2R1 rs10741657
GG	119	39.4	75	36.6			21	43.8
GA	139	46.0	91	44.4	0.40	1.20	19	39.5	0.70	2.1
AA	44	14.6	39	19.0			8	16.7
CYP27B1 rs10877012
CC	134	44.4	99	48.3			18	37.5
AC	126	41.7	84	41.0	0.50	1.50	24	50.0	0.56	1.68
AA	42	13.9	22	10.7			6	12.5
CYP27B1 rs4646536
TT	138	45.7	96	46.8			18	37.5
TC	122	40.4	87	42.5	0.57	1.71	24	50.0	0.45	1.35
CC	42	13.9	22	10.7			6	12.5
CYP24A1 rs927650
TT	79	26.1	44	21.5			9	18.7
CT	150	49.7	99	48.3	0.24	0.72	27	56.3	0.53	1.59
CC	73	24.2	62	30.2			12	25.0
CYP24A1 rs2248137
CC	116	38.4	73	35.6			24	50.0
CG	136	45.0	89	43.4	0.44	1.32	18	37.5	0.31	0.93
GG	50	16.6	43	21.0			6	12.5
CYP24A1 rs2296241
AA	89	29.5	57	27.8			9	18.8
AG	151	50.0	101	49.3	0.79	2.37	22	45.8	0.05	0.15
GG	62	20.5	47	22.9			17	35.4

p-Values = 0.05 is boldface.

HC, healthy controls; PTC, papillary thyroid cancer; FTC, follicular thyroid carcinoma; pc, corrected p.

Haplotype analysis

The LD was calculated between the rs12794714 and rs10741657 polymorphisms within the CYP2R1 gene (LD: LOD=56.23; D′=0.825 [0.76–0.88]), between the rs10877012 and rs4646536 polymorphisms within the CYP27B1 gene (LD: LOD=158.63; D′=0.905 [0.87–0.93]), and between the following polymorphisms within the CYP24A1 gene: rs2248137 and rs2296241 (LD: LOD=67.74; D′=0.82 [0.76–0.87]), rs927650 and rs2248137 (LD: LOD=14.76; D′=0.423 [0.33–0.5]), and rs927650 and rs2296241 (LD: LOD=39.07; D′=0.534 [0.47–0.59]).

The haplotype analysis showed that the rare haplotype rs10877012A/rs4646536T for CYP27B1 (1% vs. 3.2%; pc _trend=0.06, data not shown) and the haplotype rs2248137C/rs2296241A for CYP24A1 (13.1% vs. 19.1%; pc=0.04) was less frequent in the PTC, whereas the haplotype rs2248137C/rs2296241G (56.0% vs. 41.9%; pc=0.03) was more frequent in the FTC compared with the HC. Furthermore, patients with DTC more often carried the haplotypes rs927650C/rs2296241G (PTC 12.9% vs. 8.4%, pc _trend=0.09; FTC 22.5%, pc=1.6×10⁻³) and rs927650C/rs2248137C/rs2296241G (PTC 11.8% vs. 7.3%, pc _trend=0.09; FTC 21.1%, pc=1.5×10⁻³) for CYP24A1 than the HC (Table 2). Finally, the haplotypes for CYP2R1 did not reveal any statistically significant associations with DTC (data not shown).

Table 2.

Comparison of CYP24A1 Haplotypes Derived from rs927650, rs2248137, and rs2296241 in Patients with Papillary Thyroid Cancer, Follicular Thyroid Cancer, and Healthy Controls

