Questing Ticks in Suburban Forest Are Infected by at Least Six Tick-Borne Pathogens

Abstract

The role of Ixodes ricinus ticks in the transmission of pathogens of public health importance such as Borrelia burgdorferi s.l. is widely recognized and is suspected in several emerging vector-borne pathogens in Europe. Here, we assess prevalence rates of several endemic and emerging zoonotic pathogens in tick populations in an area of high human population density in France, to contribute to a risk assessment for potential transmission to humans. Pathogen prevalence rates were evaluated by polymerase chain reaction detection and sequencing in questing ticks, individually for adults and in pools of 10 for nymphs. In addition to finding micro-organisms corresponding to symbionts, we found high prevalence rates of B. burgdorferi s.l. (32% of adult females and 10% of nymphs) and low to moderate ones of Anaplasma phagocytophilum (∼1%), spotted fever group Rickettsia spp. (∼6%), Babesia sp. EU1 (∼1%), Bartonella birtlesii (0.1%), and Francisella tularensis (∼1%). Our findings extend the knowledge of the geographical distribution of these endemic and emergent pathogens and support the conclusion that ticks are important vectors of pathogenic micro-organisms in suburban forests. Moreover, tick coinfection with multiple pathogens was found to occur frequently, which poses a serious challenge for diagnosis and appropriate treatment. The incrimination of these pathogens in potentially severe pathologies requires widespread surveillance to assess the risk of infection, thereby facilitating diagnosis and treatment, as well as raising local awareness of tick-borne diseases.

Introduction

T he emergence of tick-borne diseases is becoming an increasing problem due to the intensification of human and animal movements and environmental changes. The impact of tick-borne diseases on human public health in United States and Europe has been recognized since the early 1980s, with the emergence of Lyme borreliosis (LB) caused by Borrelia burgdorferi s.l. (Wormser 2006), which is transmitted by hard ticks, and mainly Ixodes ricinus, the most abundant and widespread tick species in Europe. Since, other human pathogens transmitted by I. ricinus have been considered as emerging, including Anaplasma phagocytophilum, spotted fever group (SFG) Rickettsia spp., Babesia spp., Francisella tularensis, and very likely Bartonella spp. [see review by Parola and Raoult (2001)]. I. ricinus feeds on a diverse class of vertebrates and can bite humans. Consequently, this obligate hematophagous acarine transmits a variety of pathogenic organisms that can cause mild to severe illness and even death in humans, domesticated animals and wildlife.

In Europe, I. ricinus transmits nine different genospecies belonging to B. burgdorferi s.l., of which, B. burgdorferi s.s., Borrelia afzelii, Borrelia garinii, Borrelia spielmanii, and Borrelia bavariensis are pathogenic to humans (Collares-Pereira et al. 2004). Various small mammals and birds are considered reservoirs of Borrelia spp., which are regarded as emerging pathogens, with the number of human cases of lyme disease increasing in Europe (Smith and Takkinen 2006). This is also the case for A. phagocytophilum a Gram-negative, obligate intracellular bacterium that invade neutrophils and cause tick-borne fever in pets and ruminants, and human granulocytic anaplasmosis [see review by Woldehiwet (2010)]. Disease incidence closely follows the distribution of I. ricinus, its main vector in Europe, and small rodents, deer, sheep, and migrating birds have been suggested as potential reservoirs of the bacteria (Woldehiwet 2010). Tick-borne rickettsioses have been increasingly reported from around the world (Parola et al. 2005). They are caused by SFG rickettsiae, a group of obligate intracellular alpha-proteobacteria. At least 15 different Rickettsia species are responsible for the spotted fever syndrome in humans, including Rickettsia rickettsii, Rickettsia conorii, and Rickettsia helvetica (Parola et al. 2005). SFG rickettsiae are transmitted via several arthropod vectors and most notably ticks, which are considered to be their main reservoir (Socolovschi et al. 2009). Babesiosis is an emerging, tick-transmitted zoonotic disease caused by intraerythrocytic protozoan parasites of the genus Babesia. Among the Babesia species pathogenic for humans, the bovine parasite Babesia divergens transmitted by I. ricinus is thought to be responsible for most European cases of human babesiosis, especially in splenectomized patients (Hunfeld et al. 2008). However, since 2003, cases of human babesiosis have also been attributed to a newly described Babesia species, Babesia sp. (EU1) (Herwaldt et al. 2003). The potential wild reservoir of this Babesia species is believed to be roe deer and the vector to be I. ricinus, as suggested by in vivo (Bonnet et al. 2007a, Becker et al. 2009) and in vitro studies (Bonnet et al. 2009). F. tularensis is a highly infectious, Gram-negative bacillus that causes tularemia, a potentially fatal, multisystemic disease of humans and some animals (rodents, rabbits, sheep). The disease can be transmitted to humans by a number of different routes, including tick bites (Foley and Nieto 2010). Tularemia occurs in the northern hemisphere and small animals such as rabbits, hares, voles, and muskrats serve as reservoir hosts (Foley and Nieto 2010). Last, Bartonella, a facultative intracellular bacteria genus, has been recently associated with several emerging diseases in humans and animals, and recent reports involving humans, cats, and canines suggest that ticks are potential vectors of Bartonella spp. (Billeter et al. 2008). Cotté et al. (2008) have provided experimental evidence that I. ricinus is a competent vector of Bartonella henselae, the agent of cat scratch disease and three human cases of neck lymphadenopathy following tick bites have been recently attributed to B. henselae (Angelakis et al. 2010). A wide range of mammalian hosts, including domestic and wild animals, such as cats, mice, deer, and cattle serve as reservoir hosts for the 26 described Bartonella spp. among which at least 13 species are responsible for human and animal diseases (Boulouis et al. 2005).

To date, there have been few reports on tick infection with several zoonotic pathogens detected simultaneously (Smith and Takkinen 2006, Cotté et al. 2010, Toledo et al. 2009, Halos et al. 2010, Reye et al. 2010), and there is a need to conduct studies estimating the risk of infection for the exposed population. The increase in outdoor recreational activities favors encounters between ticks and humans. Indeed, even if ticks are rare in highly urbanized environments, suburban habitats associated with natural woodland provide excellent habitats. In addition, ticks can harbor two or more infectious agents and transmit them simultaneously (Swanson et al. 2006). Consequently, it is also important to determine the prevalence of tick coinfections, which is significant for the correct diagnostic and prophylaxis of tick-borne diseases. Thus, this study aims to evaluate I. ricinus infection with B. burgdorferi s.l., Anaplasma spp., SFG Rickettsia spp., Babesia spp., F. tularensis, and Bartonella spp. in one of the largest and most visited forests near Paris, France, and to identify the pathogen species within each genus. Because of the different transmission patterns of such pathogens and different ecological cycles and habits of both tick life stages and pathogens, which are linked to the risk of tick-borne diseases transmission, we also compare the prevalence of infection between nymphs, and female and male adult ticks.

