First Detection of Leishmania major in Rattus norvegicus from Fars Province,Southern Iran

Abstract

Zoonotic cutaneous leishmaniasis is an important health problem in Iran and a great economic burden on the health resources. In southern Iran (Fars Province), Meriones libycus was reported as the main reservoir of zoonotic cutaneous leishmaniasis in Arsanjan and Marvdasht cities, and Tatera indica and Gerbillus spp. were the reservoirs reported in Larestan and Kharameh districts. Because of an increase in human cutaneous leishmaniasis in Fars Province, this study was performed to identify the rodent hosts in this region. From April 2004 to April 2006, live traps were used to catch rodents in different parts of Fars Province. Fifty-seven Rattus norvegicus were caught and checked for Leishmania infection using a combination of microscopy, culture, nested polymerase chain reaction (PCR), and enzyme electrophoresis. One female R. norvegicus was found to be smear positive for amastigotes in Giemsa-stained skin sample of sole, and it was also culture positive for Leishmania. Results of PCR and isoenzyme electrophoresis indicated that this infected rodent was harboring Leishmania major. PCR was also positive for L. major in biopsy of soles, ear, liver, and spleen of 29 other R. norvegicus hosts that were negative in smears and cultures. There were no lesions seen in any parts of infected rodents' bodies. As L. major has not been previously reported in R. norvegicus in Iran or elsewhere, the rodent can be considered as a possible reservoir in transmission of the disease in Fars Province, and it should be brought into consideration when planning for preventive measures.

Introduction

L eishmania major parasite is a causative agent in zoonotic cutaneous leishmaniasis (ZCL) of the Old World. Iran is considered as one of the endemic foci of the disease due to L. major and Leishmania tropica (Ardehali et al. 2000). ZCL caused by L. major occurs widely in Iran, mainly in 11 of its 29 provinces (Yaghoobi-Ershadi et al. 2001). The species of rodents reported from Iran were Rhombomys opimu, Meriones libycus erythrousus, Tatera indica, Nesokia indica, and Meriones hurriana (Seyedi-Rashti and Nadim 1967, Nadim and Faghih 1968, Nadim et al. 1968, Seyedi-Rashti and Nadim 1984, Javadian 1988, Javadian et al. 1998, Seyedi-Rashti and Salehzadeh 1990, Mohebali et al. 2004). In southern Iran, there has been a worrying increase in the incidence of human ZCL in the last decade (Nadim et al. 1977, Motazedian et al. 2002); L. major has been detected in M. libycus (Rassi et al. 2001, Moenmenbellah-Fard et al. 2003), T. indica, and Gerbillus sp. (Asgari et al. 2007, Mehrabani et al. 2007). The increase of human ZCL in this area is probably the consequence of the spread of local human population into areas where L. major has been maintained in a rodent–sand fly–rodent cycle (Dejeux 2001, Motazedian et al. 2006). This study was undertaken to identify the rodent hosts of L. major in different areas in Fars Province, using a combination of microscopy, culture, nested polymerase chain reaction (PCR), and enzyme electrophoresis methods to detect and identify any Leishmania parasites in wild-caught rodents.

Materials and Methods

Study area

Fars Province is one of the main and environmentally fragile areas in southern Iran, with an occupied area of 122,780 km and a population of 323,626. Shiraz is the major city of the province, with an altitude of 1500 m above sea level. It has cold, rainy winter and moderate to hot dry summer. The average temperature of Shiraz is 16.8°C, ranging between 4.7°C and 29.2°C. The geographical and climatic variation of the province causes variations in plants, and consequently, variation of the wildlife. Other cities included in this study are located around Shiraz, with moderate differences in geographical characteristics (Fars Budget and Planning Organization 2000).

Trapping

Rodents were caught alive in 35 × 12 × 12-cm wire traps baited with bread and roasted peanuts (Lacher et al. 1989). Between April 2004 and April 2005, 100 traps were set inside and outside houses and in agricultural plantations close to them, in both rural and urban settings, in or close to following cities: Shiraz, Kazerun, Kavar, Arsanjan, Marvdasht, Zarghan, and Estahban. At each collection site, traps were left for 96 consecutive nights, being checked and rebaited early each morning. Trapped animals were identified by the staff of Shiraz University, Department of Biology, using the relevant taxonomic criteria: forms of teeth, comb of tooth, shape of cranlum, size, and prominence of food pad (Eisenberg and Redford 1999). Fars Environmental Protection Organization gave the permission for trapping, and all the rodents caught were handled and killed according to methods approved by the Iran Veterinary Organization.

