Maternal Exercise Before and During Pregnancy Facilitates Embryonic Myogenesis by Enhancing Thyroid Hormone Signaling

Abstract

Background:

Maternal exercise (ME) improves fetal and offspring muscle development, but mechanisms remain to be established. Since the thyroid hormone (TH) is critical for cell differentiation during embryonic development, we hypothesized that ME elevates TH receptor (THR) signaling in embryos, which promotes embryonic myogenesis.

Methods:

Female mice were exercised daily on a treadmill or received a daily TH, triiodothyronine (T3) injection. Embryos (embryonic day 12.5 [E12.5]) and P19 cells were used for studying effects of TH on embryonic myogenesis. TH levels in serum and embryos after ME or T3I were analyzed. Expression of TH signaling related genes and myogenic genes was assessed. THRα binding to the promoters of myogenic genes was investigated by chromatin immunoprecipitation-qantitative polymerase chain reaction (ChIP-qPCR). A CRISPR/CAS9 plasmid was utilized to knock out THRα in P19 cells.

Results:

ME elevated TH levels in both maternal circulation and embryos, which were correlated with enhanced TH signaling and myogenesis. At E12.5, both myogenic determinants (Pax3, Pax7) and myogenic regulatory factors (Myf5, Myod) were upregulated in ME embryos. ME increased THRα content and elevated messenger RNA (mRNA) expression of TH transporter Slc16a2 and deiodinase Dio2. In addition, the THRα binding to the promoters of Pax3/7 was increased. In P19 embryoid bodies, T3 promoted myogenic differentiation, which was abolished by ablating THRα. Furthermore, maternal daily injection of T3 at a level matching exercised mothers promoted embryonic myogenesis.

Conclusions:

ME promotes TH delivery to the embryos and enhances embryonic myogenesis, which is partially mediated by enhanced TH signaling in ME embryos.

Introduction

While conflicting reports exist, increasing evidence points to the beneficial effects of gestational exercise on maternal and neonatal outcomes (1,2). The American College of Obstetricians and Gynecologist recommends that pregnant women participate in daily exercise during gestation (3). Unlike exhaustive exercise that causes adverse physiological responses (4), moderate exercise improves metabolic health (5,6). Similarly, gestational exercise also improves embryonic development. In mice, regular exercise during pregnancy remarkably reduced diet-induced obesity in their offspring (7), and suppressed metabolic dysfunctions (8 –10). Placenta mediates maternal and fetal exchange of nutrients (11), and maternal exercise (ME) enhanced placental vascularization and function, partially explaining the improvement of fetal development (7).

The thyroid hormone (TH) regulates muscle contraction, intestinal activity, and body temperature (12). Gestational thyroid dysfunction is quite common in women (13), which is associated with fetal growth retardation, adverse neurocognition (14), and miscarriage (15). Importantly, embryos do not produce TH and thus depend on maternal provision of triiodothyronine (T3) and thyroxine (T4) (16). The transcription of thyroid hormone receptor (THR) and transporter is initiated soon after fertilization in mice (17,18), but embryonic thyroid glands only function after embryonic day 17 (E17) in mice (19,20), emphasizing the importance of maternal TH in regulating embryonic development (21). Interestingly, recent studies showed that exercise could substitute TH treatment for hypothyroidism therapy (22 –25), because aerobic exercise increases circulatory TH levels (5,6,26,27).

While T4 is dominant in circulation, it is converted to active T3 in tissues locally by iodothyronine deiodinase 2 (D2 for protein and Dio2 for gene). The intracellular T3 level is regulated by D2 and D3. D2 converts T4 to T3 to activate THR signaling, while D3 inactivates both T4 and T3 through inner ring deiodination (28). D1 can catalyze both the outer and inner ring deiodination. The active T3 enters the cell nucleus and binds with THR, which, in conjunction with retinoid X receptor, further binds with its cognitive elements in promoters to initiate gene expression (29). There are two types of THR, THRα and THRβ, differentially expressed in tissues, with THRα predominantly expressed in skeletal muscle (30,31). However, despite a positive correlation between TH and muscle regeneration being reported (29,32,33), little is known about the roles of maternal TH in embryonic myogenesis.

Skeletal muscle, originated from the mesoderm, is one of the major metabolic organs (34). The number of skeletal muscle fibers is determined in utero, while after birth, the muscle growth mainly depends on hypertrophy (35). Prenatal muscle development is crucial for long-term postnatal function of skeletal muscle. In mice, the embryonic myogenesis occurs in the dermomyotome between E8.5 and 12.5, when embryonic Pax7⁺ myoblasts commit to a myogenic fate, and the myogenic factor Myf5 initiates myogenesis (34). The primary muscle fibers formed during the embryonic stage serve as scaffolds for the formation of fetal muscle fibers; these embryonic myogenic cells also contribute to the formation of satellite cells in offspring muscle (34,36,37). Thus, malformation of embryonic myogenic cells worsens fetal muscle development and offspring muscle function (38).

Indeed, in our previous study, we found that ME enhanced muscle mass and endurance in offspring (39). Considering that ME enhances TH levels, we hypothesized that ME improves the delivery of maternal TH into the embryos, which activates TH signaling and enhances embryonic myogenesis.

Materials and Methods

Mouse exercise protocol

Animal studies were conducted according to the protocol approved by the Institute of Animal Use and Care Committee at Washington State University. A total of 32 eight-week-old C57BL/6J female mice (The Jackson Laboratory, Bar Harbor, ME) were randomly separated into control (CN) and ME groups (16 females/group). A detailed exercise protocol has been described previously, and moderate exercise intensity is defined as 70% maximal oxygen consumption (VO_2max) (7). The ME mice were assigned to prepregnancy exercise for 24 days and then mated with age-matched males. Successful mating was confirmed by the presence of vaginal plug and designated as E0.5. To synchronize pregnancy, all female mice were only with males for one night. Pregnant mice continued to be exercised during pregnancy until embryo collection at E12.5.

All mice were housed at 22°C on 12-hour-light/12-hour-dark cycles, fed ad libitum. The food intake and body weight were measured. At E12.5, pregnant mice were anesthetized by carbon dioxide inhalation and euthanized by cervical dislocation. The somite number of embryos was counted under a stereomicroscope. The head of embryo was removed to minimize the noise from neurogenic tissue (40), except those embryos used for TH analysis, where the whole embryos were used.