Materials and Methods

Study area and ticks collection

Questing ticks (nymphs and adults) were collected in wooded habitat, from April to June 2008, using the flagging method by drawing 1 m² cotton cloth over the vegetation (Vassallo et al. 2000) in Sénart Forest (48° 40′ North, 2° 29′ East). Three hours of dragging were performed at each sampling in the same part of the forest, a plot of land of 100 × 200 m located in the South of the forest. All specimens, returned alive to the laboratory, were then identified to the species level by using taxonomic keys (Pérez-Eid 2007), categorized by sex and life stage, and frozen at −20°C before DNA extraction. Sénart Forest is one of the oldest and largest (30 km²) state forests of the administrative region of Ile de France (IdF) (France) and one of the most populated metropolitan areas in Europe (974 inhabitants/km²). This forest is located in the southern Paris metropolitan area in the middle of an urban zone. It is predominantly deciduous and hosts a large number of large mammals (wild boar and roe deer), small rodents, and birds, offering an appropriate environment for ticks. Because of its location and the recreational activities available, the forest is visited by over 3 million people every year (www.valdyerres.com/portail/La-foret-de-Senart,144.html).

DNA extraction

Ticks were crushed, individually for adults and in pools of 10 for nymphs, by shaking with a bead beater (mixer mill MM301; Qiagen, Hilden, Germany) as previously described (Halos et al. 2004). DNA was extracted using the Nucleospin Tissue kit according to the manufacturer's instructions (Macherey-Nagel, Duren, Germany). The final elution volume was 50 μL for adults and 100 μL for pools of nymphs. The DNA extracts were then stored at −20°C until used. The efficiency of DNA extraction was confirmed in all samples by polymerase chain reaction (PCR) amplification of the 16S rRNA mitochondrial gene using tick-specific primers TQ16S+1F (5′-CTGCTCAATGATTTTTTAAATTGCTGTGG-3′) and TQ16S-2R (5′-ACGCTGTTATCCCTAGAG-3′), as described (Black and Piesman 1994).

PCR amplification

The presence of B. burgdorferi s.l., Anaplasma spp., SFG Rickettsia spp., Babesia spp., F. tularensis, and Bartonella spp. DNA in tick DNA extracts was tested by PCR using specific primers for each pathogen. The primer sets used in this study and PCR conditions are listed in Table 1. All PCRs were performed in a thermocycler MyCycler (Bio-Rad, Strasbourg, France). Each reaction was carried out in 25 μL volume containing 0.5 μmol/μL of each primer, 2.5 mM of each dNTP, 2.5 μL of 10 × PCR buffer, and 1 U of Taq DNA polymerase (Takara Biomedical Group, Shiga, Japan) and 5 μL of the DNA extract. Negative (sterile water) and positive controls were included in each run.

Table 1.

Primers and Polymerase Chain Reaction Conditions Used for Detection of Pathogens in Ixodes Ricinus

Organism detected	Target gene	Primer sequence (5′ → 3′)	Product size (bp)	Melting temperature	Reference
Borrelia burgdorferi s.l.	16S rRNA	16SLDF: ATGCACACTTGGTGTTAACTA	357	Denaturation 95°C 8 min	Marconi et al. (1992)
		16SLDR: GACTTATCACCGGCAGTCTTA		Hybridization 35 cycles: 95°C 60 s, 53°C 60 s, 72°C 60 s
				Extension 72°C 10 min
Anaplasma spp.	16S rRNA	EHR16SD: GGT ACC YAC AGA AGA AGT CC	330	Denaturation 95°C 8 min	Hornok et al. (2008)
		EHR16SR: TAG CAC TCA TCG TTT ACA GC		Hybridization 35 cycles: 95°C 60 s, 54°C 60 s, 72°C 60 s
				Extension 72°C 10 min
Rickettsia spp.	Citrate synthase	Rsfg877: GGGGGCCTGCTCACGGCGG	380	Denaturation 95°C 8 min	Regnery et al. (1991)
		Rsfg1258: ATTGCAAAAAGTACAGTGAACA		Hybridization 5 cycles: 95°C 60 s, 58°C 60 s, 72°C 60 s
				35 cycles: 95°C 60 s, 51°C 60 s, 72°C 60 s
				Extension 72°C 10 min
Babesia-Theileria spp.	18S rDNA	BABGF2: GYYTTGTAATTGGAATGATGG	359	Denaturation 94°C 8 min	Bonnet et al. (2007b)
		BABGR2: CCAAAGACTTTGATTTCTCTC		Hybridization 35 cycles: 94°C 60 s, 60°C 60 s, 72°C 60 s
				Extension 72°C 10 min
Francisella tularensis	Putative peptidyl-propyl cis-trans isomerase	FtC1: TCCGGT TGG ATA GGT GTT GGA TT	181	Denaturation 95°C 8 min	Johansson et al. (2000)
		FtC4: GCG CGG ATA ATT TAA ATT TCT CAT A		Hybridization 5 cycles: 95°C 60 s, 51°C 60 s, 72°C 60 s
				35 cycles: 95°C 60 s, 53°C 60 s, 72°C 60 s
				Extension 72°C 10 min
Bartonella spp.	Citrate synthase	bart781: GGGGACCAGCTCATGGTGG	356	Denaturation 95°C 8 min	Norman et al. (1995)
		bart1137: AATGCAAAAAGAACAGTAAACA		Hybridization 35 cycles: 95°C 30 s, 54°C 30 s, 72°C 30 s
				Extension 72°C 10 min

Positives controls were kindly provided by D. Raoult (Unit for Research on Emergent and Tropical Infectious Diseases [URMITE], Marseille, France) for SFG Rickettsia spp. and F. tularensis DNA, M. Jouglin (BioEpar, INRA, Nantes, France) for B. divergens. DNA, E. Ferquel (CNR Borrelia, Institut Pasteur, Paris, France) for Borrelia spp. DNA, and J. de la Fuente (IREC, Ciudad Real, Spain) for Anaplasma spp. DNA. Bartonella spp. DNA used for positive control came from our laboratory. The amplicons obtained after amplification were analyzed on 2% agarose gels with 0.1 mg/mL of ethidium bromide and observed under UV light.