	HC, n=302	PTC, n=205					FTC, n=48
Haplotypes	F (%)	F (%)	OR	[95% CI]	p	pc	F (%)	OR	[95% CI]	p	pc
rs2248137/rs2296241
CA	19.1	13.1	0.64	[0.45–0.91]	0.01	0.04	12.7	0.62	[0.33–1.17]	0.14	0.42
CG	41.9	44.2	1.00	[0.86–1.42]	0.51	0.54	56.0	1.77	[1.14–2.73]	0.01	0.03
GA	35.4	39.4	1.18	[0.91–1.53]	0.23	0.71	28.9	0.74	[0.46–1.19]	0.18	0.53
rs927650/rs2248137
CC	21.4	22.9	1.09	[0.80–1.47]	0.59	2.36	30.6	1.62	[1.00–2.60]	0.06	0.23
CG	27.6	31.5	1.21	[0.92–1.59]	0.14	0.58	22.5	0.76	[0.46–1.27]	0.33	1.32
TC	39.5	34.5	0.81	[0.62–1.05]	0.09	0.38	38.2	0.95	[0.61–1.47]	0.88	3.54
TG	11.5	11.1	0.96	[0.65–1.43]	0.81	3.25	8.7	0.73	[0.35–1.56]	0.26	1.05
rs927650/rs2296241
CA	40.6	41.5	1.04	[0.81–1.34]	0.68	2.74	30.6	0.65	[0.41–1.03]	0.11	0.43
CG	8.4	12.9	1.60	[1.60–2.40]	0.02	0.09	22.5	3.14	[1.80–5.49]	4.0×10^–4	1.6×10^–3
TA	13.9	10.9	0.76	[0.51–1.11]	0.10	0.40	11.0	0.77	[0.39–1.51]	0.18	0.73
TG	37.1	34.7	0.90	[0.69–1.17]	0.48	1.92	35.9	0.95	[0.61–1.49]	0.93	3.74
rs927650/rs2248137/rs2296241
CCA	14.4	10.9	0.72	[0.49–1.06]	0.10	0.50	10.4	0.69	[0.35–1.38]	0.28	1.41
CCG	7.3	11.8	1.71	[1.11–2.63]	0.02	0.09	21.1	3.40	[1.90–6.06]	3.0×10^–4	1.5×10^–3
CGA	26.1	30.7	1.25	[0.95–1.65]	0.10	0.50	19.3	0.68	[0.39–1.16]	0.30	1.50
TCG	34.6	32.4	0.91	[0.69–1.18]	0.50	2.49	34.9	1.01	[0.64–1.59]	0.74	3.70
TGA	9.3	8.7	0.93	[0.60–1.44]	0.57	2.86	9.6	1.04	[0.50–2.16]	0.40	1.99

p-Values <0.05 are boldface. Haplotypes with a frequency (F) >5% in both groups are listed.

OR, odds ratio; 95% CI, 95% confidence interval.

Plasma 25(OH)D₃ and 1,25(OH)₂D₃ levels

Data for 25(OH)D₃ and 1,25(OH)₂D₃ were available in the plasma of 173 patients with PTC (women n=109; men n=64), 38 patients with FTC (women n=24; men n=14), and 104 patients with HC (women n=56; men n=48).

The median ages of the control subjects differed from those of the patients with DTC. Since one of the possible causes for developing vitamin D deficiency is aging by reduced skin production of the vitamin D precursor, we examined whether a relationship between age in our controls and the production of vitamin D exists. We found no association between age and circulating 25(OH)D₃ or 1,25OH₂D₃ levels in our control group (data not shown).

As expected and previously reported (4), the plasma levels of 1,25(OH)₂D₃ but not 25(OH)D₃ were significantly lower in individuals with PTC and FTC compared with those with HC (pc=3.0×10⁻⁷ and pc=1.8×10⁻⁵ respectively, data not shown). Twenty and 0.2% of patients were severely vitamin D deficient, 42.3% were deficient, 26% were insufficient, and only 11.5% were sufficient. Nevertheless, only in the HC group but not in the patient group was the vitamin D level significantly reduced in winter compared with the summer season [1,25(OH)₂D₃: 43 pg/mL vs. 56 pg/mL, p=0.04; 25(OH)D₃: 12 ng/mL vs. 20 ng/mL, p=0.01]. In contrast, patients with DTC had similarly low levels of 25(OH)D₃ during winter and summer periods (PTC: 16 ng/mL vs. PTC: 17 ng/mL, p=0.78; FTC: 14 ng/mL vs. 12 ng/mL, p=0.87).

In order to evaluate the effect of 25(OH)D₃ status on the production of 1,25(OH)₂D₃ levels, the patients and controls were divided into four 25(OH)D₃ subgroups (severely deficient, deficient, insufficient, and sufficient). While 25(OH)D₃-deficient PTC and FTC patients have a lower concentration of 1,25(OH)₂D₃ in median (35 and 30 pg/mL) than controls (53 pg/mL; pc=2×10⁻⁵, pc=2×10⁻³, respectively), no difference was observed in the severely deficient group. Furthermore, only PTC patients with an insufficient or sufficient 25(OH)D₃ had lower levels of 1,25(OH)₂D₃ compared with the controls (Table 3).