T3 hormone injection

Sixteen 8-week-old C57BL/6J female mice (The Jackson Laboratory) were randomly separated into CN and thyroid hormone injection (T3I) groups (8 females/group). After mating, pregnant mice were subcutaneously injected with T3 (0.2 μg/g body weight) in saline solution daily (41,42), while CN mice received an equal volume of saline solution until dissection at E12.5.

Muscle function measurement

Two days before mating, the VO_2max, acute exercise endurance, and total running distance were measured using a treadmill respiratory measurement system (Columbus Instruments, Columbus, OH). A grip strength meter for mice (Columbus Instruments) was used to measure the limb grip strength (7).

Metabolic studies

At gestational day (GD) 9.5, pregnant mice were subjected to a resting metabolic rate analysis, including oxygen consumption (VO₂) and heat production (from 10 AM to 6 AM the next day) using an indirect open circuit calorimetry system (Comprehensive Lab Animal Monitoring System [CLAMS]; Columbus Instruments) (7).

TH analysis

Total T3, T4, and thyrotropin (TSH) in maternal serum and whole embryos were analyzed using a Thyroid Panel enzyme-linked immunosorbent assay (ELISA) Kit (Monobind, Inc.). For maternal serum separation, whole blood was clotted for 8 hours at 4°C, and then centrifuged at 2000 × g for 10 minutes to remove debris; the supernatant was transferred to a new tube. To detect the TH in the whole embryos, an extraction buffer included in the ELISA Kit was added to the embryos (300 μL/50 mg tissue) and homogenized at 4°C. The debris was removed by centrifuge (5424 R, Eppendorf, Enfield, CT) at 12,000 rpm for 5 minutes at 4°C (16).

P19 cell culture

An embryonic cell line, P19 (CRL-1825, ATCC), was used to examine the embryonic myogenesis, as described in a previous report (38). Briefly, P19 cells were cultured in a growth medium (alpha-minimal essential medium [a-MEM] with 7.5% bovine calf serum, 2.5% fetal bovine serum, and 0.5% penicillin–streptomycin; Sigma, Burlington, MA) at 37°C in 5% CO₂. For embryoid body (EB) culture, a total of 5 × 10⁶ P19 cells were subcultured into a Petri dish (VWR International, Irving, TX) with growth medium and 1% dimethyl sulfoxide, and placed in an incubator with shaker (Incu-Shaker Mini; Benchmark, Woburn, MA) at 70 rpm. In addition, 10 nM T3 (TOCRIS Bioscience, Minneapolis, MN) was added to assess the effects of TH on myogenesis (30,43).

Quantitative reverse transcription polymerase chain reaction analysis

RNA was extracted using TRIzol reagent (Invitrogen, Grand Island, NY) and reverse transcribed to complementary DNA (cDNA) by an iScript^™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA). SsoAdvanced^™ Universal SYBR Green Supermix (BioRad, Hercules, CA) was used for polymerase chain reaction (PCR) with a Real-Time System (BioRad). All the primers used are listed in Table 1. 18S ribosomal RNA (rRNA) was used as a reference gene and relative RNA levels were calculated by the 2^−ΔΔCt method (44).

Table 1.

Primers Used in This Study

Primers	Gene RefSeq	Forward/reverse	Amplicon length (bp)	Primer sequence
qRT-PCR
TRα	NM_001313983.1	F	128	AGATCACCCGGAATCAGTGC
TRα	NM_001313983.1	R		CTCCCGGTTCTGCTCAATCA
Dio2	NM_010050.4	F	164	GAAGTCCGAAGTTGGCTGGA
Dio2	NM_010050.4	R		TCGGTGAGGCAATGGGATTC
Dio3	NM_172119.2	F	189	TCAGACGACAACCGTCTGTG
Dio3	NM_172119.2	R		AAAATTGAGCACCAACGGGC
Slc16a2	NM_009197.2	F	227	TCTGTCCCCCATTCTAGGCA
Slc16a2	NM_009197.2	R		GTCCCTAATGAGGTGAGCCG
Myf5	NM_008656.5	F	157	CGGATCACGTCTACAGAGCC
Myf5	NM_008656.5	R		GCAGGAGTGATCATCGGGAG
Myod	NM_010866.2	F	150	CGACACCGCCTACTACAGTG
Myod	NM_010866.2	R		GGTGGTGCATCTGCCAAAAG
Pax3	NM_008781.4	F	158	GGGGAACTGGAGGCATGTTT
Pax3	NM_008781.4	R		AATCCGGTTTTCCGTCCCAG
Pax7	NM_011039.2	F	108	TGGAAACGGGACAAGCCTAC
Pax7	NM_011039.2	R		GGGGATAAGGGGACTGAGGT
Pgc1a	NM_008904.2	F	160	ACTCTCAGTAAGGGGCTGGT
Pgc1a	NM_008904.2	R		CAACCAGAGCAGCACACTCT
Nrf1	NM_001164226.1	F	134	CTGCAGGTCCTGTGGGAAT
Nrf1	NM_001164226.1	R		GGCTCTGAGTTTCCGAAGCA
Myog	NM_031189.2	F	82	TCCCAACCCAGGAGATCATT
Myog	NM_031189.2	R		GCTGTCCACGATGGACGTAA

Genes	RefSeq	Chromosome location
ChIP-qPCR
Pax3-	NC_000067.7	78181464–78181445	F	104	GGTGGTGTTGGACAGATGGA
Primer1		78181361–78181380	R		TGCAAGTGATGCTCTGGTGT
Pax3		78181357–78181338	F	149	CATCCGTCCATAAGCACCCA
Primer2		78181209–78181228	R		TGTCTCCAGGTAGCCAGTGA
Pax3		78181237–78181218	F	95	GCCAGCTTTTCACTGGCTAC
Primer3		78181143–78181162	R		GTGTAGTGGGCTAAGTGCCT
Pax7	NC_000070.6	139567787–139567767	F	86	CCAAGCTCTGTGACCTCATGG
Primer1		139567702–139567721	R		CAGTGGGCAATGGTAGCCTC
Pax7		139567736–139567717	F	104	CTTCATCTCCAGGGTGAGGC
Primer2		139567633–139567652	R		AGGAGAGACCACAGCCATGT
Pax7		139567651–139567632	F	112	CATGGCTGTGGTCTCTCCTG
Primer3		139567540–139567559	R		GGTTCGGAAACCAGGACCAA

Dio2/3, deiodinase 2/3; qRT-PCR, quantitative reverse transcription polymerase chain reaction; ChIP-qPCR, chromatin immunoprecipitation-quantitative polymerase chain reaction.