Smears and cultures

Each animal was killed by chloroform and carefully evaluated for any skin lesions. Impression smears of tissue samples taken from ears, tail, soles, and patent lesion (Edrissian et al. 1982) were stained with Giemsa and examined microscopically for presence of amastigotes. Tissue samples collected aseptically from spleen, liver, and skin were cultured at 25°C in rabbit blood agar (Evans 1989). Cultures were checked regularly for parasites and only considered negative if no promastigotes were seen within 2 months. Parasites from any positive culture were coded and cryopreserved in liquid nitrogen, pending their identification in a PCR-based assay (see below).

DNA extraction

DNA from cultured promastigotes was extracted as describes by Motazedian et al. (2002). And DNA from soles, ear, liver, and spleen was isolated as follows: small cuts of tissue were divided into very smaller pieces using lancet and then squashed by a slender rod in an appendorf tube.

One hundred milliliters of distilled water was added and tubes were frozen and thawed in liquid nitrogen three times. Tubes were then boiled for 10 min and centrifuged at 1000 rpm for 2 min. After that, the standard method of phenol chloroform was used for DNA extraction. Briefly, a heat-sealed Pasteur pipette was used to homogenize the samples with 200 μL lysis buffer (50 mM Tris-HCl [pH 7.6]; 1 mM EDTA, and 1% Tween 20) and 12 μL of a proteinase K solution (Cinna Gen) (containing 19 μg of the enzyme/mL) in a 1.5-mL microcentrifuge tube. The homogenate was then incubated at 37°C overnight before 300 μL of a phenol:chloroform:isoamyl alcohol mixture (25:24:1, by vol) was added. After being shaken vigorously, the tube holding the mix was centrifuged (10,000 g for 10 min) and then the DNA in the supernatant solution was precipitated with 400 μL of cold, pure ethanol, resuspended in 50 μL double-distilled water, and stored at −20°C until it could be tested for Leishmania kDNA. All the procedures were done in a sterile way.

Nested PCR

This PCR method was used to reduce the risk of contamination in products. Nested PCR involves two sets of primers used in two successive runs of PCR, the second set intended to amplify a secondary target within the first-run product. First-round PCR mixture contained 0.4 U Taq DNA polymerase (Sina Gene), 2.5 mM deoxynucleoside triphosphate (Sina Gene), 2.0 mM MgCl₂, 2.5 μL PCR buffer (Sina Gene), 1 μL DNA, and 40 ng of each of outer pair of primers CSB2XF (C/GA/GTA/GCAGAAAC/TCCCGTTCA) and CSB1XR (ATTTTTCG/CGA/TTTT/CGCAGAACG). Cycling conditions were as follows (Corbette): 30 cycles of 94°C for 30 s, 55°C for 1 min, 72°C for 90 s. One microliter of a 1:10 dilution in water of the first-round product was used as template for the second round under the same conditions as those for the first round, except with nested primers (“internal” to the first primer) LiR (TCGCAGAACGCCCCT) and 13Z (ACTGGGGGTTGGTGTAAAATAG). Second-round PCR product was loaded onto 1.5% agarose gel (Roche). Amplification products were separated by electrophoresis and visualized by ultraviolet illumination following ethidium bromide (Roche) staining. Parasite species were identified according to the molecular weight of DNA bands (L. tropica 750 bp, Leishmania infantum 680 bp, L. major 560 bp) (Noyes et al. 1998).

Agarose gel electrophoresis

Samples of 10 μL of the PCR products mixed with 5 μL of loading buffer were run in 1.5% agarose gel. Runs were stained with ethidium bromide and visualized under ultraviolet light. The World Health Organization reference strains L. tropica (MHOM/AZ/1974/SAF-K27), L. major (MHOM/TM/1973/5ASKH), and L. infantum (MHOM/TN/1980/IPT1) were obtained from Pasteur Institute.