Table 3.

1,25(OH)₂D₃ Concentration in Patients with Papillary Thyroid Cancer, Follicular Thyroid Cancer, and Healthy Controls According to 25(OH)D₃ Status

		1,25 (OH)₂D₃ [pg/mL]
25 (OH)D₃ status	n	Median	Range	p	pc
Severely deficient (<10 ng/mL)
HC	21	43	4–76
PTC	35	34	7–117	^a
FTC	28	28	3–58
Deficient (10–20 ng/mL)
HC	44	53	14–93
PTC	75	35	5–120	7×10 ⁻⁶	2×10^‒5
FTC	12	30	14–89	8.2×10 ⁻⁴	2×10 ⁻³
Insufficient (20–30 ng/mL)
HC	27	68	33–92
PTC	39	49	3–86	1×10 ⁻³	3×10 ⁻³
FTC	3	45	8–47	0.03	0.09
Sufficient (>30 ng/mL)
HC	12	58	38–72
PTC	24	33	8–96	2×10 ⁻³	6×10 ⁻³
FTC	11	51	25–67	0.10	0.30

p-Values <0.05 are boldface. Kruskal–Wallis test global p<0.05; multiple Conover–Iman comparison (Bonferroni corrected).

Kruskal p global p>0.05.

1,25(OH)₂D₃, 1,25-hydroxyvitamin; 25(OH)D₃, 25-hydroxyvitamin D₃.

Plasma 1,25(OH)₂D₃ levels and genotypes

In order to analyze whether the haplotype combination of CYP27B1 and CYP24A1 was associated with higher or lower vitamin D levels [25(OH)D₃ and 1,25(OH)₂D₃], the genotypes between patients with DTC and HC as well as within the groups were compared. A relationship between 1,25(OH)₂D₃ (Table 4) but not 25(OH)D₃ status (data not shown) with polymorphisms of the vitamin D system genes was observed. Patients with PTC and the genotype CC/AC of rs10877012, genotypes CC/CG of rs2248137 and genotypes AA/AG of rs2296241 had lower levels of 1,25(OH)₂D₃ in comparison to those with HC with the same combinations. In contrast, all three genotypes of the rs4646536 and rs927650 polymorphisms demonstrated a lower level of 1,25(OH)₂D₃ in patients with PTC compared with those with HC. In addition, a lower level of circulating 1,25(OH)₂D₃ was observed in patients with FTC of rs10877012 genotype AC, rs4646536 genotypes CC/TC, rs2248137 genotype CG, and rs2296241 genotype GG (Table 4).

Table 4.

Distribution of the CYP27B1 (rs10877012, rs4646536) and CYP24A1 (rs927650, rs2248137, rs2296241) Polymorphisms According to the Median 1,25(OH)₂D₃ Plasma Levels in Patients with Papillary Thyroid Cancer, Follicular Thyroid Cancer, and Healthy Controls

			1,25(OH)₂D₃ (median; pg/mL)
	HC, n=104		PTC, n=173			FTC, n=38
	Median (n)	Range	Median (n)	Range	pc	Median (n)	Range	pc
rs10877012
CC	52 (47)	21–93	37 (79)	5–96	3.0×10 ⁻⁴	46 (22)	3–67	0.15
AA	47 (13)	14–88	31 (20)	3–65	0.09	14 (3)	13–28	0.08
AC	50 (44)	23–91	39 (74)	4–120	2.9×10 ⁻⁴	31 (13)	8–89	6.0×10^–3
rs4646536
TT	51 (49)	25–93	36 (80)	5–96	4.8×10 ⁻⁵	46 (22)	3–67	0.12
CC	47 (13)	29–88	27 (19)	3–65	8.8×10 ⁻³	14 (3)	13–28	0.04
TC	51 (42)	14–91	39 (74)	3–67	5.8×10 ⁻³	31 (13)	8–89	0.01
rs927650
TT	57 (34)	23–91	39 (40)	3–80	3.4×10 ⁻⁴	39 (8)	18–57	0.06
CC	47 (29)	25–86	36 (48)	7–117	0.01	36 (11)	3–67	0.44
CT	47 (41)	14–93	36 (85)	4–120	5.9×10 ⁻³	35 (19)	8–89	0.07
rs2248137
CC	54 (43)	21–86	37 (68)	3–96	1.2×10 ⁻⁵	41 (14)	14–89	0.18
GG	54 (14)	29–93	37 (28)	4–69	0.13	28 (10)	3–67	0.12
CG	48 (47)	14–92	37 (77)	5–120	5.0×10 ⁻³	34 (14)	8–60	0.04
rs2296241
AA	58 (31)	29–93	38 (49)	5–117	6.0×10 ⁻⁵	41 (6)	3–55	0.26
GG	49 (24)	23–86	39 (44)	7–87	0.19	20 (13)	8–60	0.01
AG	48 (49	14–92	35 (80)	3–120	3.7×10 ⁻⁴	38 (19)	13–89	0.46