Western blot analysis

Proteins were extracted as previously described (39). The primary antibody against THRα was purchased from Abcam (Waltham, MA; ab53729), and the secondary goat anti-rabbit antibody (No. 926-32,211, RRID: AB_621,843) and goat anti-mouse antibody (No. 926-68,070, RRID AB_10,956,588) were purchased from LI-COR Biosciences (Lincoln, NE). Primary antibodies against β-actin (AB_528068) and tubulin (AB_2315513) were purchased from DSHB (Iowa City, IA) and used as references. Images were captured by an Odyssey Infrared Imaging System (LI-COR Biosciences) and quantified by ImageJ software (National Institutes of Health) (45).

Chromatin immunoprecipitation-quantitative polymerase chain reaction

Upstream sequences of each gene were obtained from the Swiss Institute of Bioinformatics Eukaryotic Promoter Database and analyzed by PROMO program (Version 8.3) (46,47). Chromatin immunoprecipitation (ChIP)-qPCR was carried out as previously described (48). Briefly, extracts were sonicated by a sonic dismembrator (Fisher Scientific, Waltham, MA) as follows: 30% intensity for 230 seconds with 5 seconds ON/5 seconds OFF. The sonicated DNA size was verified by agarose gel electrophoresis. Then, the THRα primary antibody (rabbit-anti-mice, ab53729; Abcam) or IgG (Sigma) was added, and immunoprecipitation (IP) was performed using EcoMagTM Protein A Magnetic Particles (No. MJA-102; Bioclone, Inc., San Diego, CA). Quantitative PCR was performed using SsoAdvanced Universal SYBR Green Supermix (BioRad, Hercules, CA) with System (BioRad). All the the primers used are listed in Table 1.

Immunocytochemical staining

P19 cells were incubated with a primary antibody against embryonic myosin heavy chain (MHC; F1.652-S; DSHB) and a fluorescent secondary antibody (6410-32, AB_2796308, donkey anti-mouse; SouthernBiotech, Birmingham, AL). A mounting medium with DAPI (Abcam) was added, and cells were observed by EVOS XL Core Imaging System (Mil Creek, WA) (49).

THRα knockout in P19 cells

A CRIPSR/Cas9 plasmid was used to knock out THRα in P19 cells. The crRNA (5′-CCTGGGCGTTAGTGCTGCGA-3′) targeting THRα was cloned into a plasmid with ampicillin bacterial resistance and puromycin selective marker (PX459; GenScript, Piscataway, NJ). The same vector with scrambled sequence was used as a CN. Plasmids were transfected into P19 cells using Lipofectamine 3000 (Invitrogen, Lenexa, KS). After transfection, P19 cells were selected with 3 μg/mL puromycin dihydrochloride (Fisher Scientific) for 24 hours (50,51).

Statistical analysis

All data were visualized and analyzed by Prism GraphPad (V.7.0, San Diego, CA), presented as mean ± standard error of the mean. Significance (p < 0.05) was identified using a two-tailed unpaired Student t-test. The correlation was analyzed by Pearson's chi-squared test. Embryos from a single pregnancy were pooled and a pregnancy was considered an experimental unit.

Results

Exercise improves metabolism and TH levels of pregnant mice

Mice were subjected to a 36-day moderate exercise training, including 12 days during gestation (Fig. 1A). Although the food intake did not change, the body weight gain was lower in the ME group before pregnancy (Fig. 1B). Interestingly, during gestation, starting from E8.5, the body weight gain (compared with E0.5) in the ME group was higher than in the CN group (Fig. 1B). After a 24-day exercise training, limb muscle maximal strength and muscle endurance of pregnant mice were significantly enhanced (Fig. 1C). Correspondingly, exercised mice had improved aerobic endurance capacity, indicated by increased VO_2max, exercise duration, and running distance (Fig. 1D). In addition, exercised mice (at GD9.5) had increased VO₂ and heat production during the active night phase (Fig. 1E, F). Importantly, ME had elevated T3 and T4 levels (Fig. 1G), whereas TSH level did not differ (Fig. 1H), suggesting that exercise increased circulatory TH levels.

FIG. 1.

Exercise improves metabolism and TH levels of pregnant mice. (A) Schematic diagram of exercise protocol. (B) Body weight gain and FI in CN and ME before and during pregnancy from E0.5. (C) Limb muscle endurance and maximal grip strength after a 24-day exercise. (D) Aerobic endurance capacity in one bout of acute exercise after exercise for 24 days. (E, F) Resting metabolism. Time-resolved and mean value of oxygen consumption (E) and heat production (F) during 24 hours. (G, H) T3, T4, and TSH levels in maternal serum (measured at GD12.5). Data are presented as mean ± SEM, each dot represents one maternal mouse; p-values from two-tailed unpaired Student's t test. Significance of AUC is set at 95% confidence interval (C). Asterisk (*) indicated p < 0.05 (B). n = 8/group. AUC, area under curve; CN, control; E0.5, embryonic days; FI, food intake; GD, gestational day; ME, maternal exercise; SEM, standard error of the mean; T3, triiodothyronine; T4, thyroxine; TH, thyroid hormone; TSH, thyrotropin; VO₂, oxygen consumption.

ME during pregnancy promotes TH delivery into embryos

We further analyzed the TH concentrations in embryos (E12.5). In agreement, both T3 and T4 levels were elevated in ME embryos (Fig. 2A). Accordingly, the messenger RNA (mRNA) contents of several TH-related genes, including TH transporter (Slc16a2), Thra, Dio2, and Dio3, were all elevated in the ME embryos (Fig. 2B) and positively related to the T3 level (Fig. 2C). Notably, the ratio of Dio2 to Dio3 was increased in the ME group, partially explaining the elevation of T3 in ME embryos (Fig. 2D). In addition, the THRα protein content in embryos was higher in ME embryos (Fig. 2E), consistent with elevation of TH-responsive genes, Pgc1a, Nrf1, and Myog (52 –54) in E12.5 (Fig. 2F). In short, ME improves TH delivery to the embryos, augmenting local TH signaling.

