Detection and Characterization of Babesia Species in Ixodes Ticks in Estonia

Abstract

The presence of Babesia spp. was studied in 2603 Ixodes ricinus and Ixodes persulcatus ticks collected at seven sites in Estonia. By reverse line blot screening, Babesia spp. was detected in 36 (1.4%) ticks, among them 18 (0.7%) were further recognized by a Babesia microti probe, 3 (0.1%) by a Babesia divergens probe, and the other 15 (0.6%) were recognized only by the universal Babesia spp. “catch all” probe. Sequence analyses of 6 of these 15 samples revealed that all of them belonged to Babesia sp. EU1. B. microti was detected in both tick species I. ricinus and I. persulcatus at the seven sites, whereas B. divergens-like and Babesia sp. EU1 were found only in I. persulcatus and I. ricinus, respectively. Genetic characterization based on partial 18S rRNA showed that the Estonian sequences of B. microti, B. divergens-like, and Babesia sp. EU1 share a high rate of similarity and are closely related to sequences from other European countries, Siberia, and United States. The present study demonstrated for the first time the existence and distribution of Babesia spp. in I. persulcatus and I. ricinus ticks in Estonia.

Introduction

B abesia (Apicomplexa, Piroplasmida) are protozoan parasites transmitted by Ixodes ticks to mammals and infecting the host erythrocytes. Babesia microti and Babesia divergens are the main etiologic agents of human babesiosis in the United States and Europe, respectively (Telford et al. 1993, Brasseur and Gorenflot 1996). In Europe, ∼40 human cases in splenectomized or immunocompromised patients due to B. divergens and B. divergens-like infections have been reported (Vannier and Krause 2009) with up to 42% mortality rate (Gorenflot et al. 1998). Moreover, a new non-B. divergens species EU1 (proposed name Babesia venatorum) has been recently described as a human pathogen in Italy, Austria, and Germany (Herwaldt et al. 2003, Häselbarth et al. 2007) and also detected in ticks and roe deer (Telford and Goethert 2004, Duh et al. 2005, Casati et al. 2006, Bonnet et al. 2007). The first European human case caused by B. microti was reported in Germany (Hildebrandt et al. 2007) and a wide distribution of this pathogen in ticks and small mammals has been demonstrated in Europe (Duh et al. 2001, Skotarczak and Cichocka 2001, Foppa et al. 2002, Goether and Telford 2003, Kalman et al. 2003). In Estonia, no human cases due to Babesia infection have been registered. However, human cases have been reported in neighboring countries such as Sweden and Finland (Uhnoo et al. 1992, Haapasalo et al. 2010), and the circulation of Babesia in the tick population was reported in Lithuania and Norway (Radzijevskaja et al. 2008).

Ticks from the genus Ixodes spp. are the main vectors involved in Babesia transmission. In Estonia, two tick species, I. ricinus and I. persulcatus, are prevalent and widely distributed, whereas in other European countries, I. ricinus is the most representative tick and plays a central role in the transmission of Babesia spp. The distribution of I. persulcatus is restricted to southeastern Estonia, whereas I. ricinus circulates in the whole territory of Estonia (Golovljova et al. 2004).

No studies concerning Babesia have been performed in Estonia. The present study was undertaken to investigate the prevalence of Babesia in ticks collected from different parts of Estonia and to characterize the pathogen by molecular methods.

Materials and Methods

Collection of ticks

Tick sampling was performed from April to November 2006–2008 at different sites in Estonia (Andineeme, Oonurme, Laeva, Järvselja, Kilingi-Nõmme, Are, Puhtu) (Fig. 1). Ticks were collected from the vegetation by flagging and pooled into groups of five adults or nymphs according to tick species, sampling date, and place of collection. Ticks (adults and nymphs) from incomplete pools were processed individually. Pools or individual ticks were washed with sterile phosphate-buffered saline, homogenized in 400 μL of phosphate-buffered saline and stored at −70°C. Two hundred microliters of suspension was used for DNA extraction.

FIG. 1.