p-Values <0.05 are boldface. Kruskal–Wallis test global p<0.05; multiple Conover–Iman comparison (Bonferroni corrected).

1,25(OH)₂D₃ production according to 25(OH)D₃ status and genotypes

The distribution of the different polymorphisms within the four 25(OH)D₃ categories (severely deficient, deficient, insufficient, and sufficient) was not different between cases and controls (data not shown). However, the genotypes GG for CYP24A1 rs2296241 and AC for CYP27B1 rs10877012 were more frequent (100% vs. 22.2%, p=0.02, pc=0.06 and 100% vs. 25.9%, p=0.04, pc=0.12, respectively) in the 25(OH)D₃ insufficient group and, subsequently, had a lower 1,25(OH)₂D₃ production than HC. These differences did not remain significant after correction of the p-values.

Discussion

Higher levels of vitamin D may reduce the risk of several cancers, possibly through the genomic effects modulated by the VDR, and the autocrine/paracrine effects of the VDR ligand, 1,25(OH)₂D₃. Vitamin D and its potential relevance to cancer prevention has become evident by the discovery that the cell types not involved with calcium metabolism are abundantly endowed with vitamin D system enzymes CYP2R1, CYP27B1, VDR, and CYP24, which produce, respond to, and degrade 1,25(OH)₂D₃ (15 –17). On the other hand, there are vitamin D response elements (VDREs) with regard to more than 200 genes that appear to be modulated by 1,25(OH)₂D₃ and, to a lesser extent, by 25(OH)D, influencing cell functions in a cell- and tissue-specific manner (18,19).

The cascade of enzymatic reactions that lead to the biosynthesis of 1,25(OH)₂D₃ is complex and requires the participation of many gene products. It is conceivable that polymorphisms in any of the several genes (e.g., CYP2R1, CYP27B1, and CYP24A1) in this pathway could lead to differences in endogenous biosynthesis and bioavailability of 1,25(OH)₂D₃. Genetic association studies investigating the role of vitamin D in colon, breast, and prostate cancers have primarily focused on polymorphisms within the VDR gene (20,21) with limited data available for other genes in the vitamin D pathway, including enzymes that activated and deactivated vitamin D (22 –29). Based on these observations and the fact that an association between VDR polymorphisms and DTC risk was previously described in our group (4), we investigated in the present case-control study (all Germans) whether polymorphisms within the CYP2R1 (rs12794714, rs10741657), CYP27B1 (rs10877012, rs4646536), and CYP24A1 (rs927650, rs2248137, rs2296241) genes could play a role in the susceptibility to DTC.