FIG. 2.

ME during pregnancy promotes TH delivery into embryos. (A) T3 and T4 levels in E12.5 embryos from CN and ME mice (normalized to embryo mass). (B) The expression of TH signaling related genes in E12.5 embryos from CN and ME mice. (C) The regression analysis between the expression of TH-related genes and T3 level in E12.5 embryos. (D) Ratio of Dio2/Dio3 in E12.5 embryos from CN and ME mice. (E) Western blots of THRα protein levels in embryos from CN and ME mice. (F) The expression of TH responsive genes in E12.5 embryos from CN and ME mice. Data are presented as mean ± SEM, each dot represents one pregnancy; p-values from two-tailed unpaired Student's t test. n = 8/group. Dio2/3, deiodinase 2/3; THR, thyroid hormone receptor.

ME during pregnancy promotes embryonic myogenesis

At E12.5, ME embryos had higher mass (Fig. 3A), consistent with the increased body weight gain of pregnant mice during gestation (Fig. 1B). The somite count, placenta weight, and number of embryos per litter did not differ between groups (Fig. 3B–D). For embryonic myogenesis, the expression of myogenic genes, including Myf5, Myod, Pax3, and Pax7, was upregulated in ME embryos (Fig. 3F) and positively correlated with T3 level (Fig. 3E). Based on bioinformatic prediction, four and six potential THRα binding sites (dissimilarity <5%) were predicted in the promoters of Pax3 and Pax7, respectively (Fig. 3G). By ChIP-PCR analysis, one THRα binding site located at −7574 bp of the transcription start site (TSS) of Pax3 and one THRα binding site located at −7519 bp of the Pax7 TSS were identified (Fig. 3H).

FIG. 3.

Maternal exercise during pregnancy promotes embryonic myogenesis. (A) Embryo mass in E12.5 embryos from CN and ME mice. (B) Somite counts in E12.5 embryos from CN and ME mice. (C) Placenta weight of E12.5 embryos from CN and ME mice. (D) Embryo number of each litter from CN and ME mice. (E) The regression analysis between the expression of myogenic genes and T3 level in E12.5 embryos. (F) Myogenic gene expression in E12.5 embryos from CN and ME mice. (G) Putative THRα binding site locations in Pax3 and Pax7 promoter region. Grey fonts highlight the binding sites chosen for ChIP analysis. (H) ChIP-PCR of THRα binding with the promoters of Pax3 and Pax7 in E12.5 embryos from CN and ME mice. Data are presented as mean ± SEM, each dot represents one pregnancy. p-Values from two-tailed unpaired Student's t test. n = 8/group. ChIP, chromatin immunoprecipitation; PCR, polymerase chain reaction.

To sum up, ME facilitates myogenesis, which correlates with the upregulation of THRα signaling and expression of myogenic genes in E12.5 embryos.

TH facilitates myogenesis in P19 EB

P19 cells are capable to form EB and simulate embryogenesis in vitro (55). Here, T3 treatment (Fig. 4A) enhanced myogenic differentiation in P19 EB, indicated by immunostaining of embryonic MHC, where more myoblasts and myofibers were visible in T3-treated cells (Fig. 4B). Consistently, TH signaling was highly activated by T3 during myogenic differentiation, as shown by an increased expression of Thrα, Slc16a2, Dio2, and Dio3, as well as an elevated Dio2/Dio3 ratio (Fig. 4C). Furthermore, myogenic genes, Pax3, Pax7, Myf5, and Myod, were expressed at higher levels in the T3 group (Fig. 4D).

FIG. 4.

TH facilitates myogenesis in P19 EB. (A) Schematic diagram of P19 cell culture. Arrows indicate sampling time points. (B) Representative images of ICC for embryonic myosin heavy chain staining on days 5, 7, and 8 of P19 culture. White arrows indicate newly formed myofibers. (C) Expression of TH signaling related gene in CN and T3-treated P19 EB. (D) Myogenic gene expression in CN and T3-treated EB. Data are presented as mean ± SEM. p-Values from two-tailed unpaired Student's t test. n = 3/group. DMSO, dimethylsulfoxide; Dn, Day n; EB, embryoid body; ICC, immunocytochemistry; TC dish, tissue culture dish.

Knocking out THRα in P19 cells abolishes myogenic differentiation stimulated by T3

To analyze the mediatory role of THRα, we knocked out THRα, which was verified at the mRNA and protein levels (Fig. 5A, C). Interestingly, THRα-knock out (KO) P19 cells displayed impaired formation of EB, indicated by less EB numbers and smaller sizes (Fig. 5B). Furthermore, myogenic differentiation was almost abolished in THRα-KO P19 cells after an 8-day differentiation, shown by less myofiber formation (Fig. 5B) and decreased expression of myogenic genes (Fig. 5D). Despite THRα KO, the expression of Dio2 and Dio3 did not differ. Taken together, THRα expression is required for embryonic myogenesis.

FIG. 5.

Knocking out THRα in P19 cells abolishes myogenic differentiation stimulated by T3. (A) Western blots of THRα protein in CN and THRα-KO P19 EB. (B) Representative images of P19 embryonic bodies under brightfield and ICC staining of embryonic myosin heavy chain in P19 from CN and THRα-KO. White arrows indicate newly forming myofibers. (C) Expression of TH signaling related genes in CN and THRα-KO EB. (D) Ratio of Dio2/Dio3 in CN and THRα-KO EB. (E) Myogenic gene expression in CN and THRα-KO EB. Data are presented as mean ± SEM. p-Values from two-tailed unpaired Student's t test. n = 3/group. KO, knock out.

