Molecular Detection of Anaplasma phagocytophilum in the European Hedgehog ( Erinaceus europaeus ) and its Ticks

Introduction

A naplasmosis is a zoonotic tick-borne disease that is caused by pathogens of the family Anaplasmataceae, order Rickettsiales, occurring worldwide in animals and humans. Human granulocytic anaplasmosis (previously known as human granulocytic ehrlichiosis) is an acute, nonspecific, febrile disease (Hartelt et al. 2004, Sréter et al. 2004). It is caused by Anaplasma phagocytophilum, which is an emerging pathogen of public health importance (Sréter et al. 2004). This gram-negative, obligate, intracellular bacterium, which replicates within neutrophilic granulocytes, is thought to be naturally maintained in a tick-rodent cycle (Bown et al. 2003).

Various strains of A. phagocytophilum have been identified, but only some are considered to be human pathogens (De la Fuente et al. 2005). The agent is usually associated with ticks of the genus Ixodes, and in Europe the main vector is thought to be Ixodes ricinus (Bown et al. 2003). Average prevalences for A. phagocytophilum recorded thus far from populations of I. ricinus in Germany ranged from 1% to 4.5% (Hartelt et al. 2004, Silaghi et al. 2008). Although A. phagocytophilum occurs worldwide in many species of wild and domestic mammals, including rodents, carnivores, equids, and ruminants (Bown et al. 2003, Sréter et al. 2004), the major reservoir hosts of human pathogenic strains in Europe are unknown (Sréter et al. 2004).

The European hedgehog (Erinaceus europaeus) is a common wild mammal in Europe with most individuals being infested by Ixodes hexagonus and/or I. ricinus ticks (Gern et al. 1997, Skuballa et al. 2007, Pfäffle et al. 2009). Both species are known to transmit a variety of tick-borne diseases, such as different Borrelia species and tick-borne encephalitis (TBE) virus (Gern et al. 1997, Skuballa et al. 2007). However, only limited information about the host status of the hedgehog and its ticks for different pathogens is available.

Materials and Methods

The animals investigated (n = 31) came from hedgehog rescue centers in various areas of Germany (Table 1). All hedgehogs had died during the summers between 2006 and 2008. They were frozen at −20°C until the dissection.

The organs of each animal were pooled. This “organ pool” comprised a 2 × 2 × 2 mm piece of tissue of heart, lung, spleen, liver, kidney, and urinary bladder. DNA isolation was carried out using a Maxwell 16 Instrument and System (Promega). In addition, 38 engorged female ticks (determined as Ixodes sp.) were removed from 14 hedgehogs from an experimental population in Karlsruhe (Germany). Since organ samples from these hedgehogs could not be taken, their infection status could not be determined. The ticks were tested individually for A. phagocytophilum infection. This experimental population consisted of about 30 hedgehogs (1–3 years old), which were observed from 2006 to 2008 in an enclosed, natural grass, and bush garden habitat (1100 m², see Pfäffle et al. 2009).

For the detection of A. phagocytophilum, DNA from the 16S rDNA gene were amplified in a nested polymerase chain reaction (PCR) according to the protocol of Bown et al. (2003), using Taq polymerase (Quiagen, Hilden, Germany) and the primers EE1 and EE2 in the first reaction (5′- TCCTGGCTCAGAACGAACGCTGGCGGC; 5′ AGTCACTGACCCAACCTTAAATGGCTG) and EE3 and EE4 in the second reaction (5′-GTCGAACGGATTATTCTTTATAGCTTGC; 5′-CCCTTCCGTTAAGAAGGATCTAATCTCC). Five microliters of the extracted DNA served as template for the primary PCR. About 1.5 μL of the first reaction was used in the second PCR reaction. As positive control, A. phagocytophilum from cell culture (donated by K. Hartelt) was used; as negative control, nuclease-free water was used. The 928 bp products of the nested PCR were visualized under ultraviolet light after electrophoresis on ethidium bromide–stained agarose gels.

All nested PCR-positive products were sequenced with an ABI 3730 automated sequencer. The sequences were compared to previously published A. phagocytophilum sequences on GenBank using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Additionally, the PCR product from one positive hedgehog in Berlin was cloned with the TOPO TA cloning kit (Invitrogen) and sequenced.

Results

A. phagocytophilum DNA was detected in 8 organ pools (25.8%) of 31 animals from different areas of Germany (Table 1). Ticks were not available from these hedgehogs.

A total of 15 (39.5%) of the 38 engorged female ticks collected from 14 animals from the experimental population was also positive. These infected ticks all derived from seven hedgehogs whereas the other seven animals from this population did not harbor Anaplasma-infected ticks. The sequences from the organ pools and from the engorged ticks showed 99% identity with A. phagocytophilum strains listed in GenBank (e.g., DQ449945, FJ172530 GU064899, GQ4123399) but had differences at least in one position.

Interestingly, the two cloned sequences, deriving from a single hedgehog in Berlin (FN390879; FN390880), differed in three positions from each other, suggesting the occurrence of more than one A. phagocytophilum strain in German hedgehogs.

Discussion

Our results suggest that hedgehogs can act as hosts for A. phagocytophilum. To our knowledge, this is the first report of this agent from E. europaeus, although it has already been reported from the hedgehog tick I. hexagonus (Nijhof et al. 2007). In general, this tick is a nest-dwelling species largely specific to hedgehogs, but with records from mustelid species and carnivores (see Pfäffle et al. 2009) as well as domestic animals and humans (Ogden et al. 2000).

The transmission cycle of Anaplasma species seems to be complex and is not fully understood, although it is believed to be maintained in a tick-vertebrate cycle with Ixodes spp. Bown et al. (2003) suggest a tick-rodent system, but sheep and roe deer are also natural hosts for A. phagocytophilum (Beninati et al. 2006). Susceptibility to Anaplasma infection may differ substantially in small mammals as reservoir hosts (Bown et al. 2003, Stuen 2007).

Stuen (2007) points out that different genetic variants may exist within the same herd and even simultaneously in the same animal. The fact that the cloned sequences showed varieties could indicate that hedgehogs also harbor different strains. This conclusion has to be confirmed in additional experiments by targeting another Anaplasma gene.

The A. phagocytophilum sequences obtained from the organ pools of the dissected animals were almost identical to the sequences from the ticks removed from hedgehogs. This leads to the assumption that hedgehogs are competent reservoir hosts for several A. phagocytophilum strains.

Considering that hedgehogs are infested with both tick species and share their habitats with humans and domestic animals, zoonotic transmission of Anaplasma species is easily conceivable. The hedgehog tick (I. hexagonus), which attacks humans only sporadically, could serve as a vector within hedgehog populations, thus leading to high infection rates. This increases the probability that I. ricinus, which is also common in hedgehogs, transfers pathogens from a natural hedgehog cycle to other vertebrates, including humans.

Due to the existence of various A. phagocytophilum strains, it is necessary to demonstrate in further studies whether the strains detected in hedgehogs are pathogenic to humans and/or domestic animals.

The DNA sequences of this study were submitted to GenBank, where they received the following accession numbers: FN390873, FN390874, FN390875, FN390876, FN390877, FN390878, FN390879, FN390880, FN390881, FN390882, FN390883, FN390884, FN390885, FN390886, FN390887, FN390888, FN390889, FN390890, FN390891, FN390892, FN390893, FN390894, and FN390895.