Sequencing and sequence analysis

Sequencing was performed on all positive samples by Qiagen, either directly on the PCR product or after extraction from agarose gel and purification using NucleoSpin Extract II (Macherey-Nagel). Sequences were compared with known sequences listed in the GenBank nucleotide sequence databases using the BLAST search option of the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/BLAST).

Statistical analysis

Prevalence rates and exact binomial 95% confidence intervals were calculated for each pathogen in male and female adult ticks independently using Ecological Methodology software (Krebs 1999). Prevalence rates were compared between males and females by the Fisher exact test, using Genstat version 7.1 (VSN International Ltd., Hemel Hempstead, United Kingdom). For the pooled nymph samples, we employed the exact method of Hauck, assuming perfect sensitivity and specificity of our pathogen detection methods (Hauck 1991). Hauck noted a one-to-one relationship between individual level prevalence, π, and the prevalence of positive pools, P. A point estimate for the prevalence rate can thus be obtained from the pool positive rate by \documentclass{aastex}\usepackage{amsbsy}\usepackage{amsfonts}\usepackage{amssymb}\usepackage{bm}\usepackage{mathrsfs}\usepackage{pifont}\usepackage{stmaryrd}\usepackage{textcomp}\usepackage{portland,xspace}\usepackage{amsmath,amsxtra}\pagestyle{empty}\DeclareMathSizes{10}{9}{7}{6} \begin{document}\begin{align*}\pi = 1 - (1 - P) ^{1 /k}\end{align*}\end{document}

where k is the number of nymphs per pool.

Exact 95% confidence intervals were then obtained by assuming a binomial distribution for the number of positive pools (Cowling et al. 1999). Nymph and adult female and/or male samples were then compared and considered significantly different if there was no overlap in 95% confidence intervals. In addition, the estimated nymph prevalence rates were used to estimate the number of individual nymphs infected. Prevalence rates of nymphs and adult ticks were then compared by the Fisher exact test.

Prevalence rates over all the samples were then calculated as the mean of the prevalence rates of the adult females and males and the estimated prevalence rate in nymphs.

Nucleotide sequence accession numbers

Sequence data have been deposited in GenBank. Accession numbers are GU734322 and GU734323 for Borrelia spp. sequences; GU734324, GU734325, GU734326, and GU734327 for Anaplasma spp. sequences; GU734321 for the Rickettsiae sequence; GU734328 for the Babesia sp. EU1 sequence; and GU734319 and GU734320 for the Bartonella spp. sequences.

Results

Tick collection and sample selection

From April to June 2008, a total of 574 ticks were collected from the vegetation, of which 558 were identified as I. ricinus. The remaining ticks were adult Dermacentor reticulatus and excluded from the study. I. ricinus comprised of 360 nymphs and 198 adults (69 females and 129 males). DNA was extracted from 234 samples: 36 pools of 10 nymphs each and 198 single adults. About 227 out of the 234 samples showed an amplified fragment of the I. ricinus 16S rRNA gene and were then included in the study. No amplification products were obtained for seven samples, corresponding to seven males, and were excluded.

Detection of B. burgdorferi s.l. DNA in ticks

Among the 227 samples analyzed by PCR, 70 were positive for B. burgdorferi s.l. generating prevalence rates of 31.9% in females, 19.7% in males, and an estimated 10.4% in nymphs (Table 2). Prevalence of infection was not different between adult males and females (p-value = 0.064), but were significantly higher in adults (combined males and females) than in nymphs (nonoverlapping 95% CI, Fisher exact p-value <0.001). Sixty PCR fragments were successfully sequenced, generating 55 sequences that were related with 100% identity to B. garinii or Borrelia lusitaniae (60%) (accession No. GU734322), B. afzelii or Borrelia valaisiana (36.4%) (accession No. GU734323), and Borrelia miyamotoi (3.6%) (accession No. GQ253925.1) (Table 3); amplified sequences were not sufficiently discriminatory to allow distinction between B. garinii and B. lusitaniae and between B. afzelii and B. valaisiana. Additional sequences of poor quality (which may correspond to coinfections and overlay sequences) showed an identity of between 80% and 94% with B. garinii in four cases (originating from one pool of nymphs, two females, and one male) and with B. afzelii in one case (originating from a female). The mean prevalence rate, over all tick samples analyzed, was 13.3% for B. garinii or B. lusitaniae (21% of the females, 14% of the males, and 5% of nymphs), 5.5% for B. afzelii or B. valaisiana (6% of the females, 5.5% of the males, and 5% of nymphs), and 1.3% for B. miyamotoi (4% of females and 0% of males and nymphs).

Table 2.

Prevalence and 95% Binomial Exact Confidence Intervals of Ixodes ricinus Samples From Sénart Forest (Ile de France, France) That Harbor DNA of Selected Bacteria and Parasites

	Detection of pathogens DNA
	Number of positive samples/number of samples analyzed (%, binomial 95% confidence intervals)
Ixodes ricinus samples	B. burgdorferi s.l.	Anaplasma spp.	Rickettsia spp.	Babesia-Theileria spp.	F. tularensis	Bartonella spp.
Females	22/69 (31.9, 21.8–44.2)	63/69 (91.3, 82.0–96.7)	5/69 (7.3, 2.4–16.1)	1/69 (1.5, 0.04–7.8)	1/69 (1.5, 0.04–7.8)	0/69 (0)
Males	24/122 (19.7, 13.0–27.8)	36/122 (29.5, 21.6–38.4)	7/122 (5.7, 2.3–11.5)	2/122 (1.6, 0.2–5.8)	1/122 (0.82, 0.02–4.5)	0/12 (0)
Nymphs (pool)	24/36 (66.7)	33/36 (91.2)	13/36 (36.1)	3/36 (8.3)	0/36 (0)	3/36 (8.3)
NymphsEstimated prevalence, π	10.4 (6.5–15.5)	22.0 (13.9–33.3)	4.4 (2.3–7.4)	0.87 (0.07–2.5)		0.87 (0.07–2.5)
Overall prevalence	20.6%	47.6%	5.8%	1.3%	0.8%	0.3%

π is a point estimate for the prevalence rate obtained from the nymph pool positive rate (see the Materials and Methods section). Overall prevalence is the mean of adult female and male and estimated nymph prevalence rates.

Table 3.