Daily injection of T3 during pregnancy enhances embryonic myogenesis

To further verify the mediatory roles of THR signaling in enhanced myogenesis due to ME, we injected pregnant mice with T3 daily (Fig. 6A). T3I did not alter food intake and body weight gain (Fig. 6B). As expected, T3 level in maternal serum increased after 3 days of T3I (Fig. 6D). Also, 12 days later, T3 maintained higher, while T4 and TSH levels retreated to the CN level (Fig. 6E). Correspondingly, embryos from T3-injected mice had a higher T3 concentration (Fig. 6F). There were no differences observed in embryo mass, placental weight, embryo number, and somite count (Fig. 6C). Similarly, the THRα protein was expressed higher in the T3I group (Fig. 6G), along with enhanced TH signaling (Fig. 6H). In agreement, the expression of myogenic genes was also elevated (Fig. 6I).

FIG. 6.

Daily injection of T3 during pregnancy enhances embryonic myogenesis. (A) Schematic diagram of T3 administration. (B) Body weight gain and FI in CN and T3I. (C) Embryo mass, somite count, placenta weight, embryo number of each litter in CN and T3I. (D) T3, T4, and TSH levels in maternal serum after 3-day T3I. (E) T3, T4, and TSH levels in maternal serum after 12-day T3I. (F) T3 and T4 levels in E12.5 embryos from CN and T3I mice (normalized by embryo mass). (G) Western blots of THRα protein level in embryos from CN and T3I mice. (H) Expression of TH signaling related genes in E12.5 embryos from CN and T3I mice. (I) Myogenic gene expression in E12.5 embryos from CN and T3I mice. Data are presented as mean ± SEM, each dot represents one pregnancy. p-Values from two-tailed unpaired Student's t test. n = 8/group. T3I, T3 injection.

These data showed that maternal T3I replicates the beneficial effects of ME on embryonic myogenesis, confirming the mediatory roles of TH signaling.

Discussion

Regular moderate exercise benefits the mental and physical health of pregnant women (56,57) and improves the long-term metabolic health of offspring (2,58). A meta-analysis showed that ME improves fetal growth and prevents preterm birth (17,59,60). Improvement in VO_2max due to regular exercise depends on exercise type, intensity, and duration (61), which correlates with metabolic health (62).

In our study, a 24-day regular treadmill exercise before mating increased the relative VO_2max, along with improved muscle performance; the resting metabolic rate was also elevated, showing an overall improvement in the metabolic health of female mice. During gestation, these well-trained mice showed elevated body mass gain, indicating no stress reaction to exercise. Consistently, embryo mass was higher in the ME group. In summary, ME before and during pregnancy promotes healthy embryonic development.

TH secretion by the thyroid gland is under the regulation of the hypothalamus–pituitary–thyroid axis (63). Exercise stimulates TH secretion (64). In aged rats, exercise improved their TH secretion to a rate similar to young rats (65). Notably, elevation of TH secretion due to ME should be distinguished from pathological hyperthyroidism and thyroid disorders. ME-induced TH secretion is caused by elevated metabolism, which is a healthy self-adaptation (66). To mimic TH elevation due to exercise, we used T3I. In rodent studies, T3I was used to induce hyperthyroidism (67,68). The decreased T4 and TSH after a 3-day T3I suggested a risk of hyperthyroidism, although their levels mostly recovered after 12 days of injection. Consequently, T3I pregnant mice did not show symptoms of hyperthyroidism, nor altered body weight or food intake. No abnormal activities such as anxiety and weakness were observed.

However, T3I did not increase the embryo mass as ME did, suggesting that ME improved embryonic development not entirely dependent on the elevation of TH signaling. Indeed, regular moderate exercise enhances placental functions (7,69), which might improve nutrient delivery and embryonic development (70). Overall, our data showed that maternal T3I elevated T3 in embryos to a comparable level with ME, which facilitated embryonic myogenesis. The molecular mechanism of increased TH secretion due to exercise remains unclear (64), but exercise enhances thyroid gland activity and increases iodine utilization (71,72). Other metabolic organs such as the brown adipose tissue, liver, and muscle also regulate circulatory TH levels (27). Our data show that a 36-day moderate exercise elevates serum T3 and T4 concentrations in pregnant mice, as well as in embryos.

TH is essential for myogenesis, a process regulated by a hierarchical expression of transcription factors (54). Among them, Pax3, Pax7, and Myf5 commit progenitor cells to the myogenic fate. After that, Myf5 activates the expression of other myogenic regulatory factors, including Myod, Myog, and Mrf4, which induce terminal myogenic differentiation (34,73). During myogenesis, a sufficient reservoir of TH is required for proper cell differentiation (30,74,75). T3 activity is positively related to the expression of myogenic genes (76), while KO of THRα dramatically inhibited myogenic differentiation and muscle regeneration (77). The intracellular concentration of T3 is regulated by extracellular TH, transmembrane transporters, and T4 to T3 conversion (19,78). It is worthy to mention that the ratio of Dio2 to Dio3 was increased after ME, consistent with an increased T3 level in embryos, which facilitates myogenesis. In addition, our data showed that THRα binds to the Pax3 and Pax7 promoters, which was enhanced due to ME. Similarly, previous studies found that THRα binds with the Myod and Myog promoters in C2C12 myogenic cells (29,73).

Taken together, we discovered a TH-mediated mechanism in enhancing embryonic myogenesis due to ME. ME enhances maternal TH delivery into embryos, upregulating TH signaling and promoting embryonic myogenesis (Fig. 7). Due to the high accessibility of exercise and the pervasiveness of a sedentary lifestyle in pregnant women, our findings have important implications related to improving fetal development and offspring muscle health.

FIG. 7.

Summary of schematic diagram. Maternal treadmill exercise elevates the circulatory TH level in pregnant mice and embryos (left panel). The increased TH provides sufficient reservoir for proper embryo development (right panel). In E12.5 somite (black line encircled), where myogenesis initiates, ME increases the expression of Dio2, which elevates T3 level, and enhances THRa binding with the promoters of myogenic genes, facilitating embryonic myogenesis. The schematic art pieces used in this figure were provided by Servier Medical art, under a Creative Commons Attribution 3.0 Unported License. .

Footnotes

Authors' Contributions

Y.G. designed and performed the experiments, analyzed the data, and wrote and edited the article. L.Z. was involved in collecting the embryos. J.S.S. provided the main idea for exercise intervention. X.L. and Y.C. were involved in analyzing and interpreting the data. J.M.D. performed animal care and metabolic measurement. M.-J.Z. and G.K.M. interpreted the data and revised the article. M.D. designed the studies, interpreted the data, and edited the article.

