Bovine Trypanosomiasis an Emerging Disease in Maranhão State

Abstract

In South American countries, bovine trypanosomiasis is caused mainly by Trypanosoma vivax. Among the infected animals, bovines are considered more susceptible, and this susceptibility varies among breeds. To determine the occurrence of T. vivax in Maranhão State, Brazil, a total of 559 cattle blood samples were collected for molecular and parasitological studies. On São Luís Island, no parasites were observed in the parasitological exam; however, with the polymerase chain reaction (PCR) method, three samples (1.06%) were positive. In four municipalities that compose the Pedreiras Basin, 3.39% of the animals were positive on the parasitological exam, and 6.21% of animals were positive by PCR. This finding demonstrates that PCR is more sensitive and confirms that the method is very useful in epidemiological surveys. A further interesting point is that molecular studies clearly define the differences in surface glycoproteins and antigenic variants.

Introduction

I n South America, Africa, and Asia (including China), the trypanosomes Trypanosoma evansi and Trypanosoma vivax represent a potential risk for >500 million cattle, 100 million buffaloes, and 12 million camels. However, both infections can be effectively controlled with chemotherapeutic agents or chemoprophylaxis, associated with the control of the arthropod vectors (Peregrine 1994).

In South American countries, bovine trypanosomiasis is caused mainly by T. vivax, which is considered the most pathogenic and important agent among the protozoa that affect cattle in veterinary practice. The infection not only occurs in cattle and buffaloes but can also be found in capybaras and wild ungulates such as deer. Although wild ungulates may serve as reservoirs for the parasite, there is no evidence that this is of epidemiological importance (Osório et al. 2008). The parasite is usually transmitted cyclically by tse-tse flies (in Africa) and mechanically by other blood-sucking insects, such as Stomoxys calcitrans (Seidl et al. 2002) and tabanids.

The first recorded occurrence of T. vivax was in Africa in 1912 (Desquesnes 1997). The trypanosome was most likely introduced into Latin America during European colonization, either with infected cattle from Senegal in 1830 or with Spanish settlers by the 15th century (D'ávila et al. 2003). In South America, the infection was recorded successively in Guyana (1919), Venezuela (1920), Guadalupe (1926), Martinique (1929), Colombia (1931), Suriname (1938), Panama (1941), Guyana (1952), El Salvador (1977), Costa Rica (1977), Ecuador (1977), Peru (1977), and Paraguay (1977) (Shaw and Lainson 1972, Paiva et al. 2000, Jones and D'ávila 2001, Cortez et al. 2008).

In Brazil, the first cases of bovine trypanosomiasis caused by T. vivax were recorded in Pará State by Boulhosa (1946). Thirty-four years later, Shaw and Lainson (1972) also described the occurrence of this parasite in buffaloes (Bubalus bubalis) from Pará State followed by the states of Amapá and Tocantins. In the central region, the parasite was reported in the Pantanal, Mato Grosso, and Mato Grosso do Sul; whereas it has also been found in the southeast (São Paulo), in the south (Rio Grande do Sul), and in the northeast (Paraiba) (Shaw and Lainson 1972, Silva et al. 1996, 2009, Paiva et al. 1997, Serra-Freire 1981, Linhares et al. 2006, Batista et al. 2008).

Since the 1980s, T. vivax has been known to circulate in cattle herds of Maranhão State; however, the first recorded occurrence in the state was in 2006 (Guerra et al. 2008). The disease was described on a farm where the calves had clinical signs of anemia, pallid mucous membranes, and one animal died. After the examination of blood smears, trypomastigotes of T. vivax were identified.

With the high influx of animals due to trade among South American countries, greater understanding of this disease in farm animals is necessary. The diagnosis of T. vivax infection is a challenge because of the low parasitemia observed in most animals, which reinforces the importance of the need for knowledge of the epidemiology of this disease, coupled with the fact that there are no data for the state of Maranhão to enable us to assess the disease's impact.

Considering the cattle trade among municipalities and the possibility of the spread of T. vivax infection, this study aimed at detecting the infection in cattle from Maranhão State, northeastern Brazil, and at comparing the sensitivity of two diagnostic methods.

Materials and Methods

Study area and blood collection

The study was performed on São Luis Island (2°31′ Lat. S; 44°16′ Long.), which is composed of the municipalities of São Luís, Raposa, Paço do Lumiar, São José de Ribamar, and the Pedreiras Basin, which comprises the counties of Pedreiras, Trizidela do Vale, Bernardo do Mearim, and Igarapé Grande. For this study, 559 blood samples were analyzed from cattle from different farms, using a molecular method and a parasitological exam.