Tick sampling sites in Estonia (Andineeme, Oonurme, Laeva, Järvselja, Kilingi-Nõmme, Are, Puhtu) and the prevalence of Babesia spp. The areas of Ixodes persulcatus and Ixodes ricinus distribution are indicated.

DNA extraction

DNA was extracted with TriPure RNA isolation reagent (Roche Diagnostics) according to the manufacturer's instructions, resuspended in 50 μL of water, and stored at −20°C.

Polymerase chain reaction for the amplification of partial 18S rRNA gene and reverse-line blot hybridization

For screening of ticks, reverse-line blot (RLB) was performed as described earlier (Gubbels et al. 1999). Briefly, the partial 18S rRNA gene of the Babesia spp. was amplified with forward primer RLB-F2 and reverse primer RLB-R2 (Table 1). Polymerase chain reaction (PCR) amplification was carried out in a total reaction volume of 50 μL, which contained the following mix of reagents: GeneAmp 10 × PCR buffer II, MgCl₂ (1 mM), dNTPs (200 μM) (Fermentas, EE), 500 nM of forward and reverse primers, AmpliTaq DNA polymerase (1.25 U; Applied Biosystems, Roche), and 10 μL of target DNA. The PCR conditions consisted of a denaturation step of 3 min at 94°C; followed by 10 cycles of touchdown program, consisting of 20 s of denaturation at 94°C, 30 s at annealing temperature decreased from 67°C to 58°C in each cycle, and an extension step of 30 s at 72°C; and then 40 cycles of denaturing step of 20 s at 94°C, an annealing step of 30 s at 57°C, and an extension step of 30 s at 72°C. A final extension step of 10 min at 72°C completed the program.

Table 1.

Sequences of Oligonucleotide Probes and Polymerase Chain Reaction Primers Used for the Detection of Babesia Spp. in Ticks

Oligonucleotide probes or primers	Sequences of oligonucleotide probes and PCR primers (5′→3′)	References
Probes
Babesia spp. (“catch all”)	5′amino-TAATGGTTAATAGGARCRGTTG	Oura et al. (2004)
Babesia microti	5′amino-CTTCCGAGCGTTTTTTTATT	Garcia-Sanmartin et al. (2008)
Babesia divergens	5′amino-GTTAATATTGACTAATGTCGA	Gubbels et al. (1999)
Primers for RLB and sequencing
RLB-F2	GACACAGGGAGGTAGTGACAAG	Georges et al. (2001)
RLB-R2	5′biotin-CTAAGAATTTCACCTCTGACAGT	Georges et al. (2001)
PIRO-A	ATTACCCAATCCTGACACAGGG	Armstrong et al. (1998)
PIRO-B	TTAAATACGAATGCCCCCAAC	Armstrong et al. (1998)

PCR, polymerase chain; RLB, reverse-line blot.

Preparation of RLB membrane, hybridization, and subsequent stripping of the membrane were carried out as previously described (Gubbels et al. 1999), with the following modifications. The amplification reaction volume (50 μL) was loaded onto the blot after dilution with 2 × SSPE (360mM NaCl, 20 mM Na₂HPO₄ × H₂O, 2 mM EDTA)–0.1% sodium dodecyl sulfate to a total volume of 150 μL. The temperature of the two 10-min posthybridization washes in 2 × SSPE–0.5% sodium dodecyl sulfate was increased to 51°C. After developing, the PCR products were stripped from the membrane.

All the nucleotide sequences of the species-specific oligonucleotide probes containing a N-terminal N-(trifluoracetamidohexyl-cyanoethyle, N,N-diisopropyl phoshoramidite)-C6 amino linker were synthesized by TAGC. The sequences of the oligonucleotide probes are shown in Table 1.