Acknowledgment

We thank Servier Medical Art for the artwork.

Author Disclosure Statement

The authors declare no competing interests.

Funding Information

This study is supported by the National Institute of Health R01-HD067449 to M.D.

References

Krans

, Gearhart

, Dubbert

, Klar

, Miller

, Replogle

. 2005. Pregnant women's beliefs and influences regarding exercise during pregnancy. J Miss State Med Assoc, 46:67–73.

Chen

, Ma

, Hu

, Yang

, Deavila

, Zhu

M-J

, Du

. 2021. Effects of maternal exercise during pregnancy on perinatal growth and childhood obesity outcomes: a meta-analysis and meta-regression. Sports Med, 51:2329–2347.

1994 Exercise during pregnancy and the postpartum period. ACOG Technical Bulletin Number 189—February 1994. Int J Gynaecol Obstet, 45:65–70.

Liao

, He

, Zhou

, Ma

, Wen

, Chen

, Li

, Qin

, Wang

. 2020. Repetitive bouts of exhaustive exercise induces a systemic inflammatory response and multi-organ damage in rats. Front Physiol, 11:685.

Altaye

, Mondal

, Legesse

, Abdulkedir

. 2019. Effects of aerobic exercise on thyroid hormonal change responses among adolescents with intellectual disabilities. BMJ Open Sport Exerc Med, 5:e000524.

Bansal

, Kaushik

, Singh

, Sharma

, Singh

. 2015. The effect of regular physical exercise on the thyroid function of treated hypothyroid patients: an interventional study at a tertiary care center in Bastar region of India. Arch Med Health Sci, 3:244.

Son

, Liu

, Tian

, Zhao

, Chen

, Hu

, Chae

, de Avila

, Zhu

, Du

. 2019. Exercise prevents the adverse effects of maternal obesity on placental vascularization and fetal growth. J Physiol, 597:3333–3347.

Stanford

, Lee

, Getchell

, So

, Hirshman

, Goodyear

. 2015. Exercise before and during pregnancy prevents the deleterious effects of maternal high-fat feeding on metabolic health of male offspring. Diabetes, 64:427–433.

Stanford

, Takahashi

, So

, Alves-Wagner

, Prince

, Lehnig

, Getchell

, Lee

, Hirshman

, Goodyear

. 2017. Maternal exercise improves glucose tolerance in female offspring. Diabetes, 66:2124–2136.

10.

Laker

, Lillard

, Okutsu

, Zhang

, Hoehn

, Connelly

, Yan

. 2014. Exercise prevents maternal high-fat diet-induced hypermethylation of the Pgc-1alpha gene and age-dependent metabolic dysfunction in the offspring. Diabetes, 63:1605–1611.

11.

Colicchia

, Campagnolo

, Baldini

, Ulisse

, Valensise

, Moretti

. 2014. Molecular basis of thyrotropin and thyroid hormone action during implantation and early development. Hum Reprod Update, 20:884–904.

12.

Mullur

, Liu

Y-Y

, Brent

. 2014. Thyroid hormone regulation of metabolism. Physiol Rev, 94:355–382.

13.

Mannisto

, Vaarasmaki

, Pouta

, Hartikainen

A-L

, Ruokonen

, Surcel

H-M

, Bloigu

, Jarvelin

M-R

, Suvanto

. 2010. Thyroid dysfunction and autoantibodies during pregnancy as predictive factors of pregnancy complications and maternal morbidity in later life. J Clin Endocrinol Metab, 95:1084–1094.

14.

, Leung

, Man

, Leung

, Ip

, Li

, Wong

, Kung

, Cheung

C-L

. 2020. Maternal thyroid dysfunction during pregnancy and the risk of adverse outcomes in the offspring: a systematic review and meta-analysis. J Clin Endocrinol Metab, 105:3821–3841.

15.

Medici

, Korevaar

, Visser

, Peeters

. 2015. Thyroid function in pregnancy: what is normal?. Clin Chem, 61:704–713.

16.

Ashkar

, Semple

, Schmidt

, St. John

, Bartlewski

, King

. 2010. Thyroid hormone supplementation improves bovine embryo development in vitro. Hum Reprod Open, 25:334–344.

17.

James

, Franklyn

, Kilby

. 2007. Placental transport of thyroid hormone. Best Pract Res Clin Endocrinol Metab, 21:253–264.

18.

Banker

, Bigler

, Eisenman

. 1991. The thyroid hormone receptor gene (c-erbA alpha) is expressed in advance of thyroid gland maturation during the early embryonic development of Xenopus laevis . Mol Cell Biol, 11:5079–5089.

19.

Nucera

, Muzzi

, Tiveron

, Farsetti

, Regina

, Foglio

, Shih

, Moretti

, Pietra

, Mancini

. 2010. Maternal thyroid hormones are transcriptionally active during embryo–foetal development: results from a novel transgenic mouse model. J Cell Mol Med, 14:2417–2435.

20.

Thorpe-Beeston

, Nicolaides

, Felton

, Butler

, McGregor

. 1991. Maturation of the secretion of thyroid hormone and thyroid-stimulating hormone in the fetus. NEJM, 324:532–536.

21.

Piccirilli

, Baldini

, Massimiani

, Camaioni

, Salustri

, Bernardini

, Centanni

, Ulisse

, Moretti

, Campagnolo

. 2018. Thyroid hormone regulates protease expression and activation of Notch signaling in implantation and embryo development. J Endocrinol, 236:1–12.

22.

Teixeira

, Zimmer

, de Castro

, Carraro

, Casali

, Dias

IGM

, Godoy

AEG

, Litvin

, Belló-Klein

, da Rosa Araujo

. 2018. Exercise training versus T3 and T4 hormones treatment: the differential benefits of thyroid hormones on the parasympathetic drive of infarcted rats. Life Sci, 196:93–101.

23.

Teixeira

, Zimmer

, de Castro

, de Lima-Seolin

, Türck

, Siqueira

, Belló-Klein

, Singal

, da Rosa Araujo

. 2017. Long-term T3 and T4 treatment as an alternative to aerobic exercise training in improving cardiac function post-myocardial infarction. Biomed Pharmacother, 95:965–973.