For the parasitological diagnosis, samples of peripheral blood were obtained from auricular vessels and smears were performed immediately, whereas blood samples for DNA extraction were collected from the jugular vein in vacutainer tubes with anticoagulant (EDTA) and stored at a temperature of −20°C.

Parasitological and molecular analysis

Thin blood smears and buffy coat smears were made and stained with Giemsa before examining the slides in an optical microscopic to determine the presence of trypomastigote forms.

DNA was extracted from 300 μL of whole blood employing the Wizard^® Genomic DNA Purification kit (Promega) following the manufacturer's recommendations. Polymerase chain reactions (PCRs) were performed for Trypanosoma spp. according to Njiru et al. (2005), by amplifying a 250 bp fragment of the T. vivax ITS1 rDNA.

The reaction was processed in 0.5 mL tubes employing a final volume of 25 μL, consisting of 4 μL of DNA solution from the test samples and 21 μL of Master Mix reaction buffer (Promega) containing 50 units/mL Taq DNA polymerase supplied in a reaction buffer (pH 8.5), 3.0 mM MgCl₂, 400 μM of each dNTP (dATP, dGTP, dCTP, and dTTP), 1.5 mM of each primer (Invitrogen), and nuclease-free water to complete the final volume. The tubes were incubated in a Biocycle thermocycler, using the following sequence of cycles: an initial step of 94°C for 5 min, 35 cycles of 94°C for 40 s, 58°C for 40 s, and 72°C for 40 s, finishing with a step at 72°C for 5 min.

PCR amplification was performed with ITS1CF 5′ CCGGAAGTTCACCGATATTG 3′ and ITS1BR 5′ TTGCTGCGTTCTTCAACGAA 3′ primers developed by D'ávila et al. (2003). The positive control was kindly provided by Imunoblot Laboratory. The strain was obtained during an outbreak of bovine trypanosomiasis in Paraiba State as described by Batista et al. (2008).

The products of PCRs were subjected to electrophoresis on a 1% agarose gel, and this was subsequently stained with a solution of ethidium bromide (0.5 mg/mL) for 15 min. Amplified products were visualized using a UV transilluminator.

Results

No trypomastigotes of Trypanosoma were observed in the buffy coat and blood smears of samples taken from São Luis Island. However, with the PCR method, three samples (1.06%) were positive for T. vivax. The PCR amplification revealed a 250 bp fragment of the ITS1 gene, thereby establishing a definitive diagnosis of infection by this hematozoan.

The T. vivax-positive animals were from the municipality of São Luís. At one of the properties, sporadic abortions had occurred in the final third of pregnancy and the infected cow gave birth to a weak calf that died in the first weeks of life. During the sampling period, tabanids were observed precisely during the rainy season. No clinical signs suggestive of trypanosomiasis were detected.

In the Pedreiras Basin, the parasitological exam showed that six animals (3.39%), in the age group between two and 5 years old and that were females, out of 177 were positive for T. vivax. However, in the PCR analysis, 11 animals (6.21%) were revealed to be infected; with this technique, the parasite was detected on farms from all the municipalities investigated. In these four counties, the bovines presented clinical signs of trypanosomiasis.

Discussion

According to our results, T. vivax is not endemic in Maranhão State, and probably the cases identified were due to introduction of cattle from areas where the parasite is common. However, it should be considered that although the parasite is not endemic, the state is home to the possible vector (tabanids), the parasite (as demonstrated in this study), and susceptible animals, thus raising the possibility of the infection spreading throughout the state, especially in the Pedreiras Basin, regarded as a major area of transit and trade of livestock.

In the current study, the PCR was clearly more sensitive than microscopy, providing confirmation of infection in animals that have low parasitemia and in the ones that were supposedly negative in the parasitological exam. Similar results were obtained in 2003 in the Pantanal region, in central-west Brazil, where a large number of T. vivax-positive animals were detected by this technique (44.7%); whereas only 0.5% were positive by parasitological examination (D'ávila et al. 2003). In other research in eastern Venezuela in 1991 and 1998, a rate of 3.4% was reported (Perrone et al. 1991, Aray et al. 1998); whereas in southeastern Brazil, in 2006, researchers found a much higher rate of infection of 18% (Madruga et al. 2006), although these studies employed serological techniques; meanwhile, in El Salvador in 1997, 15% of blood smears were identified as containing trypomastigotes (Wells et al. 1997).