Repartition of Borrelia burgdorferi s.l. Species Identification in 55 Ixodes ricinus Samples from Sénart Forest (Ile de France, France)

	Borrelia species detected (% of sequences harboring 100% identity)
I. ricinus samples (number of samples)	Borrelia garinii/Borrelia lusitaniae	Borrelia afzelii/Borrelia valaisiana	Borrelia miyamotoi
Females (15)	66.66%	20%	13.33%
Males (18)	72.22%	27.77%	0
Nymphs (22)	45.45%	54.54%	0
Total (55)	60%	36.36%	3.63%

Detection of Anaplasma spp. DNA in ticks

A set of primers binding the 5′ region of the 16S rRNA gene from various members of the family Anaplasmataceae and closely related rickettsial agents was used. About 58.2% of the 227 tick samples analyzed showed an amplification product with this set of primers (Table 2). Prevalence rates were 91.3% in females, 29.5% in males, and an estimated 22.0% in nymphs, leading to an estimated overall prevalence of 47.6% (Table 2). Prevalence of infection was higher in females than in males (p-value < 0.001) and nymphs (nonoverlapping 95% CI, Fisher exact p-value < 0.001); the prevalence rate in adult males was not significantly different from that of nymphs (overlapping 95% CI, Fisher exact p-value = 0.12). Among the 132 amplicons, 131 were successfully sequenced and sequence comparison in GenBank revealed only 2 sequences (1.5%) that were related to A. phagocytophilum with 100% identity (accession No. GU734324). About 33.3% of the sequences were closely related to a bacteria described as uncultured Anaplasma species and isolated from a tick in Korea (GB N°GU075704.1) (97% identity, p-value = 1 × 10⁻¹³⁷). The remaining sequences were related to two symbionts belonging to the Anaplasmataceae family, Candidatus midichloria (accession No. GU734326) and Wolbachia (accession No. GU734327) (56.5% and 7.6% respectively) (Table 4). Finally, an estimated 0.7% carried some A. phagocytophilum DNA with certainty (1.45% of females, 0% males, and 0.66% of nymphs).

Table 4.

Repartition of Anaplasmataceae and Closely Related Rickettsial Agents in 131 Ixodes ricinus Samples from Sénart Forest (Ile de France, France)

	Prevalence of bacteria species detected among sequenced PCR products
I. ricinus samples (number of samples)	Anaplasma phagocytophilum	Anaplasma spp.	Candidatus midichloria	Wolbachia
Females (63)	1.6%	17.4%	81%	0
Males (35)	0	68.6%	28.6%	2.8%
Nymphs (33)	3%	33.3%	39.4%	27.3%
Total (131)	1.5%	30.3%	56.5%	7.6%

PCR, polymerase chain reaction.

Detection of SFG Rickettsia spp. DNA in ticks

Among the 227 samples analyzed by PCR, 25 were positive for SFG Rickettsia spp., giving a mean prevalence rate of 5.8% (prevalence rates were 7.3% in female ticks; 5.7% in males; an estimated 4.4% in individual nymphs) (Table 2). There were no differences in the prevalence of infection between adult males and females (p-value = 0.681), nor between adults and nymphs (overlapping 95% CI, Fisher exact p-value = 0.37). Nineteen Rickettsiae-positive samples were successfully sequenced and were related to R. helvetica (accession No. GU734321).

Detection of Babesia/Theileria spp. DNA in ticks

Among the 227 samples analyzed by PCR, only 3 adults (1.6%) and 3 pools of nymphs (0.9% individual prevalence rates) were positive for Babesia spp. (Table 2). All the samples were successfully sequenced and all were related to Babesia sp. (EU1) (100% identity) (accession no. GU734328). There was an estimated 1.25% overall mean prevalence rate.

Detection of F. tularensis DNA in ticks

Only two (one male and one female) were positive for F. tularensis (1.1%) (Table 2). Because the quality of DNA was too poor, only one sample could be partially sequenced (19% of the amplified fragment) and 26 bp of the sequence were related to F. tularensis (CP000915) (100% identity, p-value = 0.009).

Detection of Bartonella spp. DNA in ticks

Among the 227 samples analyzed by PCR, only 3 pools of nymphs were positive for Bartonella, leading to an overall estimated prevalence of 0.3%. All the samples were sequenced. One sequence was 100% related to a Bartonella strain (p-value = 2e⁻¹⁴⁴) previously isolated from the yellow-necked mouse (Apodemus flavicolis) in Greece (Tea et al. 2004) and related to Bartonella birtlesii (99% identity, p-value = 2e⁻¹⁴⁰) (accession No. GU734319). Concerning the two others, their closest sequenced relative was Arsenophonus nasoniae (98% identity, p-value = 7e⁻¹⁵⁵) (accession No. GU734320), a male-killing endosymbiont of jewel wasps (Gherna et al. 1991). The overall prevalence rate of Bartonella spp. was therefore 0.1%.

Coinfections

Among the 227 samples analyzed, 37 were positive for more than one pathogen (16.3%) (see Table 5). Nineteen adults (9.9%) were coinfected but never with more than two pathogens (Table 5). Twenty-five percent of the nymph pools harbored more than two pathogens, 16.7% more than three pathogens, and 8.3% more than four pathogens.

Table 5.

Ixodes ricinus Adult Ticks Infected with Two Pathogens in Sénart Forest (Ile de France, France) ^a

	Number of infected adult ticks with 2 pathogens (%)
	Bbsl+Aph	Bbsl+Rspp	Bbsl+Bab	Bbsl+Ft	Aph+Rspp	Bab+Rspp
Males	7 (5.7)	2 (1.6)	1 (0.8)	1 (0.8)	1 (0.8)	0 (0)
Females	4 (5.8)	1 (1.4)	0 (0)	0 (0)	1 (1.4)	1 (1.4)

B. burgdorferi s.l. (Bbsl), Anaplasma spp. (including A. phagocytophilum) (Aph), Rickettsia spp. (Rspp), Babesia sp. EU1 (Bab), and F. tularensis (Ft).

Discussion

To date, there has been only one epidemiological survey exploring a large number of human tick-borne pathogens considered as emerging in France (Cotté et al. 2010). Here, we have assessed the infection rate of I. ricinus by six major human pathogens transmitted by I. ricinus and considered as emerging in Europe (B. burgdorferi s.l., A. phagocytophilum, SFG Rickettsia spp., Babesia spp., F. tularensis, and Bartonella spp.) in a suburban forest near Paris, France.