24.

de Castro

, Fernandes

, Ortiz

, Campos

, Bonetto

, Fernandes

, Conzatti

, Siqueira

, Tavares

, Schenkel

. 2016. Thyroid hormones improve cardiac function and decrease expression of pro-apoptotic proteins in the heart of rats 14 days after infarction. Apoptosis, 21:184–194.

25.

Mourouzis

, Giagourta

, Galanopoulos

, Mantzouratou

, Kostakou

, Kokkinos

, Tentolouris

, Pantos

. 2013. Thyroid hormone improves the mechanical performance of the post-infarcted diabetic myocardium: a response associated with up-regulation of Akt/mTOR and AMPK activation. Metabolism, 62:1387–1393.

26.

Ciloglu

, Peker

, Pehlivan

, Karacabey

, İlhan

, Saygin

, Ozmerdivenli

. 2005. Exercise intensity and its effects on thyroid hormones. Neuro Endocrinol Lett, 26:830–834.

27.

Fortunato

, Ignácio

, Padron

, Peçanha

, Marassi

, Rosenthal

, Werneck-de-Castro

, Carvalho

. 2008. The effect of acute exercise session on thyroid hormone economy in rats. J Endocrinol, 198:347–353.

28.

Huang

. 2005. Physiology and pathophysiology of type 3 deiodinase in humans. Thyroid, 15:875–881.

29.

Muscat

, Mynett-Johnson

, Dowhan

, Downes

, Griggs

. 1994. Activation of myoD gene transcription by 3, 5, 3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors. Nucleic Acids Res, 22:583–591.

30.

Milanesi

, Lee

J-W

, Kim

N-H

, Liu

Y-Y

, Yang

, Sedrakyan

, Kahng

, Cervantes

, Tripuraneni

, Cheng

S-Y

. 2016. Thyroid hormone receptor α plays an essential role in male skeletal muscle myoblast proliferation, differentiation, and response to injury. Endocrinology, 157:4–15.

31.

Forrest

, Vennström

. 2000. Functions of thyroid hormone receptors in mice. Thyroid, 10:41–52.

32.

Salvatore

, Simonides

, Dentice

, Zavacki

, Larsen

. 2014. Thyroid hormones and skeletal muscle—new insights and potential implications. Nat Rev Endocrinol, 10:206–214.

33.

El Haddad

, Notarnicola

, Evano

, El Khatib

, Blaquière

, Bonnieu

, Tajbakhsh

, Hugon

, Vernus

, Mercier

. 2017. Retinoic acid maintains human skeletal muscle progenitor cells in an immature state. Cell Mol Life Sci, 74:1923.

34.

Chal

, Pourquié

. 2017. Making muscle: skeletal myogenesis in vivo and in vitro. Development, 144:2104–2122.

35.

, Zhou

, Chen

, Nie

, Huang

, Chen

, Mo

. 2015. Not all the number of skeletal muscle fibers is determined prenatally. BMC Dev Biol, 15:1–6.

36.

Murphy

, Kardon

. 2011. Origin of vertebrate limb muscle: the role of progenitor and myoblast populations. Curr Top Dev Biol, 96:1–32.

37.

Gros

, Manceau

, Thomé

, Marcelle

. 2005. A common somitic origin for embryonic muscle progenitors and satellite cells. Nature, 435:954–958.

38.

Zhao

, Law

, Gomez

, Son

, Gao

, Liu

, de Avila

, Zhu

, Du

. 2021. Obesity impairs embryonic myogenesis by enhancing bmp signaling within the dermomyotome. Adv Sci (Weinh), 8:e2102157.

39.

Son

, Chae

, Wang

, Chen

, Iniguez

, de Avila

, Jiang

, Zhu

M-J

, Du

. 2020. Maternal inactivity programs skeletal muscle dysfunction in offspring mice by attenuating apelin signaling and mitochondrial biogenesis. Cell Rep, 33:108461.

40.

Götz

, Huttner

. 2005. The cell biology of neurogenesis. Nat Rev Mol Cell Biol, 6:777–788.

41.

Costa

, Clementino-Neto

, Mendes

, Franzon

, Costa

, Moura-Neto

, Ximenes-da-Silva

. 2019. Evidence of aquaporin 4 regulation by thyroid hormone during mouse brain development and in cultured human glioblastoma multiforme cells. Front Neurosci, 13:317.

42.

Long

, Mathieu

, Fiset

. 2021. Pregnancy-induced increased heart rate is independent of thyroid hormones. Heart Rhythm O2, 2:168–173.

43.

Sagliocchi

, Cicatiello

, Di Cicco

, Ambrosio

, Miro

, Di Girolamo

, Nappi

, Mancino

, De Stefano

, Luongo

. 2019. The thyroid hormone activating enzyme, type 2 deiodinase, induces myogenic differentiation by regulating mitochondrial metabolism and reducing oxidative stress. Redox Biol, 24:101228.

44.

Livak

, Schmittgen

. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2^−ΔΔCT method. Methods, 25:402–408.

45.

Davarinejad

. 2015. Quantifications of western blots with ImageJ. Heslington, York: University of York.

46.

Messeguer

, Escudero

, Farré

, Núñez

, Martínez

, Albà

. 2002. PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics, 18:333–334.

47.

Farré

, Roset

, Huerta

, Adsuara

, Roselló

, Albà

, Messeguer

. 2003. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res, 31:3651–3653.

48.

Chen

Y-T

, Hu

, Yang

Q-Y

, Son

, Liu

X-D

, de Avila

, Zhu

M-J

, Du

. 2020. Excessive glucocorticoids during pregnancy impair fetal brown fat development and predispose offspring to metabolic dysfunctions. Diabetes, 69:1662–1674.

49.

Zhao

, Son

, Wang

, Tian

, Chen

, Liu

, de Avila

, Zhu

M-J

, Du

. 2020. Retinoic acid signalling in fibro/adipogenic progenitors robustly enhances muscle regeneration. EBioMedicine, 60:103020.

50.

Hasegawa

, Shirayoshi

. 2015. P19 cells overexpressing Lhx1 differentiate into the definitive endoderm by recapitulating an embryonic developmental pathway. Yonago Acta Med, 58:15.

51.

Huang

, Turner

, Thompson

, Uhler

. 2012. Ascl1-induced neuronal differentiation of P19 cells requires expression of a specific inhibitor protein of cyclic AMP-dependent protein kinase. J Neurochem, 120:667–683.