When an animal presents a high parasitemia, mechanical transmission is possible in the presence of blood-sucking insects. Extravascular foci and/or competition between subpopulations of variable antigen types may explain why T. vivax apparently disappears or becomes puzzling in its manifestations in enzootic areas (Desquesnes 1997).

The diagnosis of infection by T. vivax is a challenge because of low parasitemia observed in the majority of infections and this is usually determined by the host immune system, which has a key role in establishing the wave pattern of parasitemia and sets the order of expression of antigenic variants. Although this process is not yet fully elucidated, it is not random as different isolates of the same species, in different geographic locations, often express different repertoires of variants (Gray 2006).

Despite the infection having been recorded in different regions of Brazil, studies of natural herds have demonstrated that T. vivax generally does not cause disease and leads to chronic and asymptomatic infection (D'ávila et al. 2003) as was the case in the present study. Additionally, South American T. vivax is transmitted mechanically and shows small numbers of serodemes and continuous infection, leading to an equilibrium of the disease. However, outbreaks of trypanosomiasis have been described in Brazil, especially in the Brazilian Pantanal (Silva et al. 1996) and the Brazilian semiarid regions (Batista et al. 2007).

Several studies have shown that calves are more resistant than adult cattle and can infect, survive, and become carriers. The adult cattle may develop severe disease leading to death or miscarriage, even before diagnosis is reached and treatment can be initiated (Mwongela et al. 1981). In the municipality of São Luís despite the absence of clinical signs, in one of the proprieties, sporadic abortion was notified.

The infection of cattle can cause subacute infection, resulting in death within a few weeks of infection or, more commonly, the disease follows a chronic course associated with low parasitemia and progressive disease development (Gardiner et al. 1989) as observed in the Pedreiras Basin.

Although we cannot be sure that tabanids are the vectors of T. vivax in Maranhão, as they can be transmitted by a variety of blood-sucking insects, tabanids were seen during the sampling period, especially in the rainy season. In Colombia, Otte et al. (1994) found a positive relationship between the presence of the parasite and an increase in the tabanid population.

Considering that the first record of the infection in the State of Maranhão was in another municipality (Guerra et al. 2008), our data also suggest that the infection is spreading.

According to Jones and D'ávila (2001), T. vivax in the New World is a pathogen that spreads beyond its original distribution due to human action, crossing thousands of kilometers between Africa and South America. Likewise, in Maranhão State, we believe that T. vivax was not endemic but was rather brought by animals introduced from an endemic area, subsequently finding here abundant vectors (tabanids) and susceptible animals.

Footnotes

Acknowledgments

The authors wish to thank Dr. Rosangela Zacarias Machado and Dr. Celio Raimundo Machado who provided the sample of T. vivax. This research was supported by FAPEMA—Fundação de Amparo a Pesquisa e ao Desenvolvimento Científico e Tecnológico do Maranhão (APP00490/2006 FAPEMA/CNPq). Solange de Araújo Melo and Francisco Borges Costa hold scholarship from CAPES—Coordenação de Aperfeiçoamento de Pessoal de Nível Superior.

Disclosure Statement

No competing financial interests exist.

References

Aray

, Uzcanga

, Soto

, Mendoza

. Ensayo inmunoenzimático para el diagnóstico de la tripanosomiasis bovina causada por Trypanosoma sp. Seroprevalencia en el município Monagas del Estado Guárico-Venezuela. Rev Cient Fac Cienc Vet Univ Zulia, 1998; 8:114–116.

Batista

, Bezerra

FSB

, Lira

, Carvalho

JRG

et al. Aspectos clínicos, epidemiológicos e patológicos da infecção natural em bovinos por Trypanosoma vivax na Paraíba. Pesq Vet Bras, 2008; 28:63–69.

Batista

, Riet-Correa

, Teixeira

MMG

, Madruga

et al. Trypanosomiasis by Trypanosoma vivax in cattle in the Brazilian semiarid: description of an outbreak and lesions in the nervous system. Vet Parasitol, 2007; 143:174–181.

Boulhosa

. Informação Científica, Boletim Técnico: Ministério da Agricultura, 1946; 21–26.

Cortez

, Ventura

, Rodrigues

, Batista

et al. The taxonomic and phylogenetic relationships of Trypanosoma vivax from South America and Africa. Parasitology, 2008; 133:159–169.

D'ávila

AMR

, Herrera

, Schlebinger

, Sousa

et al. Using PCR for unraveling the cryptic epizootiology of livestock trypanosomosis in the Pantanal, Brazil. Vet Parasitol, 2003; 117:1–13.