B. burgdorferi s.l. was estimated to occur at a 20% mean overall prevalence rate. If our sampling site is representative of Sénart Forest, the forest would be classified as an LB high risk zone. Reported values of Borrelia prevalence in ticks range from 0% to 36.4% in France (Randolph 2001, Beytout et al. 2007, Halos et al. 2005, 2010). To date, only three studies conducted in IdF (Rambouillet and Fontainebleau forests) to assess the infection rate of I. ricinus by B. burgdorferi s.l. have been published (Pichon et al. 1995, 1999, Zhioua et al. 1996), but none in Sénart Forest. Using results obtained in adult ticks in Rambouillet and Fontainebleau Forests in 1996 where the infection rates were 0% and 9%, respectively (Zhioua et al. 1996) and in Sénart Forest in 2008 (this study), it would seem that the Borrelia infection rate has increased in adult ticks over the last 10 years in IdF. This increase could be explained by the release of the Siberian chipmunk, which is suspected to be a reservoir host for LB, into Sénart Forest from the 1960s (Vourc'h et al. 2007). Indeed, their presence in suburban forests may greatly increase the Borrelia prevalence in ticks and thus may increase the LB risk for humans (Vourc'h et al. 2007). Considering the nymph infection rates, the method of Cowling et al. (1999) enables us to compare ours results with those previously obtained. We found that 10% of the nymphs were infected, a rate very close to that previously found in the Zhioua (12.4%) (Zhioua et al. 1996) and Pichon studies (12% and 8.2%) (1995 and 1999) (Pichon et al. 1995, 1999). Our results showed that there was no significant difference between Borrelia infection in male and female adult ticks. This is in contradiction to other studies that reported a higher infection rate in females (Wodecka 2003, De Meeus et al. 2004), although consistent with a meta-analysis based on 11 European studies (Rauter and Hartung 2005). De Meeûs et al. (2004) suggested difference in prevalence rates between males and females could be explained by the fact that immature males feed on hosts that have lower reservoir competence for B. burgdorferi s.l. The much lower prevalence obtained in nymphs (10%) than in female adults (32%) not only reiterates the importance of adult ticks as an infectious reservoir but also underlines the necessity to take into account tick age structure when assessing prevalence rates.

Borrelia sequences revealed at least 3 species present: 60% of the B. burgdorferi s.l. sequences were related to B. garinii or B. lusitaniae, 36% to B. afzelii or B. valaisiana, and 4% to B. miyamotoi. Sequences obtained were regrettably not sufficiently discriminatory to separate B. garinii and B. lusitaniae or B. afzelii and B. valaisiana, but it is known that all of these species are present in Sénart Forest (E. Ferquel, personnel communication). Although no B. burgdorferi s.s. was detected here, B. afzelii and B. garinii have been already detected in Rambouillet Forest, with a predominance of B. afzelii (Pichon et al. 1995, 1999, Zhioua et al. 1996). Four percent of the Borrelia-positive samples exhibited 100% identity to the relapsing fever Borrelia species B. miyamotoi. This species has been described in ticks in Asia, North America, and Europe (Sweden) (Fukunaga et al. 1995, Scoles et al. 2001, Fraenkel et al. 2002), but this is, to our knowledge, its first description in France.

Anaplasmosis is an important and frequent cause of tick bite fever in all areas where Ixodes ticks bite humans and so thorough intensive surveillance of reservoir hosts, vector, and tick-exposed population is needed. In Europe 0.3% to 23.7% of the ticks have been found infected with A. phagocytophilum (Sanogo et al. 2003, Grzeszczuk and Stanczak 2006) and from 1.25% to 10.7% in central France (Parola et al. 1998, Halos et al. 2010). In our study, we have found an infection rate with A. phagocytophilum (0.7%) comparable to that recently found in western France (0.35%) (Cotté et al. 2010). Sequencing of the fragments amplified with primers specific to Anaplasma genus showed that 33% of the sequences were closely related to a bacteria species described as uncultured Anaplasma spp. and isolated from Haemaphysalis longicornis in Korea, indicating that these bacteria may be transmitted by ticks. These sequences had 95% identity (p-value = 4e⁻¹²⁷) with A. phagocytophilum strains isolated in several countries either from ticks or wild and domestic animals. Whether or not this new species or strain is pathogenic for humans or animals remains to be evaluated.

Six percent of all tick samples were infected with SFG Rickettsia spp. This prevalence rate is a little lower than that reported from central France (8.7%) (Halos et al. 2010), but higher than those recently reported from western France (1.4%) (Cotté et al. 2010). Here, all Rickettsia sequences obtained were related to R. helvetica. To date, the pathogenic potential of this bacterium for humans is unclear, but has been suspected to cause acute perimyocarditis, unexplained febrile illness, and sarcoidosis (Fournier et al. 2004, Nilsson et al. 2005). Consequently, our data suggest that increased attention and vigilance regarding this pathogen are needed. The lack of difference in the prevalence rates in nymphs and adult is surprising and may reflect the significant contribution of transovarial transmission to the overall prevalence rate relative to that from infectious bloodmeals. This contrasts with Borrelia, for which transovarial transmission is believed to occur infrequently.

In Europe, >30 human cases of babesiosis have been reported over the last 50 years, and have been traditionally attributed to infection with the bovine parasite B. divergens transmitted by I. ricinus (Hunfeld et al. 2008). Here all the sequences were 100% related to Babesia sp. EU1, a recently characterized parasite, responsible for three human cases in Austria, Italy, and Germany (Herwaldt et al. 2003, Haselbarth et al. 2007). The absence of Babesia microti was surprising despite this rodent parasite being very widespread in Europe and known to be transmitted by I. ricinus. The absence of cattle and the high density of roe deer in the forest partly explain the sole detection of Babesia sp EU1, since roe deer are strongly suspected of being the reservoir of this species (Duh et al. 2005b, Bonnet et al. 2007a, Pietrobelli et al. 2007). This parasite was detected in I. ricinus for the first time in Slovenia (2.2%) (Duh et al. 2005a). Since then, it has also been reported in Switzerland (0.4%) (Casati et al. 2006), France (40% of larvae originated from females collected on Babesia infected roe deer) (Bonnet et al. 2007a), the Netherlands (0.9%) (Wielinga et al. 2008), and Poland (0.9%) (Cieniuch et al. 2009), and evidence of transmission by I. ricinus has been reported both in vitro (Bonnet et al. 2009) and in vivo (Bonnet et al. 2007a, Becker et al. 2009). Although the clinical signs of human babesiosis are usually limited to splenectomized patients, three new human cases (one attributed to B. divergens, the others to unknown origin) have been very recently detected in immunocompetent patients in eastern France (Martinot, personal communication). It is also noticeable that 0.38% of the French population is splenectomized (Legrand et al. 2005). The proportion of the population at risk of Babesia infection is thus higher than previously suspected and Babesia sp. (EU1) likely represents a real potential agent of an emerging zoonotic disease and needs increased attention and vigilance.