Similar to other studies, which tested the same sequence variants (rs10877012, rs4646536) within the CYP27B1 gene in different types of cancer, we found no significant differences in our case-control comparison (22,25,26). However, the haplotype analysis suggests that the rare haplotype rs10877012A/rs4646536T within the CYP27B1 gene may be protective against PTC. To date, 3 out of 12 discovered polymorphisms of the CYP27B1 gene, studied in various cancers (22,24,25 –29) (rs8176345, rs4646537, rs3782130), were reported to be associated with prostate cancer risk alone (26,29). Furthermore, our finding regarding polymorphisms within the CYP24A1 gene are consistent with a previous analysis in which no significant differences in the genotype distributions between cancer patients and controls with regard to the rs927650 (24,27,28), the rs2248137 (25), and the rs2296241 polymorphisms were found (24,26 –28). However, Holt et al. (29) observed significantly altered risks of recurrence/progression and cancer death in relation to rs927650 and rs2296241 CYP24A1 polymorphisms in patients with prostate cancer. The genotype and allele analysis revealed a trend association between the CYP24A1 rs2296241 polymorphism and FTC in our study. This indicates that the presence of the CYP24A1 rs2296241 allele could contribute to the development of DTC. Effectively, the haplotype combination containing rs2296241 alleles showed that the haplotype rs2248137C/rs2296241A protects against PTC, while the haplotypes rs927650C/rs2296241G and rs927650C/rs2248137C/rs2296241G for CYP24A1 appear to be associated in DTC (weak in PTC and strong in FTC) with an increasing risk. The three investigated polymorphisms within the CYP24A1 gene are intronic (rs927650 and rs2248137) and not evolutionarily conserved with the exception of rs2296241 (conservation score 0.99), a synonymous polymorphism in exon 4. This result is important for several reasons: First, a recent study revealed that the promoter region of the CYP24A1 gene contains VDREs and, thus, emphasized the special role of the CYP24A1 gene in 1,25(OH)₂D₃ signaling, which is affected by polymorphism (30). The functional effects of the CYP24A1 polymorphisms investigated here remain unclear, but several novel polymorphisms have recently been identified in the promoter region 5′ of exon 1 in the CYP24A1 gene that exerted a functional impact on VDRE binding and transactivation in vitro and altered expression of CYP24A1 in vivo (31). The rs2296241 is located near this region and could be linked to this functional polymorphism. This could explain an association with DTC. Second, the extra renal expression of CYP27B1 in a wide variety of nonclassical target tissues includes the thyroid epithelium where 25(OH)D₃ can be converted to 1,25(OH)₂D₃, affecting the differentiation, proliferation, and apoptosis of cells (32). CYP24A1 mRNA expression is up-regulated in tumors, and may counteract 1,25(OH)₂D₃ antiproliferative activity, presumably by decreasing 1,25(OH)₂D₃ levels (15,33,34). In this context, decreased 1,25(OH)₂D₃ concentration in the peripheral blood of patients with DTC (n=147) was previously reported by our group (4). The present study confirms the previous results of our group (4) describing lower 1,25(OH)₂D₃ levels in DTC patients. In extension to that, the present study provides additional information about calcium and creatinine levels. These findings have been confirmed by others (35). However, the level of 25(OH)D₃ was not statistically different from HC (4); the majority of the patients as well as controls had deficient levels of 25(OH)D₃. In probands with deficient 25(OH)D₃ status, the differences in the 1,25(OH)₂D₃ levels between patients and controls were more distinct.

The difference in the 25(OH)D₃ status/1,25OH₂D₃ production between controls and patients could be attributed to the age of the patients. However, since there is no correlation between age and vitamin in the control group, it is likely that the differences are due to the disease.

Since lower levels of 1,25(OH)₂D₃ were measured in our patient groups compared with HC, an overexpression of the CYP24A1 in DTC tissues can be expected. An increased expression of this enzyme in the thyroid tissue of patients with DTC and in thyroid cancer cell lines has been recently documented (33,34). Finally, we found that the median plasma concentration of 1,25(OH)₂D₃ but not 25(OH)D₃ differs significantly depending on the genotypes. Subsequently, the risk alleles in the haplotype combination rs927650C/rs2248137C/rs2296241G for CYP24A1 in DTC are associated with a lower 1,25(OH)₂D₃ concentration. This may explain that polymorphisms in the CYP24A1 gene could influence the production of 1,25(OH)₂D₃ possibly by an altered balance of CYP27B1 and CYP24 expression.

A recent report showed the active 1,25(OH)₂D₃ compound as well as a superagonistic VDR ligand to be effective in anaplastic thyroid carcinoma in conjunction with paclitaxel or suberoylanilide hydroxamic acid (36). This illustrates the potential of vitamin D signaling in undifferentiated carcinoma and may extend to DTC.

Our results suggest that haplotypes within the CYP24A1 gene, low circulating 25(OH)D₃ levels (deficiency), and a reduced conversion to 1,25(OH)₂D₃ enhance the risk to DTC. Whether deficient 25(OH)D₃ levels in combination with the genetic variants lead to lower circulating 1,25(OH)₂D₃, and thereby to a depressed vitamin D action, should be evaluated in future studies in DTC.