Sequencing of the partial 18S rRNA gene

The samples positive by the RLB assay were amplified by nested PCR for sequencing of the partial 18S rRNA gene with outer primers PIRO-A and RLB-R2 and inner primers RLB-F2 and PIRO-B (Table 1). The PCR amplifications were performed in a total volume of 25 μL as follows: GeneAmp 10 × PCR buffer II, MgCl₂ 1.5 mM for the first PCR and 0.5 mM for the nested PCR, dNTPs 200 μM for the first PCR and 400 μM for the nested PCR, 1 μM of forward and reverse primers, AmpliTaq DNA polymerase (1.25 U; Applied Biosystems, Roche), and 5 μL of target DNA. The cycling conditions were an initial denaturation for 1 min at 94°C, followed by 40 cycles of 1 min at 94°C, 1 min at 59°C, and 1 min at 72°C. For the nested PCR, the annealing temperature was 55°C.

The amplified products of the nested PCR were purified with GFX-PCR kit (Amersham Biosciences) according to the manufacturer's instructions. The purified PCR products were used as templates in the sequencing reaction using the dideoxynucleotide chain termination method with BigDye Terminator Cycle Sequencing Ready Reagent Kit (ABI PRISM, PE Applied Biosystems). The ABI PRISM 3100 Genetic Analyzer (Applied Biosystems) was used for sequence analysis. The obtained sequences were edited using the BioEdit program (www.mbio.ncsu.edu/BioEdit/bioedit.html).

Phylogenetic analysis

Phylogenetic analysis was carried out with the TREE-PUZZLE 5.2 version package. For phylogenetic tree reconstruction, a quartet puzzling Maximum Likelihood method was used and 10,000 puzzling steps were applied using the Hasegawa-Kishino-Yano model for substitution (Hasegawa et al. 1985). The sequences of the partial 18S rRNA genes for the Babesia species were retrieved from the GenBank database and aligned by BioEdit program (www.mbio.ncsu.edu/BioEdit/bioedit.html). A Plasmodium falciparum 18S rRNA sequence was included as outgroup.

Nucleotide sequence accession numbers

The sequences of the partial 18S rRNA gene detected in the present study were deposited in the GenBank database under numbers running from HQ629933 to HQ629948.

Results

Detection of Babesia sp. in ticks by RLB hybridization

A total of 2603 ticks including 938 I. persulcatus (577 adults and 361 nymphs) and 1665 I. ricinus (587 adults and 1078 nymphs) were collected from different parts of Estonia in 2006–2008 (Fig. 1).

All ticks were tested for the presence of Babesia spp. by RLB. The presence of Babesia was detected in 36 pools of ticks (1.4%), among them 18 (0.7%) were recognized by the B. microti probe, 3 (0.1%) by B. divergens probe, and the other 15 (0.6%) were recognized only by the universal Babesia spp. “catch all” probe on the membrane (Table 2). B. microti was detected in 4 pools of I. persulcatus (3 pools of females and 1 pool of males) from the eastern part of Estonia (Laeva, Oonurme and Järvselja) and in 14 I. ricinus nymph pools, which were collected in the western part of Estonia (Andineeme, Puhtu, Are, and Kilingi-Nõmme). Three pools—I. persulcatus (two males and one female) from the Järvselja collection site—reacted with the B. divergens probe. Fifteen tick pools (13 pools of I. ricinus nymphs and 2 of I. persulcatus) with undetermined Babesia species by RLB originated from Oonurme, Puhtu, Laeva, Andineeme, Kilingi-Nõmme, and Are. The minimum infection rate was calculated by assuming that only one tick out of five in a pool was positive. The prevalence rates of Babesia species at different geographical sites are shown in Figure 1 and Table 2.

Table 2.