F. tularensis was detected in two adult ticks (one male and one female) among the 227 samples analyzed. This low prevalence is similar to that observed in the Czech Republic (0.2%) (Hubalek and Halouzka 1997), but lower than that in Serbia (3.8%) (Milutinovic et al. 2008). Because of the poor quality of the DNA extracted from ticks, only one sample could be partially sequenced, and, as Francisella-like endosymbionts exist in ticks (Sun et al. 2000), it cannot be excluded that the bacteria detected here may correspond to such a symbiont. The importance of tularemia in France is unknown and probably underestimated, the disease being considered limited to hare and hunter. Its epidemiology is complex since multiple routes of transmission, including tick bites, have been reported (Parola and Raoult 2001, Vaissaire et al. 2005). To date, only a few cases have been identified and the disease is considered rare. However, the importance of the ticks as a reservoir must be taken into consideration, all the more given the potentially severe outcome of tularaemia.

Finally, our study confirms the presence of Bartonella spp. DNA in I. ricinus ticks but at a very low prevalence (0.1% in nymphs only). The presence of Bartonella spp. has been reported in ticks from all over the world. In France, the reported prevalence of Bartonella spp. in questing I. ricinus was 9.8% in the North (Halos et al. 2005) and 0.2% in the West (Cotté et al. 2010). Sequencing the Bartonella-positive sample revealed that it was related to B. birtlesii, a species of Bartonella isolated from wild rodents and, to our knowledge, not pathogenic for humans (Bermond et al. 2000), and never isolated from ticks to date.

Cases of multiple infections with tick-borne pathogens are not rare events in humans (Bjoersdorff et al. 2002, Krause et al. 2002, Hermanowska-Szpakowicz et al. 2004). Many ticks can harbor two or more infectious agents and transmit them simultaneously [see Swanson et al. (2006) for review]. Such a phenomenon is particularly frequent with I. ricinus and can be easily explained by the tick live cycle as it has nonspecific feeding habits and feeds on a variety of vertebrate species that are reservoirs for multiple tick-borne pathogens. To date, there have been few reports on tick coinfections with various pathogens in France and none in IdF. In our study, coinfections were detected in 9.9% of the adult ticks, which underlines the potential risk of multiple infections with tick-borne pathogens. The most common was coinfection with Borrelia spp. and Anaplasma spp. (5.75%), greater than that observed by Wojcik-Fatla et al. (2009) in Europe (1.2%–4.3%). Thus, there is a need to conduct further studies to determine the risk of transmission of multiple infections to humans, which would facilitate correct diagnosis and prophylaxis of tick-borne disease.

Our findings extend the knowledge of the geographic distribution of the studied pathogens and support the conclusion that ticks are important vectors of pathogenic micro-organisms in suburban forests. We demonstrate that in the studied area, I. ricinus were infected with B. burgdorferi s.l., A. phagocytophilum, SFG Rickettsia spp., Babesia spp., Bartonella spp. and very likely F. tularensis. Although our study confirms the ever-increasing diversity of the community of tick-borne pathogens, further work is clearly required in improving pathogen characterization, in evaluating the actual degree of pathogenicity of each pathogen and in measuring the force of infection and associated risk factors. In addition to a more precise description of pathogen prevalence rates in ticks, concomitant prevalence and seroprevalence studies in exposed human populations would be invaluable. To date, because outdoor recreational activities have increased among citizens, urban forests are more frequently visited, thereby increasing the contact of people with ticks and hence the risk of tick-transmitted diseases. Thus, it is important to conduct epidemiological studies to assess the risk of transmission of the aforementioned pathogens, to facilitate the diagnosis and treatment of tick-borne diseases and finally, and to increase public awareness on the potential role of ticks in the spread of infection.

Footnotes

Acknowledgments

The authors thank D. Raoult, M. Jouglin, Dr. E. Ferquel, and J. de la Fuente for providing PCR-positive controls; Dr. E. Ferquel for providing unpublished information; and E. Le Naour, F. Femenia, D. Huet, and M. Vayssier-Taussat for their help in collecting ticks. The authors also thank the “Tiques et Maladies à Tiques” group (REID- Réseau Ecologie des Interactions Durables) for stimulating discussions. This work was supported by research funds from INRA and CIRAD institutes and by the Region Ile de France.

Disclosure Statement

No competing financial interests exist.

References

Angelakis

, Pulcini

, Waton

, Imbert

et al. Scalp eschar and neck lymphadenopathy caused by Bartonella henselae after tick bite. Clin Infect Dis, 2010; 50:549–551.

Becker

, Bouju-Albert

, Jouglin

, Chauvin

et al. Natural transmission of Zoonotic Babesia spp. by Ixodes ricinus ticks. Emerg Infect Dis, 2009; 15:320–322.

Bermond

, Heller

, Barrat

, Delacour

et al.

Bartonella birtlesii sp. nov., isolated from small mammals (Apodemus spp.)

Int J Syst Evol Microbiol, 2000; 50:1973–1979.

Beytout

, George

, Malaval

, Garnier

et al. Lyme borreliosis incidence in two French departments: correlation with infection of Ixodes ricinus ticks by Borrelia burgdorferi sensu lato. Vector Borne Zoonotic Dis, 2007; 7:507–517.

Billeter

, Levy

, Chomel

, Breitschwerdt

. Vector transmission of Bartonella species with emphasis on the potential for tick transmission. Med Vet Entomol, 2008; 22:1–15.

Bjoersdorff

, Wittesjo

, Berglun

, Massung

et al. Human granulocytic ehrlichiosis as a common cause of tick-associated fever in Southeast Sweden: report from a prospective clinical study. Scand J Infect Dis, 2002; 34:187–191.

Black

WCt

, Piesman

. Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc Natl Acad Sci U S A, 1994; 91:10034–10038.

Bonnet

, Brisseau

, Hermouet

, Jouglin

et al. Experimental in vitro transmission of Babesia sp. (EU1) by Ixodes ricinus. Vet Res, 2009; 40:21.

Bonnet

, Jouglin

, L'Hostis

, Chauvin

. Babesia sp. EU1 from roe deer and transmission within Ixodes ricinus. Emerg Infect Dis, 2007a. 13:1208–1210.

10.

Bonnet

, Jouglin

, Malandrin

, Becker

et al. Transstadial and transovarial persistence of Babesia divergens DNA in Ixodes ricinus ticks fed on infected blood in a new skin-feeding technique. Parasitology, 2007b. 134:197–207.

11.