Enzyme extraction and electrophoresis

Enzyme extraction from the peletted organism was done by the method described by Hatam et al. (1999).

Analysis was done using five enzymatic systems (namely malate dehydrogenase E.C.1.1.1.37, phosphoglucomutase E.2.7.51, glucose-phosphate isomerase E.C.5.3.1.9, nucleoside hydrolase I E.C.3.2.2.1, and nucleoside hydrolase II E.C.3.2.2.1) in discontinuous polyacrylamide gel electrophoresis. Electrophoresis was performed as described earlier (Evans 1989).

Sequencing

Twenty of 29 samples from different area, which showed a high-quality yield in PCR product, and according to distance from Shiraz, the capital city of Fars Province, were chosen and sequenced (Faza Biotech Iran and Macro Gene companies South Korea). Results of sequences were compared using multiple sequence alignment by CLUSTALW from http://align.genome.jp/clustalw/.

Results

Of 57 Rattus norvegicus caught in agricultural plantations close to houses (Table 1), 29 were positive by PCR. One female R. norvegicus was found to be smear positive for amastigotes in Giemsa-stained skin sample of soles, and it was also culture positive for leishmania (Table 1). Results of the PCR and isoenzyme electrophoresis indicated that this infected rodent was harboring L. major (Figs. 3 and 4). PCR was also positive for L. major in soles (23), ears (18), liver (10), and spleen (5) of R. norvegicus hosts, which were negative in smears and cultures (Fig. 4). The infected rodents were caught from Shiraz, Kazerun, Kavar, Arsanjan, Marvdasht, Zarghan, and Estahban cities, Fars Province. There were no lesions on any parts of the bodies of R. norvegicus. Amastigotes were observed in smears of sole skin.

FIG. 1.

Rattus norvegicus captured in Marvdasht town, Fars Province, southern Iran.

FIG. 2.

The denture of Rattus norvegicus captured in Marvdasht town, Fars Province.

FIG. 3.

Electrophoretic profiles obtained with soluble extracts of Leishmania promastigotes, using five enzymatic systems in Rattus norvegicus in Marvdasht. L.inf, Leishmania infantum, L.m, Leishmania major.

FIG. 4.

Agarose (1.5%) gel electrophoresis of polymerase chain reaction products: M: marker; 1: isolated parasite in culture from R. norvegicus; 2: isolated parasite in liver from R. norvegicus; 3: isolated parasite in spleen from R. norvegicus; 4: Leishmania tropica (MHOM/IR/89ARD2) reference strain; 5: L. infantum (MHOM/FR/59/LEM 188) reference strain; 6: L. major (MHOM/IR/54/LV39) reference strain.

Table 1.

Details of Infected and Uninfected Rattus norvegicus Caught in Plantations at Various Locations in Fars Province, Southern Iran, During 2004–2006

			Infection
No.	Location	Number	PCR+	Smear	Culture	Isoenzyme	Species
1	Marvdasht	12	5	+1	+1	+ve	Leishmania major
2	Shiraz	27	14	−ve	−ve	Not done	L. major
3	Arsanjan	1	1	−ve	−ve	Not done	L. major
4	Kavar	12	5	−ve	−ve	Not done	L. major
5	Kazerun	2	2	−ve	−ve	Not done	L. major
6	Estahban	1	1	−ve	−ve	Not done	L. major
7	Zarghan	1	1	−ve	−ve	Not done	L. major
8	Khorambid	1	−ve	−ve	−ve	Not done	L. major
	Total	57	29	1	1

PCR, polymerase chain reaction.

Sequencing result

According to dendrogram obtained by this method, infected mice were classified into two main groups. One group contains infected mice from different areas far from each other. Mice number 5 (5m) is from Kazeroun 100 km far away from number 15 (15m) Marvdasht, indicating genetic similarity in different area. High similarity was observed between mice from one place and different places, for example, number 11m from Shiraz suburb, 9m also from shiraz suburb, 13m from Shiraz suburb, and 15m from Marvdasht.