Desquesnes

. Evaluation of a simple PCR technique for the diagnosis of Trypanosoma vivax infection in the serum of cattle in comparison to parasitological techniques and antigen-enzyme-linked immunosorbent assay. Acta Trop, 1997; 65:139–148.

Gardiner

, Assoku

RKG

, Whitelaw

, Murray

. Haemorragic lesions resulting from Trypanosoma Vivax infection in Ayrshire Cattle. Vet Parasitol, 1989; 31:187–198.

Gray

. The antigenic relationships of strains of Trypanosoma brucei isolated in Nigeria. J Gen Microbiol, 2006; 44:263–271.

10.

Guerra

RMSNC

, Feitosa

Jr. , Santos

, Abreu-Silva

et al. Biometry of Trypanosoma vivax found in a calf in the state of Maranhão, Brazil. Cienc Rural, 2008; 38:833–835.

11.

Jones

, D'ávila

AMR

. Trypanosoma vivax out of Africa. Trends Parasitol, 2001; 17:99–101.

12.

Linhares

GFC

, Dias Filho

, Fernandes

, Duarte

. Tripanossomíase em bovinos no município de Formoso do Araguaia, Tocantins (Relato de caso) Cienc Anim Bras, 2006; 7:455–460.

13.

Madruga

, Araújo

, Cavalcante-Goes

, Martins

et al. The development of an enzymelinked immunosorbent assay for Trypanosoma vivax antibodies and its use in epidemiological surveys. Mem Inst Oswaldo Cruz, 2006; 101:801–807.

14.

Mwongela

, Kovatch

, Frazil

. Acute Trypanosoma vivax infection in dairy cattle in Coast Province, Kenya. Trop Anim Health Prod, 1981; 13:63–69.

15.

Njiru

, Constantine

, Guya

, Crowther

et al. The use of ITS1 rDNA PCR in detecting pathogenic African trypanosomes. Parasitol Res, 2005; 95:186–192.

16.

Osório

ALAR

, Madruga

, Desquenes

, Soares

et al. Trypanosoma (Duttonela) vivax: its biology, epidemiology, pathogenesis and introduction in the New World—a review. Mem Inst Oswaldo Cruz, 2008; 103:1–13.

17.

Otte

, Abuabara

, Wells

. Trypanosoma vivax in Colômbia: epidemiology and production losses. Trop Anim Health Prod, 1994; 26:146–156.

18.

Paiva

, Lemos

RAA

, Nakazato

, Mori

et al. Trypanosoma vivax em bovinos no Pantanal do Mato Grosso do Sul, Brasil. I. Acompanhamento clínico, laboratorial e anatomo-patológico de rebanhos infectados. Rev Bras Parasitol Vet, 2000; 9:135–141.

19.

Paiva

, Lemos

RAA

, Oshiro

, Salvador

et al. Ocorrência de Trypanosoma vivax em bovinos no Estado de Mato Grosso do Sul. Rev Bras Parasitol Vet, 1997; 6:349.

20.

Peregrine

. Chemotherapy and delivery systems: haemoparasites. Vet Parasitol, 1994; 54:223–248.

21.

Perrone

, Lesseur

, Reverón

, Espinoza

et al. Análisis seroepidemiológico de la tripanosomiasis bovina en la zona de Santa María de Ipire. Acta Cient Venez, 1991; 42:208.

22.

Plata

. Nota preliminar sobre una trypanosomiais del ganado vacuno en Bolívar. Rev Med Vet Bogota, 1931; 3:77–79.

23.

Serra-Freire

. Oiapoque–outro foco de Trypanosoma vivax no Brasil. Rev Bras Med Vet, 1981; 4:30–31.

24.

Shaw

, Lainson

. Trypanosoma vivax in Brazil. Ann Trop Med Parasitol, 1972; 66:25–32.

25.

Silva

, Costa

, Polenz

et al. Primeiro registro de Trypanosoma vivax em bovinos no Estado do Rio Grande do Sul, Brasil. Cienc Rural, 2009; 39:2550–2554.

26.

Silva

RAMS

, Da Silva

, Schneider

, De Freitas

et al. Outbreak of trypanosomiasis due to Trypanosoma vivax (Ziemann, 1905) in bovines of the Pantanal, Brazil. Mem Inst Oswaldo Cruz, 1996; 91:561–562.

27.

Wells

, Betancourt

, Ramirez

. Serological evidence for the geographical distribution of Trypanosoma vivax in the New World. Trans R Soc Trop Med Hyg, 1977; 71:448–449.

Bovine Trypanosomiasis an Emerging Disease in Maranhão State–Brazil