Boulouis

, Chang

, Henn

, Kasten

et al. Factors associated with the rapid emergence of zoonotic Bartonella infections. Vet Res, 2005; 36:383–410.

12.

Casati

, Sager

, Gern

, Piffaretti

. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Ann Agric Environ Med, 2006; 13:65–70.

13.

Cieniuch

, Stanczak

, Ruczaj

. The first detection of Babesia EU1 and Babesia canis canis in Ixodes ricinus ticks (Acari, Ixodidae) collected in urban and rural areas in northern Poland. Pol J Microbiol, 2009; 58:231–236.

14.

Collares-Pereira

, Couceiro

, Franca

, Kurtenbach

et al. First isolation of Borrelia lusitaniae from a human patient. J Clin Microbiol, 2004; 42:1316–1318.

15.

Cotté

, Bonnet

, Cote

, Vayssier-Taussat

. Prevalence of five pathogenic agents in questing Ixodes ricinus ticks from western France. Vector Borne Zoonotic Dis, 2010; 10:723–730.

16.

Cotté

, Bonnet

, Le Rhun

, Le Naour

et al. Transmission of Bartonella henselae by Ixodes ricinus. Emerg Infect Dis, 2008; 14:1074–1080.

17.

Cowling

, Gardner

, Johnson

. Comparison of methods for estimation of individual-level prevalence based on pooled samples. Prev Vet Med, 1999; 39:211–225.

18.

De Meeus

, Lorimier

, Renaud

. Lyme borreliosis agents and the genetics and sex of their vector, Ixodes ricinus. Microbes Infect, 2004; 6:299–304.

19.

Duh

, Petrovec

, Avsic-Zupanc

. Molecular characterization of human pathogen Babesia EU1 in Ixodes ricinus ticks from Slovenia. J Parasitol, 2005a. 91:463–465.

20.

Duh

, Petrovec

, Bidovec

, Avsic-Zupanc

. Cervids as Babesiae hosts, Slovenia. Emerg Infect Dis, 2005b. 11:1121–1123.

21.

Foley

, Nieto

. Tularemia. Vet Microbiol, 2010; 140:332–338.

22.

Fournier

, Allombert

, Supputamongkol

, Caruso

et al. Aneruptive fever associated with antibodies to Rickettsia helvetica in Europe and Thailand. J Clin Microbiol, 2004; 42:816–818.

23.

Fraenkel

, Garpmo

, Berglund

. Determination of novel Borrelia genospecies in Swedish Ixodes ricinus ticks. J Clin Microbiol, 2002; 40:3308–3312.

24.

Fukunaga

, Takahashi

, Tsuruta

, Matsushita

et al. Genetic and phenotypic analysis of Borrelia miyamotoi sp. nov., isolated from the ixodid tick Ixodes persulcatus, the vector for Lyme disease in Japan. Int J Syst Bacteriol, 1995; 45:804–810.

25.

Gherna

, Werren

, Weisburg

, Cote

et al. Arsenophonus-nasoniae Gen-Nov, Sp-Nov, the causative agent of the son-killer trait in the parasitic wasp Nasonia vitripennis. Int J Syst Evol Microbiol, 1991; 41:563–565.

26.

Grzeszczuk

, Stanczak

. High prevalence of Anaplasma phagocytophilum infection in ticks removed from human skin in north-eastern Poland. Ann Agric Environ Med, 2006; 13:45–48.

27.

Halos

, Bord

, Cotte

, Gasqui

et al. Ecological factors characterizing the prevalence of bacterial tick-borne pathogens in Ixodes ricinus ticks in pastures and woodlands. Appl Environ Microbiol, 2010; 76:4413–4420.

28.

Halos

, Jamal

, Maillard

, Beugnet

et al. Evidence of Bartonella sp. in questing adult and nymphal Ixodes ricinus ticks from France and co-infection with Borrelia burgdorferi sensu lato and Babesia sp. Vet Res, 2005; 36:79–87.

29.

Halos

, Jamal

, Vial

, Maillard

et al. Determination of an efficient and reliable method for DNA extraction from ticks. Vet Res, 2004; 35:709–713.

30.

Haselbarth

, Tenter

, Brade

, Krieger

et al. First case of human babesiosis in Germany—clinical presentation and molecular characterisation of the pathogen. Int J Med Microbiol, 2007; 297:197–204.

31.

Hauck

. Confidence intervals for seroprevalence determined from pooled sera. Ann Epidemiol, 1991; 1:277–281.

32.

Hermanowska-Szpakowicz

, Skotarczak

, Kondrusik

, Rymaszewska

et al. Detecting DNAs of Anaplasma phagocytophilum and Babesia in the blood of patients suspected of Lyme disease. Ann Agric Environ Med, 2004; 11:351–354.

33.

Herwaldt

, Caccio

, Gherlinzoni

, Aspock

et al. Molecular characterization of a non-Babesia divergens organism causing zoonotic babesiosis in Europe. Emerg Infect Dis, 2003; 9:942–948.

34.

Hornok

, Foldvari

, Elek

, Naranjo

et al.

Molecular identification of Anaplasma marginale and rickettsial endosymbionts in blood-sucking flies (Diptera: Tabanidae, Muscidae) and hard ticks (Acari: Ixodidae)

Vet Parasitol, 2008; 154:354–359.

35.

Hubalek

, Halouzka

. Mosquitoes (Diptera: Culicidae), in contrast to ticks (Acari: Ixodidae), do not carry Francisella tularensis in a natural focus of tularemia in the Czech Republic. J Med Entomol, 1997; 34:660–663.

36.

Hunfeld

, Hildebrandt

, Gray

. Babesiosis: recent insights into an ancient disease. Int J Parasitol, 2008; 38:1219–1237.

37.

Johansson

, Ibrahim

, Goransson

, Eriksson

et al. Evaluation of PCR-based methods for discrimination of Francisella species and subspecies and development of a specific PCR that distinguishes the two major subspecies of Francisella tularensis. J Clin Microbiol, 2003; 38:4180–4185.

38.

Krause

, McKay

, Thompson

, Sikand

et al. Disease-specific diagnosis of coinfecting tickborne zoonoses: babesiosis, human granulocytic ehrlichiosis, and Lyme disease. Clin Infect Dis, 2002; 34:1184–1191.

39.

Krebs

. Ecological Methodology. Harlow: Addison Wesley Longman, 1999.

40.

Legrand

, Bignon

, Borel

, Zerbib

et al.

[Perioperative management of asplenic patients]

Ann Fr Anesth Reanim, 2005; 24:807–813.

41.