Babesia Sp. Detection in Ticks by Reverse-Line Blot Hybridization

Sampling sites	Species of tick	B. microti No. of infected samples/no. of investigated samples (MIR %)	B. divergens No. of infected samples/no. of investigated samples (MIR %)	Babesia sp. No. of infected samples/no. of investigated samples (MIR %)	Total No. of infected samples/no. of investigated samples (MIR %)
Puhtu	Ixodes ricinus	2/475 (0.4%)	0/475	4/475 (0.8%) (2 EU1)^a	6/475 (1.3%)
Are		4/321 (1.2%)	0/321	1/321 (0.3%)	5/321 (1.5%)
Andineme		3/359 (0.8%)	0/359	1/359 (0.3%) (1 EU1)^a	4/359 (1.1%)
Kilingi-Nõmme		5/345 (1.4%)	0/345	5/345 (1.4%) (1 EU1)^a	10/345 (2.9%)
Oonurme	Ixodes persulcatus	1/209 (0.5%)	0/209	1/209 (0.5%)	2/240 (0.8%)
	I. ricinus	0/31	0/31	0/31
Laeva	I. persulcatus	1/320 (0.3%)	0/320	1/320 (0.3%)	4/417 (0.9%)
	I. ricinus	0/97	0/97	2/97 (2%) (2 EU1)^a
Järvselja	I. persulcatus	2/409 (0.5%)	3/409 (0.7%)	0/409	5/446 (1.1%)
	I. ricinus	0/37	0/37	0/37
Total		18/2603 (0.7%)	3/2603 (0.1%)	15/2603 (0.6%) (6 EU1)^a	36/2603 (1.4%)

No. of samples confirmed as EU1 by sequencing.

MIR, minimum infection rate.

Sequencing and phylogenetic analysis of partial 18S rRNA gene

For confirmation of the Babesia findings, 16 samples found to be positive by RLB (8 recognized by the B. microti probe, 2 recognized by the B. divergens probe, and 6 recognized by the Babesia spp. “catch all” probe) were amplified and sequenced in the 18S rRNA gene region.

B. microti DNA was amplified from I. persulcatus (Est603, Est884) and I. ricinus (Est 923, Est939, Est941, Est1033, Est1078, Est1098). Seven of eight amplicons were found identical for the 378-bp amplicon of the 18S rRNA gene to sequences previously found in a human blood sample (GenBank EF413181) in Germany and also to sequences from I. ricinus ticks and rodents from Slovenia (GenBank AF373332, AY149572) and Switzerland (GenBank AF494286). However, the sequence of the B. microti sample Est884 differed from the other Estonian sequences by two nucleotide substitutions at positions 614 (A/G) and 699 (T/C), which made it distinct from other published sequences by at least one substitution. On the phylogenetic tree, the Estonian B. microti samples clustered together with strains belonging to the zoonotic “US” type, which is distributed worldwide, and has been reported as pathogenic for humans (Gray et al. 2010) (Fig. 2). The Estonian sequences share a high rate of similarity (99.7%–100%) with other sequences belonging to the “US” type; 98.4% similarity was found with sequences belonging to the Hobetsu and Kobe types, whereas the lowest similarity rate (95.8%–96.3%) was demonstrated with Munich-type strains.

FIG. 2.

Phylogenetic tree based on partial 18S rRNA gene (378 bp) sequences of Babesia species. The phylogenetic tree was constructed using the quartet puzzling maximum likelihood method (TREE-PUZZLE program). The numbers on the nodes are bootstrap values based on 10,000 replicates (only values >70% are shown). Plasmodium falciparum has been used as the outgroup. The GenBank accession numbers for the sequences used in the present study are given. Est923* is identical to sequences Est939, Est941, Est1033, Est1078, and Est1098; Est788** is identical to sequences Est670, Est916, Est1148, Est1362, and Est1444. The Estonian sequences from this study are in bold.

The two B. divergens-like samples (Est622 and Est746) were amplified from I. persulcatus ticks and generated 350-bp amplicons of the partial 18S rRNA gene. They were identical to sequences previously detected in roe deer and reported as B. divergens in Slovenia (GenBank AY572456), Poland (GenBank DQ083544), and Spain (GenBank DQ866844), whereas identical sequences were classified as Babesia capreoli in France (GenBank AY726009, FJ944827, FJ944828). Therefore, the distinction between the two closely related Babesia species, B. divergens and B. capreoli, remains questionable. We reported our Estonian sequences as B. divergens-like, although the Estonian samples had G at nucleotide position 631 and T at nucleotide position 663 of the 18S rRNA gene as that was proposed as a feature of B. capreoli (Malandrin et al. 2010). Other B. divergens and B. divergens-like sequences from Europe, United States, and West Siberia showed 98.2%–99.7% of identity with the Estonian samples amplified in the present study (Fig. 2).