To our knowledge, this is the first study that evaluates both plasma vitamin D status and polymorphisms in the genes encoding enzymes that are involved in the metabolism of vitamin D₃ in relation to DTC. The frequent vitamin D deficiency in patients with DTC warrants clinical studies with supplementation that may have secondary preventive action.

Footnotes

Acknowledgments

This study was supported by a grant from the European Union (FP7-NAIMIT: Grant Agreement No. 241447 and EURADRENAL: Grant Agreement No.201167), the Else–Kröner Fresenius Stiftung, and the Paul and Ursula Klein–Stiftung.

Disclosure Statement

The authors declare that no competing financial interests exist.

References

Jemal

, Bray

, Center

, Ferlay

, Ward

, Forman

. 2011. Global cancer statistics. CA Cancer J Clin, 61:69–90.

Aschebrook-Kilfoy

, Ward

, Sabra

, Devesa

. 2011. Thyroid cancer incidence patterns in the United States by histologic type, 1992–2006. Thyroid, 21:125–134.

Grant

. 2007. An ecologic study of cancer mortality rates in Spain with respect to indices of solar UVB irradiance and smoking. Int J Cancer, 120:1123–1128.

Penna-Martinez

, Ramos-Lopez

, Stern

, Hinsch

, Hansmann

, Selkinski

, Grünwald

, Vorländer

, Wahl

, Bechstein

, Zeuzem

, Holzer

, Badenhoop

. 2009. Vitamin D receptor polymorphisms in differentiated thyroid carcinoma. Thyroid, 19:623–628.

Cheng

, Levine

, Bell

, Mangelsdorf

, Russell

. 2004. Genetic evidence that the human CYP2R1 enzyme is a key vitamin D 25-hydroxylase. Proc Natl Acad Sci U S A, 101:7711–7715.

Zehnder

, Bland

, Walker

, Bradwell

, Howie

, Hewison

, Stewart

. 1999. Expression of 25-hydroxyvitamin D3-1alpha-hydroxylase in the human kidney. J Am Soc Nephrol, 10:2465–2473.

Barreto

, Schwartz

, Woodruff

, Cramer

. 2000. 25-Hydroxyvitamin D3, the prohormone of 1,25-dihydroxyvitamin D3, inhibits the proliferation of primary prostatic epithelial cells. Cancer Epidemiol Biomarkers Prev, 9:265–270.

Miller

, Stapleton

, Ferrara

, Scott Lucia

, Pfister

, Hedlund

, Upadhya . 1992. The human prostatic carcinoma cell line LNCaP expresses biologically active, specific receptors for 1 alpha,25-dihydroxyvitamin D3. Cancer Res, 52:515–520.

Kliewer

, Umesono

, Noonan

, Heyman

, Evans

. 1992. Convergence of 9-cis retinoic acid and peroxisome proliferator signalling pathways through heterodimer formation of their receptors. Nature, 358:771–774.

10.

Sakaki

, Sawada

, Nonaka

, Ohyama

, Inouye

. 1999. Metabolic studies using recombinant escherichia coli cells producing rat mitochondrial CYP24 CYP24 can convert 1α,25-dihydroxyvitamin D3 to calcitroic acid. Eur J Biochem, 262:43–48.

11.

Miller

, Dykes

, Polesky

. 1988. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res, 16:1215.

12.

Ramos-Lopez

, Bruck

, Jansen

, Herwig

, Badenhoop

. 2007. CYP2R1 (vitamin D 25-hydroxylase) gene is associated with susceptibility to type 1 diabetes and vitamin D levels in Germans. Diabetes Metab Res Rev, 23:631–636.

13.

Bailey

, Cooper

, Zeitels

, Smyth

, Yang

, Walker

, Hyppönen

, Dunger

, Ramos-Lopez

, Badenhoop

, Nejentsev

, Todd

. 2007. Association of the vitamin D metabolism gene CYP27B1 with type 1 diabetes. Diabetes, 56:2616–2621.

14.

Cooper

, Smyth

, Walker

, Stevens

, Burren

, Wallace

, Greissl

, Ramos-Lopez

, Hypponen

, Dunger

, Spector

, Ouwehand

, Wang

, Badenhoop

, Todd

. 2011. Inherited variation in vitamin d genes is associated with predisposition to autoimmune disease type 1 diabetes. Diabetes, 60:1624–1631.

15.