The other group contains three main branches with 14 infected mice. One sequence of L. major (21 L. major) was obtained from GenBank (Smith et al. 1989) and compared with these samples. It showed similarity with 2m and 18m from Shiraz. High similarity and genomic distance were also observed between mice from one place and different places (Fig. 5).

FIG. 5.

Twenty polymerase chain reaction products of Leishmania major minicircles isolated from infected Rattus norvegicus. Number 1m to 20m from sh: shiraz; sh su: shiraz suburb; ka: kazerun; ma: marvdasht. Number 21: L. major minicircle from gene bank.

Discussion

Human ZCL caused by L. major is a widely distributed zoonotic disease in several countries. In Sudan, the reservoir host for ZCL has been the Nile rat (Arvicanthis niloticus) (el-Hassan and Zijlstra 2001). Meriones sacramenti has been reported from North Sinai, Egypt, as a reservoir host (Morsy et al. 1993), and Psammomus obesus has been reported as the reservoir host of ZCL in Jordan, Algeria, and Egypt (Saliba et al. 1994, Harrat et al. 1996, Morsy et al. 1996). Tatera robusta is the main reservoir host of ZCL in Baringo district of Kenya (Githure et al. 1996). In Israel, Meriones crassus and P. obesus were the reservoir hosts (Schlein et al. 1984), and also Gerbillus dasyurus and P. obesus were positive for Leishmania in Nizzana, Israel (Waaserburg et al. 2002). Rioux et al. (1986) isolated L. major from the rodent Meriones shawi shawi in central Tunisia. A misleading trypanosomatid parasite (Leishmania amastigote) has been isolated from Gerbillus pyramidum and Gerbillus andersoni in an endemic area of L. major in North Sinai, but the parasites failed to be identified as a species (Mikhail et al. 1996). L. major infection was reported in P. obesus, M. crassus, and M. libycus in Saudi Arabia and in P. obesus in Syria (Rioux et al. 1992, el Sibae et al. 1993). Parasitic infection in R. norvegicus was reported first by Morsy et al. (1988) from Alexandria, Egypt, but despite isolation and growth of parasite on blood agar, they failed to determine and confirm the species of the parasite by isoenzyme technique. Giannini (1985) showed that experimental infection in Sprague–Dawley rats, which were injected intradermally with L. major promastigotes, indicates possible involvement of R. norvegicus in the transmission cycle of CL. Petrovic et al. (1975) reported the presence of Leishmania donovani infantum infections in Rattus rattus and R. norvegicus in some areas of former Yugoslavia.

Rhombomys opimus, M. libycus erythrousus, and Meriones persicus were shown as the rodent hosts of the disease in central Iran (Nadim and Faghih, 1968, Nadim et al. 1968, Javadian 1988, Doroudgar et al. 1995, Yaghoobi-Ershadi et al. 1996, 2001, Javadian et al. 1998, Rassi et al. 2001, Mohebali et al. 2004, Parvizi et al. 2008), and T. indica and N. indica in western Iran, Khorasan Province, and Tehran (Seyedi-Rashti and Nadim 1967, Javadian 1988, Javadian et al. 1998, Seyedi-Rashti and Salahzadeh 1990). T. indica and Meriones hurrianae were reported as natural reservoir hosts in southeast Iran (Seyedi-Rashti and Nadim, 1984, Yaghoobi-Ershadi et al. 1996). In southern Iran, Fars Province, L. major infection was reported in M. libycus in Arsanjan and Marvdasht (Rassi et al. 2001, Moemenbellah-Fard et al. 2003) and in T. indica and Gerbillus spp. in Larestan and Kharameh (Asgari et al. 2007, Mehrabani et al. 2007).