The 6 sequenced samples (Est788, Est670, Est916, Est1148, Est1362, and Est1444) of the 15 ones found to be positive by RLB only with the universal Babesia spp. probe were identified as EU1 after sequencing. All six were amplified from I. ricinus ticks and produced 350-bp amplicons that were identical to the Babesia sp. EU1 sequences detected from I. ricinus in France (GenBank FJ215873) and Slovenia (GenBank AY553915), from roe deer in Slovenia (GenBank AY572457) and France (GenBank EF185818), from human blood in Italy (GenBank AY046575), and from I. persulcatus in West Siberia (GenBank GU734773) (Fig. 2). Babesia sp. EU1 was found only in I. ricinus even in an area (Laeva) where the proportion of I. ricinus ticks is only 20%.

Discussion

The present study revealed for the first time the presence of Babesia in Estonia. Our data showed that the potentially pathogenic species B. microti, Babesia sp. EU1, and B. divergens-like circulated in I. ricinus and I. persulcatus ticks in different areas in Estonia, with a total prevalence rate of 1.4%. A similar prevalence in ticks has been reported from South Germany (1%) (Hartelt et al. 2004) and Switzerland (0.7%–1.7%) (Casati et al. 2006). However, much higher Babesia spp. prevalence rates were reported in I. ricinus ticks from Slovenia (9.6%) (Duh et al. 2001), France (6.1%–20.6%) (Halos et al. 2005, Cotté et al. 2010), and Austria (51.8%) (Blaschitz et al. 2008). The distribution of infected ticks is mosaic and varies during seasons and years; thus, a comparison of tick-borne pathogen prevalence rates between countries should be performed with caution.

B. microti was the most frequently found Babesia species in Estonia. We found identical B. microti sequences in I. persulcatus and I. ricinus ticks; thus, we suggest that both tick species play a role in the transmission and maintenance of B. microti in natural foci in Estonia. All detected sequences clustered together with zoonotic “US”-type B. microti strains, which were widely distributed in Europe, United States, and West Siberia. The possibility to utilize several Ixodes species as vector may be the reason for worldwide spreading of B. microti “US”-type strains.

We found B. divergens-like (probably B. capreoli) sequences only in I. persulcatus ticks, whereas in the other European countries such as Slovenia, Germany, and Switzerland, this species of Babesia was detected in I. ricinus (Duh et al. 2001, Hartelt et al. 2004, Casati et al. 2006). Moreover, the Estonian strains were identical to the other European strains in the partial 18S rRNA gene region; thus, we suggest that B. divergens could use both tick vectors for its transmission and maintenance in natural foci (Fig. 2).

In the present study, Babesia sp. EU1 was detected only in I. ricinus ticks even in areas where I. persulcatus predominated (85% of collected ticks). Recently, it was demonstrated that I. ricinus is a competent vector for Babesia sp. EU1 (Bonnet et al. 2007, 2009, Becker et al. 2009). However, Babesia sp. EU1 was found also in I. persulcatus, suggesting it as a vector in West Siberia (Rar et al. 2010). Our Estonian sequences were identical to the European as well as Siberian ones in the partial 18S rRNA gene region (Fig. 2). Thus, it needs to be clarified whether Babesia sp. EU1 is not able to utilize I. persulcatus as a vector in Estonia or the detection of this Babesia species only in I. ricinus is due to a collection bias.

A close relationship of the Estonian and other Babesia sequences was confirmed by phylogenetic analysis. On the phylogenetic tree based on the partial 18S rRNA gene, the Estonian sequences clustered together with other B. microti, B. divergens/B. divergens-like, and Babesia sp. EU1 sequences from Europe, United States, and West Siberia with a high bootstrap support (Fig. 2). Moreover, the analyzed sequences of B. microti and Babesia sp. EU1 were identical in the 18S partial gene region to sequences reported in ill humans, although until now there have been no reports of human infection due to Babesia spp. in Estonia.

The results of the present study demonstrated for the first time the presence of B. microti, B. divergens-like, and Babesia sp. EU1 in natural populations of Ixodes ticks in Estonia, which should be considered as a possible risk of transmission to humans.