52.

Wulf

, Harneit

, Kröger

, Kebenko

, Wetzel

, Weitzel

. 2008. T3-mediated expression of PGC-1α via a far upstream located thyroid hormone response element. Mol Cell Endocrinol, 287:90–95.

53.

Weitzel

, Radtke

, Seitz

. 2001. Two thyroid hormone-mediated gene expression patterns in vivo identified by cDNA expression arrays in rat. Nucleic Acids Res, 29:5148–5155.

54.

Bloise

, Cordeiro

, Ortiga-Carvalho

. 2018. Role of thyroid hormone in skeletal muscle physiology. J Endocrinol, 236:R57–R68.

55.

van der Heyden

, Defize

. 2003. Twenty one years of P19 cells: what an embryonal carcinoma cell line taught us about cardiomyocyte differentiation. Cardiovasc Res, 58:292–302.

56.

Coll

CVN

, Domingues

, Stein

, da Silva

BGC

, Bassani

, Hartwig

, da Silva

ICM

, da Silveira

, da Silva

, Bertoldi

. 2019. Efficacy of regular exercise during pregnancy on the prevention of postpartum depression: the PAMELA randomized clinical trial. JAMA Netw Open, 2:e186861.

57.

Davenport

, Marchand

A-A

, Mottola

, Poitras

, Gray

, Garcia

, Barrowman

, Sobierajski

, James

, Meah

. 2019. Exercise for the prevention and treatment of low back, pelvic girdle and lumbopelvic pain during pregnancy: a systematic review and meta-analysis. Br J Sports Med, 53:90–98.

58.

Dhasarathy

, Roemmich

, Claycombe

. 2017. Influence of maternal obesity, diet and exercise on epigenetic regulation of adipocytes. Mol Asp Med, 54:37–49.

59.

Di Mascio

, Magro-Malosso

, Saccone

, Marhefka

, Berghella

. 2016. Exercise during pregnancy in normal-weight women and risk of preterm birth: a systematic review and meta-analysis of randomized controlled trials. Am J Obstet Gynecol, 215:561–571.

60.

Haakstad

, Bø

. 2011. Exercise in pregnant women and birth weight: a randomized controlled trial. BMC Pregnancy Childbirth, 11:1–7.

61.

Cai

, Ruchat

S-M

, Sivak

, Davenport

. 2020. Prenatal exercise and cardiorespiratory health and fitness: a meta-analysis. Med Sci Sports Exerc, 52:1538–1548.

62.

Mottola

. 2013. Physical activity and maternal obesity: cardiovascular adaptations, exercise recommendations, and pregnancy outcomes. Nutr Rev, 71:S31–S36.

63.

Zimmermann

, Boelaert

. 2015. Iodine deficiency and thyroid disorders. Lancet Diabetes Endocrinol, 3:286–295.

64.

Arkader

, Rosa

, Moretti

. 2016. Physiological changes of exercise of thermogenesis, thyroid homeostasis and inflammation. Int J Endocrinol Metab, 3:85–88.

65.

Story

, Griffith

. 1974. Effect of exercise on thyroid hormone secretion rate in aging rats. Horm Metab Res, 6:403–406.

66.

Banker

, Eisenman

. 1993. Thyroid hormone receptor can modulate retinoic acid-mediated axis formation in frog embryogenesis. Mol Cell Biol, 13:7540–7552.

67.

Yau

, Singh

, Lesmana

, Zhou

, Sinha

, Wong

, Wu

, Bay

B-H

, Sugii

, Sun

. 2019. Thyroid hormone (T3) stimulates brown adipose tissue activation via mitochondrial biogenesis and MTOR-mediated mitophagy. Autophagy, 15:131–150.

68.

Trajkovic

, Visser

, Mittag

, Horn

, Lukas

, Darras

, Raivich

, Bauer

, Heuer

. 2007. Abnormal thyroid hormone metabolism in mice lacking the monocarboxylate transporter 8. J Clin Invest, 117:627–635.

69.

Clapp III

, Kim

, Burciu

, Lopez

. 2000. Beginning regular exercise in early pregnancy: effect on fetoplacental growth. Am J Obstet Gynecol, 183:1484–1488.

70.

Chae

, Son

, Du

. 2021. Prenatal exercise in fetal development: a placental perspective. FEBS J. [Epub ahead of print]; DOI: 10.1111/febs.16173.

71.

Rhodes

. 1967. Effect of exercise on the thyroid gland. Nature, 216:917–918.

72.

Smyth

, Duntas

. 2005. Iodine uptake and loss-can frequent strenuous exercise induce iodine deficiency?. Horm Metab Res, 37:555–558.

73.

Downes

, Griggs

, Atkins

, Olson

, Muscat

. 1993. Identification of a thyroid hormone response element in the mouse myogenin gene: characterization of the thyroid hormone and retinoid X receptor heterodimeric binding site. Cell Growth Differ, 4:901.

74.

Muscat

, Downes

, Dowhan

. 1995. Regulation of vertebrate muscle differentiation by thyroid hormone: the role of the myoD gene family. Bioessays, 17:211–218.

75.

Ambrosio

, De Stefano

, Di Girolamo

, Salvatore

. 2017. Thyroid hormone signaling and deiodinase actions in muscle stem/progenitor cells. Mol Cell Endocrinol, 459:79–83.

76.

Dümmler

, Müller

, Seitz

. 1996. Regulation of adenine nucleotide translocase and glycerol 3-phosphate dehydrogenase expression by thyroid hormones in different rat tissues. Biochem J, 317:913–918.

77.

Milanesi

, Lee

J-W

, Yang

, Liu

Y-Y

, Sedrakyan

, Cheng

S-Y

, Perin

, Brent

. 2017. Thyroid hormone receptor alpha is essential to maintain the satellite cell niche during skeletal muscle injury and sarcopenia of aging. Thyroid, 27:1316–1322.

78.

Galton

, Wood

, St. Germain

, Withrow

C-A

, Aldrich

, St. Germain

, Clark

, St. Germain

. 2007. Thyroid hormone homeostasis and action in the type 2 deiodinase-deficient rodent brain during development. Endocrinology, 148:3080–3088.