In this study, the isolated L. major from R. norvegicus was characterized by both nested PCR and isoenzyme techniques. Soles, ear, liver, and spleen of 29 R. norvegicus were also positive by PCR, indicating the possibility of this rodent Bering as a main reservoir host for L. major both around and in cities of this province. Sequences analysis of minicircles showed similarity and divergence of the parasites in one area and different areas far from each other. This indicates the genomic variation in L. major in this province. R. norvegicus is one of the rodents in the area, which lives in agricultural regions near Shiraz, the capital city, and other big cities of Fars Province. These regions are suitable for agriculture and have enough water supplies providing suitable locations for reproduction of the rodents and Phelebotomus sand flies. In our study, the reservoir host of L. major was different from those reported in other parts of Iran, which may be due to difference in plantation, weather, sunshine duration, humidity, and type of soil in the area. Our results vary with studies of Rassi et al. (2001) and Moemenbellah-Fard et al. (2003) in Arsanjan and Marvdasht, who reported L. major infection in M. libycus, which could be due to difference in the place of trapping. In our study, traps were set inside and outside homes and in agricultural plantations close to houses, whereas in the other two studies, they caught the rodents far from the houses. It seems that rodent control is a challenge to the health authorities involved in the control of ZCL in southern parts of Iran. Rapid urbanization, construction of buildings in farms near the colonies of rodents, storage of waste materials around the town, which are suitable for building nests by rodents, new agricultural projects in this area, existence of some animal shelters among old mud houses, and socioeconomic changes in the area may help increase the number of wild rodents and sand flies to provide a very efficient cycle for the transmission of the disease. Migration of refugees from Afghanistan has also provided suitable conditions for further spread of the disease (Ardehali 1996). As L. major has not been previously reported in R. norvegicus elsewhere and in Iran, the rodent can be considered as a possible reservoir in transmission of the disease in Fars Province and should be brought into consideration when planning preventive measures. Further studies are needed to shed light on the disease cycle in the area to demonstrate the role of this rodent as a definite reservoir for CL.

Footnotes

Acknowledgments

The authors thank the Office of the Vice-Chancellors for Research of Shiraz University of Medical Sciences, Shiraz University, for financial support. The authors also thank Dr. Motahareh Motazedian for help with improving the English language in the manuscript.

Disclosure Statement

No competing financial interests exist.

References

Ardehali

Leishmaniasis. Where do we stand?

Iranian J Med Sci, 1996; 21:87–88.

Ardehali

, Moattari

, Hatam

, Hosseini

, Sharifi

Characterization of Leishmania isolated in Iran: 1. Serotyping with species specific monoclonal antibodies. Acta Trop, 2000; 75:301–307.

Asgari

, Motazedian

, Mehrabani

, Oryan

et al. Zoonotic cutaneous leishmaniasis in Shiraz, southern Iran: a molecular, isoenzyme and morphologic approach. J Res Med Sci, 2007; 12:7–15.

Dejeux

The increase in risk factors for leishmaniasis worldwide. Trans R Soc Trop Med Hyg, 2001; 95:239–243.

Doroudgar

, Javadian

, Dehghani

, Hoshyar

, Sayyah

The prevalence of leishmaniasis in wild rodents in Kashan, Iran. Feyz J, 1995; 2:53–59. (In Persian).

Edrissian

, Zovein

, Nadim

A simple technique for preparation of smears from the ear of Rhombomys opimus for the detection of leishmanial infection. Trans R Soc Trop Med Hyg, 1982; 76:706–707.

Eisenberg

, Redford

Mammals of the Neotropics. The Central Neotropics: Ecuador, Peru, Bolivia, Brazil, 3. Chicago: University of Chicago Press, 1999.

el-Hassan

, Zijlstra

EE.

Leishmaniasis in Sudan. Cutaneous leishmaniasis. Trans R Soc Trop Med Hyg, 2001; 95,Suppl 1:S1–1.

el Sibae

, Eesa

, Morsy

TA.

Rodents and cutaneous leishmaniasis in Qasim, Saudi Arabia. J Egypt Soc Parasitol, 1993; 23:667–673.

10.

Evans

DA.

Handbook on Isolation, Characterization and Cryopreservation of Leishmania. Geneva: United Nations Development Programmed World Bank/World Health Organization, 1989.

11.

Fars Budget and Planning Organization. Management and Planning Press. 2000:20–30(In Persian).

12.

Giannini

SH.

Induction and detection of leishmanial infections in Rattus norvegicus. Trans R Soc Trop Med Hyg, 1985; 79:458–461.

13.

Githure

, Ngumbi

, Anjili

, Lugalia

et al. Animal reservoirs of leishmaniasis in Marigat, Baringo District, Kenya. East Afr Med J, 1996; 73:44–47.

14.