Marconi

, Lubke

, Hauglum

, Garon

. Species-specific identification of and distinction between Borrelia burgdorferi genomic groups by using 16S rRNA-directed oligonucleotide probes. J Clin Microbiol, 1992; 30:628–632.

42.

Milutinovic

, Masuzawa

, Tomanovic

, Radulovic

et al. Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Francisella tularensis and their co-infections in host-seeking Ixodes ricinus ticks collected in Serbia. Exp Appl Acarol, 2008; 45:171–183.

43.

Nilsson

, Lukinius

, Pahlson

, Moron

et al. Evidence of Rickettsia spp. infection in Sweden: a clinical, ultrastructural and serological study. APMIS, 2005; 113:126–134.

44.

Norman

, Regnery

, Jameson

, Greene

et al. Differentiation of Bartonella-like isolates at the species level by PCR-restriction fragment length polymorphism in the citrate synthase gene. J Clin Microbiol, 1995; 33:1797–1803.

45.

Parola

, Beati

, Cambon

, Brouqui

et al. Ehrlichial DNA amplified from Ixodes ricinus (Acari: Ixodidae) in France. J Med Entomol, 1998; 35:180–183.

46.

Parola

, Paddock

, Raoult

. Tick-borne rickettsioses around the world: emerging diseases challenging old concepts. Clin Microbiol Rev, 2005; 18:719–756.

47.

Parola

, Raoult

. Tick-borne bacterial diseases emerging in Europe. Clin Microbiol Infect, 2001; 7:80–83.

48.

Pérez-Eid

. Les Tiques: Identification, Biologie, Importance Médicale Et Vétérinaire. Paris: Lavoisier, 2007.

49.

Pichon

, Godfroid

, Hoyois

, Bollen

et al. Simultaneous infection of Ixodes ricinus nymphs by two Borrelia burgdorferi sensu lato species: possible implications for clinical manifestations. Emerg Infect Dis, 1995; 1:89–90.

50.

Pichon

, Mousson

, Figureau

, Rodhain

et al. Density of deer in relation to the prevalence of Borrelia burgdorferi s.l. in Ixodes ricinus nymphs in Rambouillet forest, France. Exp Appl Acarol, 1999; 23:267–275.

51.

Pietrobelli

, Cancrini

, Moretti

, Tampieri

. Animal babesiosis: an emerging zoonosis also in Italy? Parassitologia, 2007; 49,Suppl 1:33–38.

52.

Randolph

. The shifting landscape of tick-borne zoonoses: tick-borne encephalitis and Lyme borreliosis in Europe. Philos Trans R Soc Lond B Biol Sci, 2001; 356:1045–1056.

53.

Rauter

, Hartung

. Prevalence of Borrelia burgdorferi sensu lato genospecies in Ixodes ricinus ticks in Europe: a metaanalysis. Appl Environ Microbiol, 2005; 71:7203–7216.

54.

Regnery

, Spruill

, Plikaytis

. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol, 1991; 173:1576–1589.

55.

Reye

, Hubschen

, Sausy

, Muller

. Prevalence and seasonality of tick-borne pathogens in questing Ixodes ricinus ticks from Luxembourg. Appl Environ Microbiol, 2010; 76:2923–2931.

56.

Sanogo

, Parola

, Shpynov

, Camicas

et al. Genetic diversity of bacterial agents detected in ticks removed from asymptomatic patients in northeastern Italy. Ann N Y Acad Sci, 2003; 990:182–190.

57.

Scoles

, Papero

, Beati

, Fish

. A relapsing fever group spirochete transmitted by Ixodes scapularis ticks. Vector Borne Zoonotic Dis, 2001; 1:21–34.

58.

Smith

, Takkinen

. Lyme borreliosis: Europe-wide coordinated surveillance and action needed? Euro Surveill, 2006; 11:E060622.1.

59.

Socolovschi

, Mediannikov

, Raoult

, Parola

The relationship between spotted fever group Rickettsiae and ixodid ticks. Vet Res, 2009; 40:34.

60.

Swanson

, Neitzel

, Reed

, Belongia

. Coinfections acquired from ixodes ticks. Clin Microbiol Rev, 2006; 19:708–727.

61.

Sun

, Scoles

, Fish

, O'Neill

. Francisella-like endosymbionts of ticks. J Invertebr Pathol, 2000; 76:301–303.

62.

Tea

, Alexiou-Daniel

, Papoutsi

, Papa

et al. Bartonella species isolated from rodents, Greece. Emerg Infect Dis, 2004; 10:963–964.

63.

Toledo

, Olmeda

, Escudero

, Jado

et al. Tick-borne zoonotic bacteria in ticks collected from central Spain. Am J Trop Med Hyg, 2009; 81:67–74.

64.

Vaissaire

, Mendy

, Le Doujet

, Le Coustumier

. [Tularemia. The disease and its epidemiology in France] Med Mal Infect, 2005; 35:273–280.

65.

Vassallo

, Pichon

, Cabaret

, Figureau

et al. Methodology for sampling questing nymphs of Ixodes ricinus (Acari: Ixodidae), the principal vector of Lyme disease in Europe. J Med Entomol, 2000; 37:335–339.

66.

Vourc'h

, Marmet

, Chassagne

, Bord

et al. Borrelia burgdorferi Sensu Lato in Siberian chipmunks (Tamias sibiricus) introduced in suburban forests in France. Vector Borne Zoonotic Dis, 2007; 7:637–641.

67.

Wielinga

, Fonville

, Sprong

, Gaasenbeek

et al. Persistent detection of Babesia EU1 and Babesia microti in Ixodes ricinus in The Netherlands during a 5-year surveillance: 2003–2007. Vector Borne Zoonotic Dis, 2009; 9:119–122.

68.

Wodecka

. Detection of Borrelia burgdorferi sensu lato DNA in Ixodes ricinus ticks in North-western Poland. Ann Agric Environ Med, 2003; 10:171–178.

69.

Wojcik-Fatla

, Szymanska

, Wdowiak

, Buczek

et al. Coincidence of three pathogens (Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti) in Ixodes ricinus ticks in the Lublin macroregion. Ann Agric Environ Med, 2009; 16:151–158.

70.

Woldehiwet

. The natural history of Anaplasma phagocytophilum. Vet Parasitol, 2010; 167:108–122.

71.

Wormser

. Clinical practice. Early Lyme disease. N Engl J Med, 2006; 354:2794–2801.

72.

Zhioua

, Postic

, Rodhain

, Perez-Eid

. Infection of Ixodes ricinus (Acari:Ixodidae) by Borrelia burgdorferi in Ile de France. J Med Entomol, 1996; 33:694–697.