Anderson

, Nakane

, Ruan

, Kroeger

, Wu-Wong

. 2006. Expression of VDR and CYP24A1 mRNA in human tumors. Cancer Chemother Pharmacol, 57:234–240.

16.

Bieche

, Narjoz

, Asselah

, Vacher

, Marcellin

, Lidereau

, Beaune

, de Waziers

. 2007. Reverse transcriptase-PCR quantification of mRNA levels from cytochrome (CYP)1, CYP2 and CYP3 families in 22 different human tissues. Pharmacogenet Genomics, 17:731–742.

17.

Hewison

. 2010. Vitamin D and the intracrinology of innate immunity. Mol Cell Endocrinol, 321:103–111.

18.

Ramagopalan

, Heger

, Berlanga

, Maugeri

, Lincoln

, Burrell

, Handunnetthi

, Handel

, Disanto

, Orton

, Watson

, Morahan

, Giovannoni

, Ponting

, Ebers

, Knight

. 2010. A ChIP-seq defined genome-wide map of vitamin D receptor binding: associations with disease and evolution. Genome Res, 20:1352–1360.

19.

Davis

, Milner

. 2011. Nutrigenomics, vitamin D and cancer prevention. J Nutrigenet Nutrigenomics, 4:1–11.

20.

Jenab

, McKay

, Bueno-de-Mesquita

, van Duijnhoven

, Ferrari

, Slimani

, Jansen

, Pischon

, Rinaldi

, Tjønneland

, Olsen

, Overvad

, Boutron-Ruault

, Clavel-Chapelon

, Engel

, Kaaks

, Linseisen

, Boeing

, Fisher

, Trichopoulou

, Dilis

, Oustoglou

, Berrino

, Vineis

, Mattiello

, Masala

, Tumino

, Vrieling

, van Gils

, Peeters

, Brustad

, Lund

, Chirlaque

, Barricarte

, Suárez

, Molina

, Dorronsoro

, Sala

, Hallmans

, Palmqvist

, Roddam

, Key

, Khaw

, Bingham

, Boffetta

, Autier

, Byrnes

, Norat

, Riboli

. 2009. Vitamin D receptor and calcium sensing receptor polymorphisms and the risk of colorectal cancer in European populations. Cancer Epidemiol Biomarkers Prev, 18:2485–2491.

21.

McKay

, McCullough

, Ziegler

, Kraft

, Saltzman

, Riboli

, Barricarte

, Berg

, Bergland

, Bingham

, Brustad

, Bueno-de-Mesquita

, Burdette

, Buring

, Calle

, Chanock

, Clavel-Chapelon

, Cox

, Dossus

, Feigelson

, Haiman

, Hankinson

, Hoover

, Hunter

, Husing

, Kaaks

, Kolonel

, Le Marchand

, Linseisen

, McCarty

, Overvad

, Panico

, Purdue

, Stram

, Stevens

, Trichopoulos

, Willett

, Yuenger

, Thun

. 2009. Vitamin D receptor polymorphisms and breast cancer risk: results from the National Cancer Institute Breast and Prostate Cancer Cohort Consortium. Cancer Epidemiol Biomarkers Prev, 18:297–305.

22.

Hawkins

, Cramer

, Zheng

, Isaacs

, Wiley

, Chang

, Bleecker

, Walsh

, Meyers

, Isaacs

, Xu

. 2002. Sequence variants in the human 25-hydroxyvitamin D3 1-alpha-hydroxylase (CYP27B1) gene are not associated with prostate cancer risk. Prostate, 53:175–178.

23.

McCullough

, Stevens

, Diver

, Feigelson

, Rodriguez

, Bostick

, Thun

, Calle

. 2007. Vitamin D pathway gene polymorphisms, diet, and risk of postmenopausal breast cancer: a nested case-control study. Breast Cancer Res, 9:R9.

24.

Holick

, Stanford

, Kwon

, Ostrander

, Nejentsev

, Peters

. 2007. Comprehensive association analysis of the vitamin D pathway genes, VDR, CYP27B1, and CYP24A1, in prostate cancer. Cancer Epidemiol Biomarkers Prev, 16:1990–1999.

25.

Dong

, Ulrich

, Hsu

, Duggan

, Benitez

, White

, Slattery

, Farin

, Makar

, Carlson

, Caan

, Potter

, Peters

. 2009. Vitamin D related genes, CYP24A1 and CYP27B1, and colon cancer risk. Cancer Epidemiol Biomarkers Prev, 18:2540–2548.