Harrat

, Pratlong

, Belazzoug

, Dereure

et al. Leishmania infantum and L. major in Algeria. Trans R Soc Trop Med Hyg, 1996; 90:625–629.

15.

Hatam

, Hosseini

SMH

, Ardehali

Izoenzyme studies in characterization of Leishmania isolated in Iran. Iranian J Med Sci, 1999; 24:8–13.

16.

Javadian

Reservoir host of cutaneous leishmaniasis in Iran. Abstract of XIIth International Congress for Tropical Medicine and Malaria, Amsterdam, The Netherlands, 52. 1988.

17.

Javadian

, Dehestani

, Nadim

, Rassi

et al. Confirmation of Tatera indica (Rodentia: Gerbillidae) as the main reservoir host of zoonotic cutaneous leishmaniasis in the west of Iran. Iranian J Public Health, 1998; 27:55–60.

18.

Lacher

Jr. , Mares

, Alho

CJR

. The structure of a small mammal community a central brazilin Savanna. Redford

, Eisenberg

. Advances in Neotropical Mammalogy. Gainesville: The Sandhill Cranepress Inc., 1989; 137–162.

19.

Mehrabani

, Motazedian

, Oryan

, Asgari

et al. A search for the rodent hosts of Leishmania major in the larestan region of southern Iran: demonstration of the parasite in Tatera indica and Gerbillus sp., by microscopy, culture and PCR. Ann Trop Med Parasitol, 2007; 101:1–9.

20.

Mikhail

, Mansour

, Mohareb

, Francies

WM.

Identification of a misleading trypanosomatid parasite from Gerbillus pyramidum and G. andersoni in a Leishmania major endemic area in north Sinai. J Parasitol, 1996; 82:400–404.

21.

Moemenbellah-Fard

, Kalantari

, Rassi

, Javadian

The PCR-based detection of Leishmania major infections in Meriones libycus (Rodentia: Muridae) from southern Iran. Ann Trop Med Parasitol, 2003; 97:811–816.

22.

Mohebali

, Javadian

, Yaghoobi-Ershadi

, Akhavan

et al. Characterization of Leishmania infection in rodents from endemic areas of the Islamic Republic of Iran. East Mediterr Health J, 2004; 10:591–599.

23.

Morsy

, el Kady

, Salama

, Habib

, Ghareb

MA.

Leishmania major in Meriones sacramenti Thomas 1922 in Nakhel, North Sinai, Egypt. J Egypt Soc Parasitol, 1993; 23:373–379.

24.

Morsy

, Sabry

, Rifaat

, Wahba

MM.

Psammomys obesus Cretzschmar, 1828 and zoonotic cutaneous leishmaniasis in Sinai Peninsula, Egypt. J Egypt Soc Parasitol, 1996; 26:375–381.

25.

Morsy

, Schnur

, Feinsod

, Michael

et al. The discovery and preliminary characterization of a novel trypanosomatid parasite from Rattus norvegicus and stray dogs from Alexandria, Egypt. Ann Trop Med Parasitol, 1988; 82:437–444.

26.

Motazedian

, Mehrabani

, Oryan

, Asqari

et al. Cutaneous leishmaniasis in Larestan Region, Fars Province, southern Iran: infection patterns in the reservoir hosts and sand fly vectors and a comparison with human isolates. Iranian Clin J Infect Dis, 2006; 1:137–143.

27.

Motazedian

, Noamanpoor

, Ardehali

Characterization of Leishmania parasites isolated from provinces of the Islamic Republic of Iran. East Mediterr Health J, 2002; 8:338–344.

28.

Nadim

, Faghih

The epidemiology of cutaneous leishmaniasis in the Isfahan Province of Iran. I. The reservoir II. The human disease. Trans R Soc Trop Med Hyg, 1968; 62:534–542.

29.

Nadim

, Mesghali

, Javadian

Cutaneous leishmaniasis in Southern Iran. Ecologies des lershamaniosis (Colloques Internationaux No. 239) Paris: Center National de la Recher che Scientifique, 1977; 215–218In language.

30.

Nadim

, Seyed-Rashti

, Mesghali

Epidemiology of cutaneous leishmaniasis in Turkaman Sahra, Iran. J Trop Med Hyg, 1968; 71:238–239.