Footnotes

Acknowledgments

The authors are grateful to Tatjana Avsic-Zupanc for providing DNA of B. divergens and B. microti. This work was supported by the Estonian Science Foundation (Grant ETF 6938), VISBY project 01347/2007, and also the EU Grant Goce-2003-010284 EDEN; it is cataloged by the EDEN Steering Committee as EDEN0223.

Disclaimer

The contents of this publication are the sole responsibility of the authors and do not necessarily reflect the views of the European Commission.

Disclosure Statement

No competing financial interests exist.

References

Armstrong

, Katavolos

, Caporale

, Smith

et al.

Diversity of Babesia infecting deer ticks (Ixodes dammini)

Am J Trop Med Hyg, 1998; 58:739–742.

Becker

, Bouju-Albert

, Jouglin

, Chauvin

, Malandrin

. Natural transmission of zoonotic Babesia sp. by Ixodes ricinus ticks. Emerg Infect Dis, 2009; 15:320–322.

Blaschitz

, Narodoslavsky-Gfoller

, Kanzler

, Stanek

, Walochnik

. Babesia sp. occurring in Austrian Ixodes ricinus ticks. Appl Environ Microbiol, 2008; 74:4841–4846.

Bonnet

, Brisseau

, Helmouet

, Jouglin

, Chauvin

. Experimental in vitro transmission of Babesia sp. (EU1) by Ixodes ricinus. Vet Res, 2009; 40:21.

Bonnet

, Jouglin

, L'Hostis

, Chauvin

. Babesia sp. EU1 from roe deer and transmission within Ixodes ricinus. Emerg Infect Dis, 2007; 13:1208–1210.

Brasseur

, Gorenflot

. Human babesial infections in Europe. Rocz Akad Med Bialymst, 1996; 41:117–122.

Casati

, Sager

, Gern

, Piffaretti

. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Ann Agric Environ Med, 2006; 13:65–70.

Cotté

, Bonnet

, Cote

, Vayssier-Taussat

. Prevalence of five pathogenic agents in questing Ixodes ricinus ticks from Western France. Vector Borne Zoonot Dis, 2010; 10:723–730.

Duh

, Petrovec

, Avsic-Zupanc

. Diversity of Babesia infecting European sheep ticks (Ixodes ricinus) J Clin Microbiol, 2001; 39:3395–3397.

10.

Duh

, Petrovec

, Avsic-Zupanc

. Molecular characterization of human pathogen Babesia EU1 in Ixodes ricinus ticks from Slovenia. J Parasitol, 2005; 91:463–465.

11.

Foppa

, Krause

, Spielman

, Goethert

et al. Entomologic and serologic evidence of zoonotic transmission of Babesia microti, eastern Switzerland. Emerg Infect Dis, 2002; 8:722–726.

12.

Garcia-Sanmartin

, Barandika

, Juste

, Garcia-Perez

, Hurtado

. Distribution and molecular detection of Theileria and Babesia in questing ticks from Northern Spain. Med Vet Entomol, 2008; 22:318–325.

13.

Georges

, Loria

, Riili

, Greco

et al. Detection of haemoparasites in cattle by reverse line blot hybridisation with a note on the distribution of ticks in Sicily. Vet Parasitol, 2001; 99:273–286.

14.

Goethert

, Telford , SR

III

. What is Babesia microti? Parasitology, 2003; 127:301–309.

15.

Golovljova

, Vene

, Brus Sjölander

, Vasilenko

et al. Characterization of tick-borne encephalitis virus from Estonia. J Med Virol, 2004; 74:580–588.

16.

Gorenflot

, Moubri

, Precigout

, Carcy

, Schetters

. Human babesiosis. Ann Trop Med Parasitol, 1998; 92:489–501.

17.

Gray

, Zintl

, Hildebrandt

, Hunfeld

, Weiss

. Zoonotic babesiosis: overview of the disease and novel aspects of pathogen identity. Ticks Tick Borne Dis, 2010; 1:3–10.