26.

Beuten

, Gelfond

, Franke

, Weldon

, Crandall

, Johnson-Pais

, Thompson

, Leach

. 2009. Single and multigenic analysis of the association between variants in 12 steroid hormone metabolism genes and risk of prostate cancer. Cancer Epidemiol Biomarkers Prev, 18:1869–1880.

27.

Holt

, Kwon

, Peters

, Ostrander

, Stanford

. 2009. Vitamin D pathway gene variants and prostate cancer risk. Cancer Epidemiol Biomarkers Prev, 18:1929–1933.

28.

Ahn

, Albanes

, Berndt

, Peters

, Chatterjee

, Freedman

, Abnet

, Huang

, Kibel

, Crawford

, Weinstein

, Chanock

, Schatzkin

, Hayes

. 2009. Vitamin D-related genes, serum vitamin D concentrations and prostate cancer risk. Carcinogenesis, 30:769–776.

29.

Holt

, Kwon

, Koopmeiners

, Lin

, Feng

, Ostrander

, Peters

, Stanford

. 2010. Vitamin D pathway gene variants and prostate cancer prognosis. Prostate, 70:1448–1460.

30.

Vaisanen

, Dunlop

, Sinkkonen

, Frank

, Carlberg

. 2005. Spatio-temporal activation of chromatin on the human CYP24 gene promoter in the presence of 1α,25-Dihydroxyvitamin D3. J Mol Biol, 350:65–77.

31.

Roff

, Wilson

. 2008. A novel SNP in a vitamin D response element of the CYP24A1 promoter reduces protein binding, transactivation, and gene expression. J Steroid Biochem Mol Biol, 112:47–54.

32.

Khadzkou

, Buchwald

, Westin

, Dralle

, Akerstrom

, Hellman

. 2006. 25-hydroxyvitamin D3 1α-hydroxylase and vitamin D receptor expression in papillary thyroid carcinoma. J Histochem Cytochem, 54:355–361.

33.

Balla

, Kosa

, Tobias

, Halaszlaki

, Takacs

, Horvath

, Speer

, Nagy

, Horanyi

, Jaray

, Szekely

, Lakatos

. 2011. Marked increase in CYP24A1 gene expression in human papillary thyroid cancer. Thyroid, 21:459–460.

34.

Sharma

, Fretwell

, Crees

, Kerege

, Klopper

. 2010. Thyroid cancer resistance to vitamin D receptor activation is associated with 24-hydroxylase levels but not the ff FokI polymorphism. Thyroid, 20:1103–1111.

35.

Stepien

, Krupinski

, Sopinski

, Kuzdak

, Komorowski

, Lawnicka

, Stepien

. 2010. Decreased 1–25 dihydroxyvitamin D3 concentration in peripheral blood serum of patients with thyroid cancer. Arch Med Res, 41:190–194.

36.

Clinckspoor

, Verlinden

, Overbergh

, Korch

, Bouillon

, Mathieu

, Verstuyf

, Decallonne

. 2011. 1,25-dihydroxyvitamin D3 and a superagonistic analog in combination with paclitaxel or suberoylanilide hydroxamic acid have potent antiproliferative effects on anaplastic thyroid cancer. J Steroid Biochem Mol Biol, 124:1–9.

Impaired Vitamin D Activation and Association with CYP24A1 Haplotypes in Differentiated Thyroid Carcinoma

Abstract

Background:

Methods:

Results:

Conclusions:

Introduction

Methods

Subjects

Genes and polymorphisms

Genotyping

Measurement of 25(OH)D3 and 1,25(OH)2D3

Clinical parameters

Statistical analysis

Results

Genotype analysis

Haplotype analysis

Plasma 25(OH)D3 and 1,25(OH)2D3 levels

Plasma 1,25(OH)2D3 levels and genotypes

1,25(OH)2D3 production according to 25(OH)D3 status and genotypes

Discussion

Footnotes

Acknowledgments

Disclosure Statement

References

Measurement of 25(OH)D₃ and 1,25(OH)₂D₃

Plasma 25(OH)D₃ and 1,25(OH)₂D₃ levels

Plasma 1,25(OH)₂D₃ levels and genotypes

1,25(OH)₂D₃ production according to 25(OH)D₃ status and genotypes