31.

Noyes

, Reyburn

, Bailey

, Smith

A nested-PCR-based schizodeme method for identifying Leishmania kinetoplast minicircle classes directly from clinical samples and its application to the study of the epidemiology of Leishmania tropica in Pakistan. J Clin Microbiol, 1998; 36:2877–2881.

32.

Parvizi

, Moradi

, Akbari

, Ready

et al. PCR detection and sequencing of parasite ITS-rDNA gene from reservoirs host of zoonotic cutaneous leishmaniasis in central of Iran. Parasitol Res, 2008; 103:1273–1278.

33.

Petrovic

, Borjoski

, Savin

Les resultats de recherches sur le réservoir de Leishmania donovani dans une région endémique du Kala-azar. Proc Europ Multicoll Parasit Trogir, 1975; 2:97–98. (In language.)

34.

Rassi

, Jalali

, Javadian

, Motazedian

Confirmation of Meriones libycus (Rodentia; Gerbillidae) as the main reservoir host of zoonotic cutaneous leishmaniasis in Arsanjan, Fars Province, South of Iran (1999–2000)

Iranian J Public Health, 2001; 30:143–144.

35.

Rioux

, Ashford

, Khiami

Ecoepidemiology of leishmaniases in Syria. 3. Leishmania major infection in Psammomys obesus provides clues to life history of the rodent and possible control measures. Ann Parasitol Hum Comp, 1992; 67:163–165.

36.

Rioux

, Petter

, Zahaf

, Lanotte

et al.

[Isolation of Leishmania major Yakimoff and Shokhor, 1914 (Kinetoplastida-Trypanosomatidae) in Meriones shawi-shawi (Duvernoy, 1842) (Rodentia-Gerbillidae) in Tunisia]

Ann Parasitol Hum Comp, 1986; 61:139–145.

37.

Saliba

, Disi

, Ayed

, Saleh

et al. Rodents as reservoir hosts of cutaneous leishmaniasis in Jordan. Ann Trop Med Parasitol, 1994; 88:617–622.

38.

Schlein

, Warburg

, Schnur

, Le Blancq

, Gunders

AE.

Leishmaniasis in Israel: reservoir hosts, sandfly vectors and leishmanial strains in the Negev, Central Arava and along the Dead Sea. Trans R Soc Trop Med Hyg, 1984; 78:480–484.

39.

Seyedi-Rashti

, Nadim

Epidemiology of cutaneous leishmaniasis in Iran. B. Khorasan area, Part I: the reservoirs. Soc Pathol Ex, 1967; 60:510–518.

40.

Seyedi-Rashti

, Nadim

. Cutaneous leishmaniasis in Balouchistan, Iran. Abstract of XI International Congress for Tropical Medicine and Malaria, Calgary, Canada, 124. 1984.

41.

Seyedi-Rashti

, Salehzadeh

A new focus of zoonotic cutaneous leishmaniasis near Tehran, Iran. Bull Soc Fr Parasitol Abstr, 1990; 8:145.

42.

Smith

, Searle

, Ready

, Gramiccia

, Ben-Ismail

A kinetoplast DNA probe diagnostic for Leishmania major. Sequence homologies between regions of Leishmania minicircles. Mol Biochem Parasitol, 1989; 37:213–223.

43.

Waaserburg

, Abramsky

, Anders

, El-Fari

et al. The ecology of cutaneous leishmaniasis in Nizzana, Israel: infection patterns in the reservoir host, and epidemiological implications. Int J Parasitol, 2002; 32:133–143.

44.

Yaghoobi-Ershadi

, Akhavan

, Mohebali

Meriones libycus and Rhombomys opimus (Rodentia: Gerbillidae) are the main reservoir hosts in a new focus of zoonotic cutaneous leishmaniasis in Iran. Trans R Soc Trop Med Hyg, 1996; 90:503–504.

45.

Yaghoobi-Ershadi

, Hanafi-Bojd

, Akhavan

, Zahrai-Ramazani

, Mohebali

Epidemiological study in a new focus of cutaneous leishmaniosis due to Leishmania major in Ardestan town, central Iran. Acta Trop, 2001; 79:115–121.