18.

Gubbels

, de Vos

, van der Weide

, Viseras

et al. Simultaneous detection of bovine Theileria and Babesia sp. by reverse line blot hybridization. J Clin Microbiol, 1999; 37:1782–1789.

19.

Haapasalo

, Suomalainen

, Sukura

, Siikamaki

, Jokiranta

. Fatal babesiosis in man, Finland, 2004. Emerg Infect Dis, 2010; 16:1116–1118.

20.

Halos

, Jamal

, Maillard

, Beugnet

et al. Evidence of Bartonella sp. in questing adult and nymphal Ixodes ricinus ticks from France and co-infection with Borrelia burgdorferi sensu lato and Babesia sp. Vet Res, 2005; 36:79–87.

21.

Hartelt

, Oehme

, Frank

, Brockmann

et al. Pathogens and symbionts in ticks: prevalence of Anaplasma phagocytophilum (Ehrlichia sp.), Wolbachia sp., Rickettsia sp., and Babesia sp. in Southern Germany. Int J Med Microbiol, 2004; 293,Suppl 37:86–92.

22.

Hasegawa

, Kishino

, Yano

. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. J Mol Evol, 1985; 22:160–174.

23.

Häselbarth

, Tenter

, Brade

, Krieger

, Hunfeld

. First case of human babesiosis in Germany—clinical presentation and molecular characterisation of the pathogen. Int J Med Microbiol, 2007; 297:197–204.

24.

Herwaldt

, Caccio

, Gherlinzoni

, Aspock

et al. Molecular characterization of a non-Babesia divergens organism causing zoonotic babesiosis in Europe. Emerg Infect Dis, 2003; 9:942–948.

25.

Hildebrandt

, Hunfeld

, Baier

, Krumbholz

et al. First confirmed autochthonous case of human Babesia microti infection in Europe. Eur J Clin Microbiol Infect Dis, 2007; 26:595–601.

26.

Kalman

, Sreter

, Szell

, Egyed

. Babesia microti infection of anthropophilic ticks (Ixodes ricinus) in Hungary. Ann Trop Med Parasitol, 2003; 97:317–319.

27.

Malandrin

, Jouglin

, Syn

, Brisseau

, Chauvin

. Redescription of Babesia capreoli (Enigk and Friedhoff, 1962) from roe deer (Capreolus capreolus): isolation, cultivation, host specificity, molecular characterisation and differentiation from Babesia divergens. Int J Parasitol, 2010; 40:277–284.

28.

Oura

, Bishop

, Wampande

, Lubega

, Tait

. Application of a reverse line blot assay to the study of haemoparasites in cattle in Uganda. Int J Parasitol, 2004; 34:603–613.

29.

Radzijevskaja

, Paulauskas

, Rosef

. Prevalence of Anaplasma phagocytophilum and Babesia divergens in Ixodes ricinus ticks from Lithuania and Norway. Int J Med Microbiol, 2008; 298:218–221.

30.

Rar

, Epikhina

, Livanova

, Panov

. Genetic diversity of Babesia in Ixodes persulcatus and small mammals from North Ural and West Siberia, Russia. Parasitology, 2010; 132:175–182.

31.

Skotarczak

, Cichocka

. The occurrence of DNA of Babesia microti in ticks Ixodes ricinus in the Florest areas of Szczecin. Folia Biol, 2001; 49:247–250.

32.

Telford

III , Goethert

. Emerging tick-borne infections: rediscovered and better characterized, or truly “new”? Parasitology, 2004; 129:301–327.

33.

Telford

III , Gorenflot

, Brasseur

, Spielman

. Babesial infections in humans, wildlife. Kreier

. Parasitic Protozoa, 2nd 5. San Diego, CA: Academic Press, 1993; 1–47.

34.

Uhnoo

, Cars

, Christensson

, Nystrom-Rosander

. First documented case of human babesiosis in Sweden. Scand J Infect Dis, 1992; 24:541–547.

35.

Vannier

, Krause

. Update on babesiosis. Interdiscip Perspect Infect Dis, 2009; 2009:984568.